1. spacer 2.5|479738|32|LR134151|PILER-CR matches to MT843276 (Serratia phage vB_SspS_OS31, complete genome) position: , mismatch: 0, identity: 1.0
ttaaaataattcgtttgtatggtgtgttaggc CRISPR spacer
ttaaaataattcgtttgtatggtgtgttaggc Protospacer
********************************
2. spacer 2.17|480470|32|LR134151|PILER-CR matches to MT843275 (Serratia phage vB_SspM_BZS1, complete genome) position: , mismatch: 0, identity: 1.0
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctggtgctgatcaagatagccgacaacgctaa Protospacer
********************************
3. spacer 2.29|479729|32|LR134151|CRISPRCasFinder,CRT matches to MT843276 (Serratia phage vB_SspS_OS31, complete genome) position: , mismatch: 0, identity: 1.0
ttaaaataattcgtttgtatggtgtgttaggc CRISPR spacer
ttaaaataattcgtttgtatggtgtgttaggc Protospacer
********************************
4. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to MT843275 (Serratia phage vB_SspM_BZS1, complete genome) position: , mismatch: 0, identity: 1.0
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctggtgctgatcaagatagccgacaacgctaa Protospacer
********************************
5. spacer 2.21|480714|32|LR134151|PILER-CR matches to MT843275 (Serratia phage vB_SspM_BZS1, complete genome) position: , mismatch: 2, identity: 0.938
ggttagatcaggatactggcgactggatgcta CRISPR spacer
ggttagatcaggatactggcgcctggatgctg Protospacer
********************* *********.
6. spacer 2.24|480897|32|LR134151|PILER-CR matches to MT843276 (Serratia phage vB_SspS_OS31, complete genome) position: , mismatch: 2, identity: 0.938
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
tgggaatttcgcccaggcacaccgcatcaaga Protospacer
********************.********.**
7. spacer 2.45|480705|32|LR134151|CRISPRCasFinder,CRT matches to MT843275 (Serratia phage vB_SspM_BZS1, complete genome) position: , mismatch: 2, identity: 0.938
ggttagatcaggatactggcgactggatgcta CRISPR spacer
ggttagatcaggatactggcgcctggatgctg Protospacer
********************* *********.
8. spacer 2.48|480888|32|LR134151|CRISPRCasFinder,CRT matches to MT843276 (Serratia phage vB_SspS_OS31, complete genome) position: , mismatch: 2, identity: 0.938
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
tgggaatttcgcccaggcacaccgcatcaaga Protospacer
********************.********.**
9. spacer 1.13|468522|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KC460990 (Serratia phage Eta, complete genome) position: , mismatch: 3, identity: 0.906
gtaaaaaccatgggtgccagcccgctgagtgg CRISPR spacer
ataaaaacgatgggtgccagcccactgagtgg Protospacer
.******* **************.********
10. spacer 1.7|468156|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MK813940 (Aeromonas phage 4_L372X, complete genome) position: , mismatch: 5, identity: 0.844
cgacaagcaaggcaaagaatggcccttggaag CRISPR spacer
acaccagcaaggcaaaaaatggcccttggaaa Protospacer
** ***********.**************.
11. spacer 1.10|468339|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to AP013469 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C56-MedDCM-OCT-S38-C52) position: , mismatch: 7, identity: 0.781
ctgaacgtcttcttttaaatcagccatcgcca CRISPR spacer
cataccatattgttttaaatcagccaccgcca Protospacer
* * *.* ** **************.*****
12. spacer 1.10|468339|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to AP013470 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C56A-MedDCM-OCT-S32-C59) position: , mismatch: 7, identity: 0.781
ctgaacgtcttcttttaaatcagccatcgcca CRISPR spacer
cataccatattgttttaaatcagccaccgcca Protospacer
* * *.* ** **************.*****
13. spacer 1.10|468339|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to AP013751 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C56A-MedDCM-OCT-S46-C59, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781
ctgaacgtcttcttttaaatcagccatcgcca CRISPR spacer
cataccatattgttttaaatcagccaccgcca Protospacer
* * *.* ** **************.*****
14. spacer 1.16|468705|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP010589 (Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence) position: , mismatch: 7, identity: 0.781
catttatcagtttctgtgccgcatctgcagct CRISPR spacer
catgcggcagtttctgagccgcatcagcaggt Protospacer
*** .. ********* ******** **** *
15. spacer 1.16|468705|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP021041 (Phaeobacter gallaeciensis strain P129 plasmid pP129_a, complete sequence) position: , mismatch: 7, identity: 0.781
catttatcagtttctgtgccgcatctgcagct CRISPR spacer
catgcggcagtttctgagccgcatcagcaggt Protospacer
*** .. ********* ******** **** *
16. spacer 1.16|468705|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP010674 (Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence) position: , mismatch: 7, identity: 0.781
catttatcagtttctgtgccgcatctgcagct CRISPR spacer
catgcggcagtttctgagccgcatcagcaggt Protospacer
*** .. ********* ******** **** *
17. spacer 1.16|468705|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_023138 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence) position: , mismatch: 7, identity: 0.781
catttatcagtttctgtgccgcatctgcagct CRISPR spacer
catgcggcagtttctgagccgcatcagcaggt Protospacer
*** .. ********* ******** **** *
18. spacer 1.16|468705|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP010637 (Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence) position: , mismatch: 7, identity: 0.781
catttatcagtttctgtgccgcatctgcagct CRISPR spacer
catgcggcagtttctgagccgcatcagcaggt Protospacer
*** .. ********* ******** **** *
19. spacer 1.17|468766|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP033895 (Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence) position: , mismatch: 7, identity: 0.781
gtctggctggcgatagtgctggc--tcatcagcc CRISPR spacer
gtctggctggggattgtgctggccaccctcgg-- Protospacer
********** *** ******** .* **.*
20. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to MT366947 (Bacillus phage Hyb2phi3Ts-SPbeta, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
21. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to KY030782 (Bacillus phage phi3T, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
22. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to NC_001884 (Bacillus phage SPBc2, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
23. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to AF020713 (Bacteriophage SPBc2 complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
24. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to MT366946 (Bacillus phage Hyb1phi3Ts-SPbeta, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
25. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to MT366948 (Bacillus phage Hyb3phi3Ts-SPbeta, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
26. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to MT601274 (Bacillus phage vB_BsuS-Goe13, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
27. spacer 1.37|470014|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to MT366945 (Bacillus phage phi3Ts, complete genome) position: , mismatch: 7, identity: 0.781
tatttctgtatctcgatttgagttgatttctt CRISPR spacer
aattcataaatctcgatttgaggtgttttctt Protospacer
***. *. ************* ** ******
28. spacer 1.44|469437|32|LR134151|CRT matches to MT498043 (Arthrobacter phage Jinkies, complete genome) position: , mismatch: 7, identity: 0.781
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
gccatgccgtagggcgggtcggtaactagcac Protospacer
.** ********************* * *.
29. spacer 2.8|479921|32|LR134151|PILER-CR matches to NZ_CP018813 (Paraburkholderia sp. SOS3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cttgcccgcgacgatctcgccgccctgaagcg Protospacer
.....************ *************
30. spacer 2.9|479982|32|LR134151|PILER-CR matches to NZ_CP018813 (Paraburkholderia sp. SOS3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cttgcccgcgacgatctcgccgccctgaagcg Protospacer
.....************ *************
31. spacer 2.20|480653|32|LR134151|PILER-CR matches to MH622942 (Microviridae sp. isolate ctcb16, complete genome) position: , mismatch: 7, identity: 0.781
tgtgttttttctttctttattcctggtagaga CRISPR spacer
gatgttttttctttcgttattcttggttgtgc Protospacer
.************* ******.**** * *
32. spacer 2.20|480653|32|LR134151|PILER-CR matches to NZ_CP009683 (Francisella tularensis subsp. novicida strain AZ06-7470 plasmid pFNE_1, complete sequence) position: , mismatch: 7, identity: 0.781
tgtgttttttctttctttattcctggtagaga CRISPR spacer
tttgttttttctttgttttttcctgacatata Protospacer
* ************ *** ******..* * *
33. spacer 2.32|479912|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP018813 (Paraburkholderia sp. SOS3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cttgcccgcgacgatctcgccgccctgaagcg Protospacer
.....************ *************
34. spacer 2.33|479973|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP018813 (Paraburkholderia sp. SOS3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cttgcccgcgacgatctcgccgccctgaagcg Protospacer
.....************ *************
35. spacer 2.44|480644|32|LR134151|CRISPRCasFinder,CRT matches to MH622942 (Microviridae sp. isolate ctcb16, complete genome) position: , mismatch: 7, identity: 0.781
tgtgttttttctttctttattcctggtagaga CRISPR spacer
gatgttttttctttcgttattcttggttgtgc Protospacer
.************* ******.**** * *
36. spacer 2.44|480644|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP009683 (Francisella tularensis subsp. novicida strain AZ06-7470 plasmid pFNE_1, complete sequence) position: , mismatch: 7, identity: 0.781
tgtgttttttctttctttattcctggtagaga CRISPR spacer
tttgttttttctttgttttttcctgacatata Protospacer
* ************ *** ******..* * *
37. spacer 1.5|468034|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
gatggtttgaattactgcctgtctgtatgttt CRISPR spacer
gcttaatcgatttactgcctgtctgtatcttg Protospacer
* * . *.** ***************** **
38. spacer 1.10|468339|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP037908 (Escherichia coli strain LHM10-1 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
ctgaacgtcttcttttaaatcagccatcgcca CRISPR spacer
ttgaacatcgtcttttaaatcagcgagtgaga Protospacer
.*****.** ************** * .* *
39. spacer 1.11|468400|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KC801932 (Escherichia phage Lw1, complete genome) position: , mismatch: 8, identity: 0.75
ttaaatcatgggcaaataaaacccctgtcgca CRISPR spacer
gcaaatcatgggtaaataaaacccccgacaat Protospacer
.**********.************.* *.
40. spacer 1.11|468400|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MT334653 (Buttiauxella phage vB_ButM_GuL6, complete genome) position: , mismatch: 8, identity: 0.75
ttaaatcatgggcaaataaaacccctgtcgca CRISPR spacer
gtaaagcatgggtaaataaaaccccaggacaa Protospacer
**** ******.************ * *
41. spacer 1.14|468583|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to KM659092 (Ochrobactrum sp. LM19 plasmid pLM19O2, complete sequence) position: , mismatch: 8, identity: 0.75
aggggggggtaatcgtattactggtacatcag CRISPR spacer
ccgtcgtcgtaattgtattgctggtacatcag Protospacer
* * *****.*****.************
42. spacer 1.15|468644|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
cggaacagcgcattcagcaggccacatctgca CRISPR spacer
cggaacagcgcatagagcaggccgaagatcaa Protospacer
************* ********. * * *
43. spacer 1.20|468949|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgttggcattaacgatccacgcgccggagcag CRISPR spacer
agttctgcgtaacgatcgacgcgccggaacag Protospacer
*** ******** **********.***
44. spacer 1.31|469648|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 8, identity: 0.75
atcgatacgacggccgcattgtcagtatcgcc CRISPR spacer
atcgcaacgacggccgcattgtcggcctgccg Protospacer
**** *****************.*. * *
45. spacer 1.44|469437|32|LR134151|CRT matches to MF373843 (Mycobacterium phage StevieRay, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
46. spacer 1.44|469437|32|LR134151|CRT matches to MN010757 (Mycobacterium phage HUHilltop, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
47. spacer 1.44|469437|32|LR134151|CRT matches to MK820639 (Mycobacterium phage Phineas, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
48. spacer 1.44|469437|32|LR134151|CRT matches to MF133446 (Mycobacterium phage Bogie, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
49. spacer 1.44|469437|32|LR134151|CRT matches to MK937604 (Mycobacterium phage Necropolis, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
50. spacer 1.44|469437|32|LR134151|CRT matches to NC_041969 (Mycobacterium phage Jebeks, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
51. spacer 1.44|469437|32|LR134151|CRT matches to NC_026605 (Mycobacterium phage Malithi, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
52. spacer 1.44|469437|32|LR134151|CRT matches to KU985090 (Mycobacterium phage Shipwreck, complete genome) position: , mismatch: 8, identity: 0.75
ctcaggccgtagggcgggtcggtaacaatcga CRISPR spacer
tccagcccgtagggcgggtcggtcaccacagc Protospacer
..*** ***************** ** *. *
53. spacer 2.8|479921|32|LR134151|PILER-CR matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cccgtgcgcgacgatctccccgcccttgcggt Protospacer
**.* ******************** . *
54. spacer 2.8|479921|32|LR134151|PILER-CR matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
agccgcagagacgatcgccgcgccctgaagcg Protospacer
* * . * ******* ** ************
55. spacer 2.9|479982|32|LR134151|PILER-CR matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cccgtgcgcgacgatctccccgcccttgcggt Protospacer
**.* ******************** . *
56. spacer 2.9|479982|32|LR134151|PILER-CR matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
agccgcagagacgatcgccgcgccctgaagcg Protospacer
* * . * ******* ** ************
57. spacer 2.17|480470|32|LR134151|PILER-CR matches to NZ_CP039967 (Pseudorhodobacter sp. S12M18 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ctggtg--ctgatcaagatagccgacaacgctaa CRISPR spacer
--ggcgacctgataaagatagccgccaacgccgc Protospacer
**.* ***** ********** ******..
58. spacer 2.20|480653|32|LR134151|PILER-CR matches to MN694783 (Marine virus AFVG_250M759, complete genome) position: , mismatch: 8, identity: 0.75
tgtgttttttctttctttattcctggtagaga CRISPR spacer
agtgttttttctttatttattgctcggattaa Protospacer
************* ****** ** * * .*
59. spacer 2.28|479669|31|LR134151|CRISPRCasFinder,CRT matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 8, identity: 0.742
atcaccgggatgttgtgtaagtttatgttga CRISPR spacer
atcaccgggctgttgggtaagttgggggtag Protospacer
********* ***** ******* . * *..
60. spacer 2.32|479912|32|LR134151|CRISPRCasFinder,CRT matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cccgtgcgcgacgatctccccgcccttgcggt Protospacer
**.* ******************** . *
61. spacer 2.32|479912|32|LR134151|CRISPRCasFinder,CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
agccgcagagacgatcgccgcgccctgaagcg Protospacer
* * . * ******* ** ************
62. spacer 2.33|479973|32|LR134151|CRISPRCasFinder,CRT matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cccgtgcgcgacgatctccccgcccttgcggt Protospacer
**.* ******************** . *
63. spacer 2.33|479973|32|LR134151|CRISPRCasFinder,CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 8, identity: 0.75
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
agccgcagagacgatcgccgcgccctgaagcg Protospacer
* * . * ******* ** ************
64. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP039967 (Pseudorhodobacter sp. S12M18 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ctggtg--ctgatcaagatagccgacaacgctaa CRISPR spacer
--ggcgacctgataaagatagccgccaacgccgc Protospacer
**.* ***** ********** ******..
65. spacer 2.44|480644|32|LR134151|CRISPRCasFinder,CRT matches to MN694783 (Marine virus AFVG_250M759, complete genome) position: , mismatch: 8, identity: 0.75
tgtgttttttctttctttattcctggtagaga CRISPR spacer
agtgttttttctttatttattgctcggattaa Protospacer
************* ****** ** * * .*
66. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP012498 (Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence) position: , mismatch: 8, identity: 0.758
tgggaaacagggaaaatggttcctgtt--gggtca CRISPR spacer
gcagaaacagggaaattggatcctgtttctggt-- Protospacer
.************ *** ******* ***
67. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 8, identity: 0.758
tgggaaacagggaaaatggttcctgtt--gggtca CRISPR spacer
gcagaaacagggaaattggatcctgtttctggt-- Protospacer
.************ *** ******* ***
68. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 8, identity: 0.758
tgggaaacagggaaaatggttcctgtt--gggtca CRISPR spacer
gcagaaacagggaaattggatcctgtttctggt-- Protospacer
.************ *** ******* ***
69. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP042296 (Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence) position: , mismatch: 8, identity: 0.758
tgggaaacagggaaaatggttcctgtt--gggtca CRISPR spacer
gcagaaacagggaaattggatcctgtttctggt-- Protospacer
.************ *** ******* ***
70. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 8, identity: 0.758
tgggaaacagggaaaatggttcctgtt--gggtca CRISPR spacer
gcagaaacagggaaattggatcctgtttctggt-- Protospacer
.************ *** ******* ***
71. spacer 1.6|468095|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
cacgcactgcgctcatcagggcaaagcttcta CRISPR spacer
ccagcagggcgctcatcagggcaaagggttgc Protospacer
* *** ****************** *.
72. spacer 1.8|468217|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
aaaattggctacgccggtgcggttgcctcgtc CRISPR spacer
cgggttggcgacgccggtgcggttgccgctca Protospacer
...***** ***************** * .
73. spacer 1.11|468400|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN508622 (UNVERIFIED: Enterobacter phage EC-W2, complete genome) position: , mismatch: 9, identity: 0.719
ttaaatcatgggcaaataaaacccctgtcgca CRISPR spacer
gcaaatcatgggtaaataaaaccccagataac Protospacer
.**********.************ * ..
74. spacer 1.22|469071|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN812722 (Vibrio phage NF, complete genome) position: , mismatch: 9, identity: 0.719
ggatttctttccatctactcatcctcctcctc CRISPR spacer
atggcgcattccatctactcaccctcctgctc Protospacer
. . . * *************.****** ***
75. spacer 1.22|469071|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to MN694433 (Marine virus AFVG_250M1159, complete genome) position: , mismatch: 9, identity: 0.719
ggatttctttccatctactcatcctcctcctc CRISPR spacer
gttattttttccatctagtcatcctcctttgg Protospacer
* **.********** **********..
76. spacer 1.25|469254|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP044508 (Chryseobacterium sp. strain SNU WT7 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tgtcacatagtggcaatctttatcaggttgaa CRISPR spacer
aggctgatagtggtaatctttatcaagttctc Protospacer
* * *******.***********.***
77. spacer 1.38|470075|33|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727
gcgaaccgcaaagcccgtgacctggtgatcgtc CRISPR spacer
ttcggacgcaaagcccttgccctggtgatcgac Protospacer
. .. ********** ** *********** *
78. spacer 2.8|479921|32|LR134151|PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cacatactcgacgatctccccgccccgcgcag Protospacer
*** * *****************.* . *
79. spacer 2.9|479982|32|LR134151|PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cacatactcgacgatctccccgccccgcgcag Protospacer
*** * *****************.* . *
80. spacer 2.14|480287|32|LR134151|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 9, identity: 0.719
gcagcaggactgcccaccacggcgtttttaca CRISPR spacer
ttcccaagactgcccaccagggcgttttcgga Protospacer
. **.************ ********.. *
81. spacer 2.17|480470|32|LR134151|PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
82. spacer 2.17|480470|32|LR134151|PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
83. spacer 2.17|480470|32|LR134151|PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
84. spacer 2.17|480470|32|LR134151|PILER-CR matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
85. spacer 2.17|480470|32|LR134151|PILER-CR matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
86. spacer 2.22|480775|32|LR134151|PILER-CR matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 9, identity: 0.719
gcttggttttgggttctggttggctgcgccct CRISPR spacer
gcttggtttttggttttggttggtggaacgta Protospacer
********** ****.*******. * .* .
87. spacer 2.32|479912|32|LR134151|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cacatactcgacgatctccccgccccgcgcag Protospacer
*** * *****************.* . *
88. spacer 2.33|479973|32|LR134151|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719
accattcgcgacgatctccccgccctgaagcg CRISPR spacer
cacatactcgacgatctccccgccccgcgcag Protospacer
*** * *****************.* . *
89. spacer 2.38|480278|32|LR134151|CRISPRCasFinder,CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 9, identity: 0.719
gcagcaggactgcccaccacggcgtttttaca CRISPR spacer
ttcccaagactgcccaccagggcgttttcgga Protospacer
. **.************ ********.. *
90. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
91. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
92. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
93. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
94. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctgatgctgatcaagatggccgacgcgacggc Protospacer
***.*************.******. .* .
95. spacer 2.46|480766|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 9, identity: 0.719
gcttggttttgggttctggttggctgcgccct CRISPR spacer
gcttggtttttggttttggttggtggaacgta Protospacer
********** ****.*******. * .* .
96. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
ataggcggcactgtatctgctggaagcccgat Protospacer
* ****** ****.***********. .*
97. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.719
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
ataggcggcactgtatctgctggaagcccgat Protospacer
* ****** ****.***********. .*
98. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP022280 (Escherichia coli strain STEC299 plasmid pSTEC299_1, complete sequence) position: , mismatch: 9, identity: 0.727
tgggaaacagggaaaatggttcctgttg--ggtca CRISPR spacer
gccgaaacagggaaactggatcctgttactggc-- Protospacer
************ *** *******. **.
99. spacer 2.54|481254|33|LR134151|CRISPRCasFinder,CRT matches to NZ_CP024249 (Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
tgggaaacagggaaaatggttcctgttg--ggtca CRISPR spacer
gccgaaacagggaaactggatcctgttactggc-- Protospacer
************ *** *******. **.
100. spacer 1.3|467912|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.688
ttcgagggaatttctggatggagtggcccgga CRISPR spacer
cgatggcgaatttctggacggagaggcccgat Protospacer
. .* ***********.**** ******.
101. spacer 1.17|468766|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.688
gtctggctggcgatagtgctggctcatcagcc CRISPR spacer
gtctggctggggatggtgctggccatttcctt Protospacer
********** ***.********. *. ..
102. spacer 1.17|468766|32|LR134151|PILER-CR,CRISPRCasFinder,CRT,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gtctggctggcgatagtgctggctcatcagcc CRISPR spacer
atagagctggagatagtgctggcccatcgcgt Protospacer
.* .***** ************.****. .
103. spacer 1.27|469376|32|LR134151|CRISPRCasFinder,CRT,CRT matches to MN480763 (Streptococcus salivarius strain YU10 plasmid pSsal-YU10, complete sequence) position: , mismatch: 10, identity: 0.688
ttaggctgatataattttgttcgataatcggc CRISPR spacer
aactactgatatcattttgttctataattgag Protospacer
.******* ********* *****.*.
104. spacer 1.29|469526|32|LR134151|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 10, identity: 0.688
ggatgttctgtgatgatgggtgccgggacgac CRISPR spacer
gccgccagtgtgatgatgcgtgtcgggacgag Protospacer
* . ********** ***.********
105. spacer 2.7|479860|32|LR134151|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcggaattctgggaaaatggaaagctact CRISPR spacer
cttgaggaaatctgggaaaatggttgggggac Protospacer
**** **** ************* .* . .
106. spacer 2.10|480043|32|LR134151|PILER-CR matches to MF766045 (Streptomyces phage Daudau, complete genome) position: , mismatch: 10, identity: 0.688
agacctcgccgatttaactgaagagctcactg CRISPR spacer
gcgtctcgccgatctcactgaagagcttcttc Protospacer
. ..*********.* ***********. .*
107. spacer 2.12|480165|32|LR134151|PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 10, identity: 0.688
cgcaacgcatggtttcgtctttgtagtagata CRISPR spacer
cgcatcgcatggtttcgtcgttgcatcccgcg Protospacer
**** ************** ***.* . ...
108. spacer 2.12|480165|32|LR134151|PILER-CR matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 10, identity: 0.688
cgcaacgcatggtttcgtctttgtagtagata CRISPR spacer
cgcatcgcatggtttcgtcgttgcatcccgcg Protospacer
**** ************** ***.* . ...
109. spacer 2.17|480470|32|LR134151|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctggtgctgatcgagattgccgatgcgggcgt Protospacer
************.**** *****.. * ..
110. spacer 2.22|480775|32|LR134151|PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 10, identity: 0.688
gcttggttttgggttctggttggctgcgccct CRISPR spacer
cgacggttttgggatttggttggctgcccggc Protospacer
.********* *.*********** * .
111. spacer 2.24|480897|32|LR134151|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.688
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
cccccatttcgcccaggcccgcagcatcccgg Protospacer
. ************* *** ***** *.
112. spacer 2.24|480897|32|LR134151|PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
ttcctccttcgcacaggcacgccccatcagcg Protospacer
* .***** ********** ****** .
113. spacer 2.31|479851|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cttgcggaattctgggaaaatggaaagctact CRISPR spacer
cttgaggaaatctgggaaaatggttgggggac Protospacer
**** **** ************* .* . .
114. spacer 2.34|480034|32|LR134151|CRISPRCasFinder,CRT matches to MF766045 (Streptomyces phage Daudau, complete genome) position: , mismatch: 10, identity: 0.688
agacctcgccgatttaactgaagagctcactg CRISPR spacer
gcgtctcgccgatctcactgaagagcttcttc Protospacer
. ..*********.* ***********. .*
115. spacer 2.36|480156|32|LR134151|CRISPRCasFinder,CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 10, identity: 0.688
cgcaacgcatggtttcgtctttgtagtagata CRISPR spacer
cgcatcgcatggtttcgtcgttgcatcccgcg Protospacer
**** ************** ***.* . ...
116. spacer 2.36|480156|32|LR134151|CRISPRCasFinder,CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 10, identity: 0.688
cgcaacgcatggtttcgtctttgtagtagata CRISPR spacer
cgcatcgcatggtttcgtcgttgcatcccgcg Protospacer
**** ************** ***.* . ...
117. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
ctggtgctgatcgagattgccgatgcgggcgt Protospacer
************.**** *****.. * ..
118. spacer 2.46|480766|32|LR134151|CRISPRCasFinder,CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 10, identity: 0.688
gcttggttttgggttctggttggctgcgccct CRISPR spacer
cgacggttttgggatttggttggctgcccggc Protospacer
.********* *.*********** * .
119. spacer 2.48|480888|32|LR134151|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.688
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
cccccatttcgcccaggcccgcagcatcccgg Protospacer
. ************* *** ***** *.
120. spacer 2.48|480888|32|LR134151|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
ttcctccttcgcacaggcacgccccatcagcg Protospacer
* .***** ********** ****** .
121. spacer 2.52|481132|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
aactacgaccgcgccaactacctgcctcagaa CRISPR spacer
ggcggcgaccgcgccaactggctgcctcttcg Protospacer
..* .**************. ******* .
122. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to MN508624 (UNVERIFIED: Enterobacter phage EC-F2, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
123. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to MN101223 (Klebsiella phage KOX10, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
124. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to MT157285 (Klebsiella phage P-KP2, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
125. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to KT001919 (Klebsiella phage Miro, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
126. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to KT001918 (Klebsiella phage Matisse, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
127. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to JN882287 (Cronobacter phage vB_CsaM_GAP161, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
128. spacer 2.53|481193|32|LR134151|CRISPRCasFinder,CRT matches to GU295964 (Klebsiella phage KP15, complete genome) position: , mismatch: 10, identity: 0.688
aatggcggccctgtgtctgctggaagtatgta CRISPR spacer
cagcgcggccctatgtctcctggaagtgaagc Protospacer
* ********.***** ********. .
129. spacer 2.17|480470|32|LR134151|PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
gcagtgctgatcaaggtggccgacaaactgcg Protospacer
..************.*.******** . .
130. spacer 2.24|480897|32|LR134151|PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
cacatccttcgcccaggcccgccccatcagcg Protospacer
.. . .*********** **** ****** .
131. spacer 2.41|480461|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
ctggtgctgatcaagatagccgacaacgctaa CRISPR spacer
gcagtgctgatcaaggtggccgacaaactgcg Protospacer
..************.*.******** . .
132. spacer 2.48|480888|32|LR134151|CRISPRCasFinder,CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
tgggaatttcgcccaggcacgccgcatcagga CRISPR spacer
cacatccttcgcccaggcccgccccatcagcg Protospacer
.. . .*********** **** ****** .
