CRISPR_ID |
Spacer_Info |
Spacer_region |
Spacer_length |
Hit_phage_ID |
Hit_phage_def |
Protospacer_location |
Mismatch |
Identity |
LR130548_1 |
1.1|4067220|36|LR130548|CRISPRCasFinder |
4067220-4067255 |
36 |
MK448233 |
Klebsiella phage ST11-VIM1phi8.1, complete genome |
8447-8482 |
0 |
1.0 |
LR130548_1 |
1.1|4067220|36|LR130548|CRISPRCasFinder |
4067220-4067255 |
36 |
MK448235 |
Klebsiella phage ST512-KPC3phi13.1, complete genome |
8447-8482 |
0 |
1.0 |
LR130548_1 |
1.1|4067220|36|LR130548|CRISPRCasFinder |
4067220-4067255 |
36 |
MK448231 |
Klebsiella phage ST101-KPC2phi6.1, complete genome |
11383-11418 |
0 |
1.0 |
1. spacer 1.1|4067220|36|LR130548|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0
cctcgccggtacgcagcgtggttactgggtttgcgt CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt Protospacer
************************************
2. spacer 1.1|4067220|36|LR130548|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0
cctcgccggtacgcagcgtggttactgggtttgcgt CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt Protospacer
************************************
3. spacer 1.1|4067220|36|LR130548|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0
cctcgccggtacgcagcgtggttactgggtttgcgt CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt Protospacer
************************************