Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR130545 Escherichia coli strain B36 genome assembly, chromosome: 1 2 crisprs NA 0 2 0 0
LR130547 Escherichia coli strain B36 genome assembly, plasmid: 3 0 crisprs NA 0 0 0 0
LR130546 Escherichia coli strain B36 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0

Results visualization

1. LR130545
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130545_1 3349447-3349529 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130545_2 4233902-4234034 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR130545_2 2.1|4233919|42|LR130545|PILER-CR 4233919-4233960 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
LR130545_2 2.2|4233978|40|LR130545|PILER-CR 4233978-4234017 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95

1. spacer 2.1|4233919|42|LR130545|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 2.2|4233978|40|LR130545|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage