Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR130517 Staphylococcus aureus strain BPH2947 genome assembly, plasmid: 3 0 crisprs NA 0 0 0 0
LR130516 Staphylococcus aureus strain BPH2947 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0
LR130515 Staphylococcus aureus strain BPH2947 genome assembly, chromosome: 1 11 crisprs NA 11 4 0 0

Results visualization

1. LR130515
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_1 481225-481325 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_2 746670-746762 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_3 809389-809487 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_4 862346-862428 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_5 903398-903478 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_6 951934-952015 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_7 1015351-1015633 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_8 1153027-1153114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_9 1233366-1233667 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_10 2422264-2422414 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130515_11 2546426-2546619 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR130515_6 6.1|951958|34|LR130515|CRISPRCasFinder 951958-951991 34 LR130515.1 1444126-1444159 0 1.0
LR130515_6 6.1|951958|34|LR130515|CRISPRCasFinder 951958-951991 34 LR130515.1 1533312-1533345 0 1.0
LR130515_11 11.2|2546505|36|LR130515|CRT 2546505-2546540 36 LR130515.1 1238802-1238837 0 1.0
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 442748-442776 1 0.966
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 1901658-1901686 1 0.966
LR130515_7 7.1|1015381|26|LR130515|CRT 1015381-1015406 26 LR130515.1 908826-908851 1 0.962
LR130515_7 7.1|1015381|26|LR130515|CRT 1015381-1015406 26 LR130515.1 1015325-1015350 1 0.962
LR130515_7 7.3|1015495|26|LR130515|CRT 1015495-1015520 26 LR130515.1 1712498-1712523 1 0.962
LR130515_7 7.4|1015551|53|LR130515|CRT 1015551-1015603 53 LR130515.1 285491-285543 1 0.981
LR130515_7 7.4|1015551|53|LR130515|CRT 1015551-1015603 53 LR130515.1 2853992-2854044 1 0.981
LR130515_9 9.1|1233387|35|LR130515|CRT 1233387-1233421 35 LR130515.1 1233331-1233365 1 0.971
LR130515_9 9.3|1233500|35|LR130515|CRT 1233500-1233534 35 LR130515.1 1233331-1233365 1 0.971
LR130515_9 9.5|1233612|35|LR130515|CRT 1233612-1233646 35 LR130515.1 2175465-2175499 1 0.971
LR130515_11 11.2|2546505|36|LR130515|CRT 2546505-2546540 36 LR130515.1 1901651-1901686 1 0.972
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 321139-321167 2 0.931
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 952000-952028 2 0.931
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 1035020-1035048 2 0.931
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 1238809-1238837 2 0.931
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 1712417-1712445 2 0.931
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 2069255-2069283 2 0.931
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 LR130515.1 2738031-2738059 2 0.931
LR130515_7 7.1|1015381|26|LR130515|CRT 1015381-1015406 26 LR130515.1 871818-871843 2 0.923
LR130515_9 9.5|1233612|35|LR130515|CRT 1233612-1233646 35 LR130515.1 862328-862362 2 0.943
LR130515_9 9.5|1233612|35|LR130515|CRT 1233612-1233646 35 LR130515.1 908862-908896 2 0.943
LR130515_9 9.5|1233612|35|LR130515|CRT 1233612-1233646 35 LR130515.1 2854055-2854089 2 0.943
LR130515_11 11.1|2546449|33|LR130515|CRT 2546449-2546481 33 LR130515.1 1136747-1136779 2 0.939
LR130515_11 11.1|2546449|33|LR130515|CRT 2546449-2546481 33 LR130515.1 1238858-1238890 2 0.939
LR130515_11 11.1|2546449|33|LR130515|CRT 2546449-2546481 33 LR130515.1 1444081-1444113 2 0.939
LR130515_11 11.1|2546449|33|LR130515|CRT 2546449-2546481 33 LR130515.1 1533358-1533390 2 0.939
LR130515_11 11.1|2546449|33|LR130515|CRT 2546449-2546481 33 LR130515.1 2058511-2058543 2 0.939
LR130515_11 11.1|2546449|33|LR130515|CRT 2546449-2546481 33 LR130515.1 2818458-2818490 2 0.939
LR130515_11 11.2|2546505|36|LR130515|CRT 2546505-2546540 36 LR130515.1 321132-321167 2 0.944
LR130515_11 11.2|2546505|36|LR130515|CRT 2546505-2546540 36 LR130515.1 1712417-1712452 2 0.944
LR130515_11 11.2|2546505|36|LR130515|CRT 2546505-2546540 36 LR130515.1 2069255-2069290 2 0.944
LR130515_11 11.3|2546564|33|LR130515|CRT 2546564-2546596 33 LR130515.1 908806-908838 2 0.939
LR130515_11 11.3|2546564|33|LR130515|CRT 2546564-2546596 33 LR130515.1 1136747-1136779 2 0.939
LR130515_11 11.3|2546564|33|LR130515|CRT 2546564-2546596 33 LR130515.1 1238858-1238890 2 0.939
LR130515_11 11.3|2546564|33|LR130515|CRT 2546564-2546596 33 LR130515.1 1444081-1444113 2 0.939
LR130515_11 11.3|2546564|33|LR130515|CRT 2546564-2546596 33 LR130515.1 2058511-2058543 2 0.939
LR130515_11 11.3|2546564|33|LR130515|CRT 2546564-2546596 33 LR130515.1 2818458-2818490 2 0.939

1. spacer 6.1|951958|34|LR130515|CRISPRCasFinder matches to position: 1444126-1444159, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 6.1|951958|34|LR130515|CRISPRCasFinder matches to position: 1533312-1533345, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 11.2|2546505|36|LR130515|CRT matches to position: 1238802-1238837, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 442748-442776, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcttgtagaatttcttttcgaaa	Protospacer
*******.*********************

5. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 1901658-1901686, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaa	Protospacer
********.********************

6. spacer 7.1|1015381|26|LR130515|CRT matches to position: 908826-908851, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*****************.********

7. spacer 7.1|1015381|26|LR130515|CRT matches to position: 1015325-1015350, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

8. spacer 7.3|1015495|26|LR130515|CRT matches to position: 1712498-1712523, mismatch: 1, identity: 0.962

tggggccccaacacagaagctggcga	CRISPR spacer
tggggccccaacacagaagctgacga	Protospacer
**********************.***

9. spacer 7.4|1015551|53|LR130515|CRT matches to position: 285491-285543, mismatch: 1, identity: 0.981

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgcgaaaatattatttctgtcccactcccaa	Protospacer
*********************************.*******************

10. spacer 7.4|1015551|53|LR130515|CRT matches to position: 2853992-2854044, mismatch: 1, identity: 0.981

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttacgaaaatatcatttctgtcccactcccaa	Protospacer
***********************.*****************************

11. spacer 9.1|1233387|35|LR130515|CRT matches to position: 1233331-1233365, mismatch: 1, identity: 0.971

cagagagaaataggatcaccaatttcaacagacaa	CRISPR spacer
cagagagaaataggatcaccaattccaacagacaa	Protospacer
************************.**********

12. spacer 9.3|1233500|35|LR130515|CRT matches to position: 1233331-1233365, mismatch: 1, identity: 0.971

cagagagaaataggatcaccaattccaacaaacaa	CRISPR spacer
cagagagaaataggatcaccaattccaacagacaa	Protospacer
******************************.****

13. spacer 9.5|1233612|35|LR130515|CRT matches to position: 2175465-2175499, mismatch: 1, identity: 0.971

catagagaaattggaaccccaatttctacagacaa	CRISPR spacer
catagagaaattggaacaccaatttctacagacaa	Protospacer
***************** *****************

14. spacer 11.2|2546505|36|LR130515|CRT matches to position: 1901651-1901686, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

15. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 321139-321167, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

16. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 952000-952028, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

17. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 1035020-1035048, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

18. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 1238809-1238837, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttctttttgaaa	Protospacer
********.***************.****

19. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 1712417-1712445, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

20. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 2069255-2069283, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaa	Protospacer
********.***********.********

21. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to position: 2738031-2738059, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

22. spacer 7.1|1015381|26|LR130515|CRT matches to position: 871818-871843, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

23. spacer 9.5|1233612|35|LR130515|CRT matches to position: 862328-862362, mismatch: 2, identity: 0.943

catagagaaattggaaccccaatttctacagacaa	CRISPR spacer
catagagaaattggattcccaatttctacagacaa	Protospacer
*************** .******************

24. spacer 9.5|1233612|35|LR130515|CRT matches to position: 908862-908896, mismatch: 2, identity: 0.943

catagagaaattggaaccccaatttctacagacaa	CRISPR spacer
catagagaaattggattcccaatttctacagacaa	Protospacer
*************** .******************

25. spacer 9.5|1233612|35|LR130515|CRT matches to position: 2854055-2854089, mismatch: 2, identity: 0.943

catagagaaattggaaccccaatttctacagacaa	CRISPR spacer
catagagaaattggattcccaatttctacagacaa	Protospacer
*************** .******************

26. spacer 11.1|2546449|33|LR130515|CRT matches to position: 1136747-1136779, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

27. spacer 11.1|2546449|33|LR130515|CRT matches to position: 1238858-1238890, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

28. spacer 11.1|2546449|33|LR130515|CRT matches to position: 1444081-1444113, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

29. spacer 11.1|2546449|33|LR130515|CRT matches to position: 1533358-1533390, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

30. spacer 11.1|2546449|33|LR130515|CRT matches to position: 2058511-2058543, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

31. spacer 11.1|2546449|33|LR130515|CRT matches to position: 2818458-2818490, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

32. spacer 11.2|2546505|36|LR130515|CRT matches to position: 321132-321167, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

33. spacer 11.2|2546505|36|LR130515|CRT matches to position: 1712417-1712452, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

34. spacer 11.2|2546505|36|LR130515|CRT matches to position: 2069255-2069290, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

35. spacer 11.3|2546564|33|LR130515|CRT matches to position: 908806-908838, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgactttccgccagcttctg	Protospacer
*********************.*.*********

36. spacer 11.3|2546564|33|LR130515|CRT matches to position: 1136747-1136779, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

37. spacer 11.3|2546564|33|LR130515|CRT matches to position: 1238858-1238890, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

38. spacer 11.3|2546564|33|LR130515|CRT matches to position: 1444081-1444113, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

39. spacer 11.3|2546564|33|LR130515|CRT matches to position: 2058511-2058543, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

40. spacer 11.3|2546564|33|LR130515|CRT matches to position: 2818458-2818490, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR130515_7 7.3|1015495|26|LR130515|CRT 1015495-1015520 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 4 0.846
LR130515_7 7.4|1015551|53|LR130515|CRT 1015551-1015603 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
LR130515_5 5.1|903424|29|LR130515|CRISPRCasFinder 903424-903452 29 MN693281 Marine virus AFVG_25M371, complete genome 6448-6476 7 0.759
LR130515_9 9.1|1233387|35|LR130515|CRT 1233387-1233421 35 KY971610 Pseudomonas phage PspYZU05, complete genome 73937-73971 11 0.686

1. spacer 7.3|1015495|26|LR130515|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 4, identity: 0.846

tggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
*..****.***************** 

2. spacer 7.4|1015551|53|LR130515|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

3. spacer 5.1|903424|29|LR130515|CRISPRCasFinder matches to MN693281 (Marine virus AFVG_25M371, complete genome) position: , mismatch: 7, identity: 0.759

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtttgtaggatttcttctaagtg	Protospacer
**************.*******.* .. .

4. spacer 9.1|1233387|35|LR130515|CRT matches to KY971610 (Pseudomonas phage PspYZU05, complete genome) position: , mismatch: 11, identity: 0.686

cagagagaaataggatcaccaatttcaacagacaa	CRISPR spacer
ccacatgaaatagggtcaccaatttgaacagcttt	Protospacer
* . . ********.********** ***** .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage