Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR130528 Pseudomonas aeruginosa isolate paerg000 genome assembly, chromosome: 0 3 crisprs csa3,RT,cas3,DEDDh,DinG,WYL,PD-DExK 0 1 5 0

Results visualization

1. LR130528
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130528_1 336324-336437 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130528_2 1002247-1002344 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130528_3 6416652-6416809 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR130528_2 2.1|1002279|34|LR130528|CRISPRCasFinder 1002279-1002312 34 NZ_CP032256 Pseudomonas aeruginosa strain AR_0111 plasmid unnamed, complete sequence 106417-106450 8 0.765
LR130528_2 2.1|1002279|34|LR130528|CRISPRCasFinder 1002279-1002312 34 NZ_CP034355 Pseudomonas aeruginosa strain IMP-13 plasmid pPYO_TB, complete sequence 10801-10834 8 0.765

1. spacer 2.1|1002279|34|LR130528|CRISPRCasFinder matches to NZ_CP032256 (Pseudomonas aeruginosa strain AR_0111 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

tctatggggcgctaaggtgaaaggatatggggcg	CRISPR spacer
ggcgtctgccgctaaggtgaaaggctatggggcg	Protospacer
  ..*  * *************** *********

2. spacer 2.1|1002279|34|LR130528|CRISPRCasFinder matches to NZ_CP034355 (Pseudomonas aeruginosa strain IMP-13 plasmid pPYO_TB, complete sequence) position: , mismatch: 8, identity: 0.765

tctatggggcgctaaggtgaaaggatatggggcg	CRISPR spacer
ggcgtctgccgctaaggtgaaaggctatggggcg	Protospacer
  ..*  * *************** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 669446 : 690096 27 Pseudomonas_phage(66.67%) NA NA
DBSCAN-SWA_2 947991 : 984086 44 Pseudomonas_virus(94.74%) tail,integrase attL 942077:942092|attR 949481:949496
DBSCAN-SWA_3 4267573 : 4274465 9 uncultured_Caudovirales_phage(83.33%) protease,tRNA NA
DBSCAN-SWA_4 4406175 : 4437320 25 Pseudomonas_phage(41.67%) transposase,integrase attL 4414930:4414978|attR 4438464:4438512
DBSCAN-SWA_5 5489845 : 5498907 10 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage