Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027874 Staphylococcus aureus strain BPH2056 genome assembly, chromosome: 1 10 crisprs NA 7 1 0 0
LR027875 Staphylococcus aureus strain BPH2056 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0

Results visualization

1. LR027874
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_1 433605-433705 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_2 700080-700172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_3 815894-815976 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_4 862442-862527 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_5 912339-912420 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_6 1110111-1110198 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_7 1194624-1194709 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_8 2373337-2373487 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_9 2497496-2497689 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027874_10 2993018-2993101 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR027874_5 5.1|912363|34|LR027874|CRISPRCasFinder 912363-912396 34 LR027874.1 1402786-1402819 0 1.0
LR027874_5 5.1|912363|34|LR027874|CRISPRCasFinder 912363-912396 34 LR027874.1 1491971-1492004 0 1.0
LR027874_9 9.2|2497575|36|LR027874|CRT 2497575-2497610 36 LR027874.1 1194555-1194590 0 1.0
LR027874_7 7.1|1194654|26|LR027874|CRISPRCasFinder 1194654-1194679 26 LR027874.1 316726-316751 1 0.962
LR027874_7 7.1|1194654|26|LR027874|CRISPRCasFinder 1194654-1194679 26 LR027874.1 825465-825490 1 0.962
LR027874_9 9.2|2497575|36|LR027874|CRT 2497575-2497610 36 LR027874.1 1857063-1857098 1 0.972
LR027874_10 10.1|2993044|32|LR027874|CRISPRCasFinder 2993044-2993075 32 LR027874.1 862608-862639 1 0.969
LR027874_10 10.1|2993044|32|LR027874|CRISPRCasFinder 2993044-2993075 32 LR027874.1 862666-862697 1 0.969
LR027874_10 10.1|2993044|32|LR027874|CRISPRCasFinder 2993044-2993075 32 LR027874.1 1120071-1120102 1 0.969
LR027874_10 10.1|2993044|32|LR027874|CRISPRCasFinder 2993044-2993075 32 LR027874.1 1492061-1492092 1 0.969
LR027874_4 4.1|862472|26|LR027874|CRISPRCasFinder 862472-862497 26 LR027874.1 316726-316751 2 0.923
LR027874_4 4.1|862472|26|LR027874|CRISPRCasFinder 862472-862497 26 LR027874.1 825465-825490 2 0.923
LR027874_4 4.1|862472|26|LR027874|CRISPRCasFinder 862472-862497 26 LR027874.1 976471-976496 2 0.923
LR027874_7 7.1|1194654|26|LR027874|CRISPRCasFinder 1194654-1194679 26 LR027874.1 825521-825546 2 0.923
LR027874_9 9.1|2497519|33|LR027874|CRT 2497519-2497551 33 LR027874.1 862508-862540 2 0.939
LR027874_9 9.1|2497519|33|LR027874|CRT 2497519-2497551 33 LR027874.1 1194611-1194643 2 0.939
LR027874_9 9.1|2497519|33|LR027874|CRT 2497519-2497551 33 LR027874.1 1402741-1402773 2 0.939
LR027874_9 9.1|2497519|33|LR027874|CRT 2497519-2497551 33 LR027874.1 1492017-1492049 2 0.939
LR027874_9 9.1|2497519|33|LR027874|CRT 2497519-2497551 33 LR027874.1 2012534-2012566 2 0.939
LR027874_9 9.1|2497519|33|LR027874|CRT 2497519-2497551 33 LR027874.1 2770258-2770290 2 0.939
LR027874_9 9.2|2497575|36|LR027874|CRT 2497575-2497610 36 LR027874.1 316851-316886 2 0.944
LR027874_9 9.2|2497575|36|LR027874|CRT 2497575-2497610 36 LR027874.1 1671075-1671110 2 0.944
LR027874_9 9.2|2497575|36|LR027874|CRT 2497575-2497610 36 LR027874.1 2023278-2023313 2 0.944
LR027874_9 9.3|2497634|33|LR027874|CRT 2497634-2497666 33 LR027874.1 862508-862540 2 0.939
LR027874_9 9.3|2497634|33|LR027874|CRT 2497634-2497666 33 LR027874.1 1194611-1194643 2 0.939
LR027874_9 9.3|2497634|33|LR027874|CRT 2497634-2497666 33 LR027874.1 1402741-1402773 2 0.939
LR027874_9 9.3|2497634|33|LR027874|CRT 2497634-2497666 33 LR027874.1 2012534-2012566 2 0.939
LR027874_9 9.3|2497634|33|LR027874|CRT 2497634-2497666 33 LR027874.1 2770258-2770290 2 0.939

1. spacer 5.1|912363|34|LR027874|CRISPRCasFinder matches to position: 1402786-1402819, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 5.1|912363|34|LR027874|CRISPRCasFinder matches to position: 1491971-1492004, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 9.2|2497575|36|LR027874|CRT matches to position: 1194555-1194590, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 7.1|1194654|26|LR027874|CRISPRCasFinder matches to position: 316726-316751, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cgggcccccaacatagaagctggcgg	Protospacer
**** *********************

5. spacer 7.1|1194654|26|LR027874|CRISPRCasFinder matches to position: 825465-825490, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
******************** *****

6. spacer 9.2|2497575|36|LR027874|CRT matches to position: 1857063-1857098, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

7. spacer 10.1|2993044|32|LR027874|CRISPRCasFinder matches to position: 862608-862639, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

8. spacer 10.1|2993044|32|LR027874|CRISPRCasFinder matches to position: 862666-862697, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

9. spacer 10.1|2993044|32|LR027874|CRISPRCasFinder matches to position: 1120071-1120102, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

10. spacer 10.1|2993044|32|LR027874|CRISPRCasFinder matches to position: 1492061-1492092, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

11. spacer 4.1|862472|26|LR027874|CRISPRCasFinder matches to position: 316726-316751, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttgggggcccg	Protospacer
************.******** ****

12. spacer 4.1|862472|26|LR027874|CRISPRCasFinder matches to position: 825465-825490, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

13. spacer 4.1|862472|26|LR027874|CRISPRCasFinder matches to position: 976471-976496, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

14. spacer 7.1|1194654|26|LR027874|CRISPRCasFinder matches to position: 825521-825546, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacataaaagcaggcgg	Protospacer
***************.**** *****

15. spacer 9.1|2497519|33|LR027874|CRT matches to position: 862508-862540, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

16. spacer 9.1|2497519|33|LR027874|CRT matches to position: 1194611-1194643, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

17. spacer 9.1|2497519|33|LR027874|CRT matches to position: 1402741-1402773, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

18. spacer 9.1|2497519|33|LR027874|CRT matches to position: 1492017-1492049, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

19. spacer 9.1|2497519|33|LR027874|CRT matches to position: 2012534-2012566, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

20. spacer 9.1|2497519|33|LR027874|CRT matches to position: 2770258-2770290, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

21. spacer 9.2|2497575|36|LR027874|CRT matches to position: 316851-316886, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

22. spacer 9.2|2497575|36|LR027874|CRT matches to position: 1671075-1671110, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

23. spacer 9.2|2497575|36|LR027874|CRT matches to position: 2023278-2023313, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

24. spacer 9.3|2497634|33|LR027874|CRT matches to position: 862508-862540, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

25. spacer 9.3|2497634|33|LR027874|CRT matches to position: 1194611-1194643, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

26. spacer 9.3|2497634|33|LR027874|CRT matches to position: 1402741-1402773, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

27. spacer 9.3|2497634|33|LR027874|CRT matches to position: 2012534-2012566, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

28. spacer 9.3|2497634|33|LR027874|CRT matches to position: 2770258-2770290, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027874_4 4.1|862472|26|LR027874|CRISPRCasFinder 862472-862497 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
LR027874_4 4.1|862472|26|LR027874|CRISPRCasFinder 862472-862497 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
LR027874_4 4.1|862472|26|LR027874|CRISPRCasFinder 862472-862497 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808

1. spacer 4.1|862472|26|LR027874|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

2. spacer 4.1|862472|26|LR027874|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

3. spacer 4.1|862472|26|LR027874|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage