Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027870 Staphylococcus aureus strain BPH2019 genome assembly, chromosome: 1 9 crisprs NA 6 1 0 0
LR027872 Staphylococcus aureus strain BPH2019 genome assembly, plasmid: 3 0 crisprs NA 0 0 0 0
LR027871 Staphylococcus aureus strain BPH2019 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0

Results visualization

1. LR027870
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_1 407029-407129 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_2 673872-673964 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_3 789752-789834 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_4 836299-836384 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_5 902917-902998 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_6 1103351-1103438 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_7 2254628-2254778 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_8 2380124-2380317 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027870_9 2878299-2878382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR027870_5 5.1|902941|34|LR027870|CRISPRCasFinder 902941-902974 34 LR027870.1 1401297-1401330 0 1.0
LR027870_5 5.1|902941|34|LR027870|CRISPRCasFinder 902941-902974 34 LR027870.1 1491813-1491846 0 1.0
LR027870_8 8.2|2380203|36|LR027870|CRT 2380203-2380238 36 LR027870.1 1187796-1187831 0 1.0
LR027870_8 8.2|2380203|36|LR027870|CRT 2380203-2380238 36 LR027870.1 1862231-1862266 1 0.972
LR027870_9 9.1|2878325|32|LR027870|CRISPRCasFinder 2878325-2878356 32 LR027870.1 836465-836496 1 0.969
LR027870_9 9.1|2878325|32|LR027870|CRISPRCasFinder 2878325-2878356 32 LR027870.1 836523-836554 1 0.969
LR027870_9 9.1|2878325|32|LR027870|CRISPRCasFinder 2878325-2878356 32 LR027870.1 1113311-1113342 1 0.969
LR027870_9 9.1|2878325|32|LR027870|CRISPRCasFinder 2878325-2878356 32 LR027870.1 1491903-1491934 1 0.969
LR027870_4 4.1|836329|26|LR027870|CRISPRCasFinder 836329-836354 26 LR027870.1 290152-290177 2 0.923
LR027870_4 4.1|836329|26|LR027870|CRISPRCasFinder 836329-836354 26 LR027870.1 799323-799348 2 0.923
LR027870_4 4.1|836329|26|LR027870|CRISPRCasFinder 836329-836354 26 LR027870.1 967048-967073 2 0.923
LR027870_8 8.1|2380147|33|LR027870|CRT 2380147-2380179 33 LR027870.1 836365-836397 2 0.939
LR027870_8 8.1|2380147|33|LR027870|CRT 2380147-2380179 33 LR027870.1 1187852-1187884 2 0.939
LR027870_8 8.1|2380147|33|LR027870|CRT 2380147-2380179 33 LR027870.1 1401252-1401284 2 0.939
LR027870_8 8.1|2380147|33|LR027870|CRT 2380147-2380179 33 LR027870.1 1491859-1491891 2 0.939
LR027870_8 8.1|2380147|33|LR027870|CRT 2380147-2380179 33 LR027870.1 2020058-2020090 2 0.939
LR027870_8 8.1|2380147|33|LR027870|CRT 2380147-2380179 33 LR027870.1 2654214-2654246 2 0.939
LR027870_8 8.2|2380203|36|LR027870|CRT 2380203-2380238 36 LR027870.1 290277-290312 2 0.944
LR027870_8 8.2|2380203|36|LR027870|CRT 2380203-2380238 36 LR027870.1 1673580-1673615 2 0.944
LR027870_8 8.2|2380203|36|LR027870|CRT 2380203-2380238 36 LR027870.1 2030772-2030807 2 0.944
LR027870_8 8.3|2380262|33|LR027870|CRT 2380262-2380294 33 LR027870.1 836365-836397 2 0.939
LR027870_8 8.3|2380262|33|LR027870|CRT 2380262-2380294 33 LR027870.1 1187852-1187884 2 0.939
LR027870_8 8.3|2380262|33|LR027870|CRT 2380262-2380294 33 LR027870.1 1401252-1401284 2 0.939
LR027870_8 8.3|2380262|33|LR027870|CRT 2380262-2380294 33 LR027870.1 2020058-2020090 2 0.939
LR027870_8 8.3|2380262|33|LR027870|CRT 2380262-2380294 33 LR027870.1 2654214-2654246 2 0.939

1. spacer 5.1|902941|34|LR027870|CRISPRCasFinder matches to position: 1401297-1401330, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 5.1|902941|34|LR027870|CRISPRCasFinder matches to position: 1491813-1491846, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 8.2|2380203|36|LR027870|CRT matches to position: 1187796-1187831, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 8.2|2380203|36|LR027870|CRT matches to position: 1862231-1862266, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

5. spacer 9.1|2878325|32|LR027870|CRISPRCasFinder matches to position: 836465-836496, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

6. spacer 9.1|2878325|32|LR027870|CRISPRCasFinder matches to position: 836523-836554, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

7. spacer 9.1|2878325|32|LR027870|CRISPRCasFinder matches to position: 1113311-1113342, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

8. spacer 9.1|2878325|32|LR027870|CRISPRCasFinder matches to position: 1491903-1491934, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

9. spacer 4.1|836329|26|LR027870|CRISPRCasFinder matches to position: 290152-290177, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttgggggcccg	Protospacer
************.******** ****

10. spacer 4.1|836329|26|LR027870|CRISPRCasFinder matches to position: 799323-799348, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

11. spacer 4.1|836329|26|LR027870|CRISPRCasFinder matches to position: 967048-967073, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

12. spacer 8.1|2380147|33|LR027870|CRT matches to position: 836365-836397, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

13. spacer 8.1|2380147|33|LR027870|CRT matches to position: 1187852-1187884, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

14. spacer 8.1|2380147|33|LR027870|CRT matches to position: 1401252-1401284, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

15. spacer 8.1|2380147|33|LR027870|CRT matches to position: 1491859-1491891, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

16. spacer 8.1|2380147|33|LR027870|CRT matches to position: 2020058-2020090, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

17. spacer 8.1|2380147|33|LR027870|CRT matches to position: 2654214-2654246, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

18. spacer 8.2|2380203|36|LR027870|CRT matches to position: 290277-290312, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

19. spacer 8.2|2380203|36|LR027870|CRT matches to position: 1673580-1673615, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

20. spacer 8.2|2380203|36|LR027870|CRT matches to position: 2030772-2030807, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

21. spacer 8.3|2380262|33|LR027870|CRT matches to position: 836365-836397, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

22. spacer 8.3|2380262|33|LR027870|CRT matches to position: 1187852-1187884, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

23. spacer 8.3|2380262|33|LR027870|CRT matches to position: 1401252-1401284, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

24. spacer 8.3|2380262|33|LR027870|CRT matches to position: 2020058-2020090, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

25. spacer 8.3|2380262|33|LR027870|CRT matches to position: 2654214-2654246, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027870_4 4.1|836329|26|LR027870|CRISPRCasFinder 836329-836354 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
LR027870_4 4.1|836329|26|LR027870|CRISPRCasFinder 836329-836354 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
LR027870_4 4.1|836329|26|LR027870|CRISPRCasFinder 836329-836354 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808

1. spacer 4.1|836329|26|LR027870|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

2. spacer 4.1|836329|26|LR027870|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

3. spacer 4.1|836329|26|LR027870|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage