Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
LT703005 | Anderseniella sp. Alg231_50 genome assembly, chromosome: III | 0 crisprs | 0 | 0 | 0 | 0 | |
LT703010 | Anderseniella sp. Alg231_50 genome assembly, chromosome: VIII | 0 crisprs | 0 | 0 | 0 | 0 | |
LT703004 | Anderseniella sp. Alg231_50 genome assembly, chromosome: II | 0 crisprs | 0 | 0 | 0 | 0 | |
LT703006 | Anderseniella sp. Alg231_50 genome assembly, chromosome: IV | 0 crisprs | 0 | 0 | 0 | 0 | |
LT703003 | Anderseniella sp. Alg231_50 genome assembly, chromosome: I | 2 crisprs | 0 | 1 | 0 | 0 | |
LT703009 | Anderseniella sp. Alg231_50 genome assembly, chromosome: VII | 0 crisprs | 0 | 0 | 0 | 0 | |
LT703007 | Anderseniella sp. Alg231_50 genome assembly, chromosome: V | 0 crisprs | 0 | 0 | 0 | 0 | |
LT703008 | Anderseniella sp. Alg231_50 genome assembly, chromosome: VI | 0 crisprs | 0 | 0 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT703003_1 | 1245924-1246066 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT703003_2 | 1331800-1331885 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
LT703003_2 | 1331829-1331856 | 28 | KY622015 | Shewanella phage SppYZU01, complete genome | 11928-11955 | 5 | 0.821 | |
LT703003_2 | 1331829-1331856 | 28 | KX925554 | Streptomyces phage BRock, complete genome | 5806-5833 | 6 | 0.786 |
cttggcgtcttccttcgacttttcttcc CRISPR spacer ggcggagtcttccttcgccttttcttcc Protospacer .** *********** **********
cttggcgtcttccttcgacttttcttcc CRISPR spacer caacgcgtcttccttcaactcttcttcg Protospacer * ************.***.******
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|