Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT999999 Chlamydia suis isolate 4-29b genome assembly, chromosome: I 2 crisprs NA 0 1 0 0

Results visualization

1. LT999999
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT999999_1 568716-568798 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT999999_2 1075006-1075100 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MT424636 Synechococcus phage S-SBP1, complete genome 31607-31631 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 KC900378 Pseudomonas phage LKA5, complete genome 40740-40764 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MT118301 Pseudomonas phage Epa33, complete genome 39348-39372 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 LT603684 Pseudomonas phage phiC725A genome assembly 40371-40395 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 NZ_CP034552 Bacillus cereus ATCC 14579 plasmid unnamed, complete sequence 6171-6195 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 NC_004721 Bacillus cereus ATCC 14579 plasmid pBClin15, complete sequence 6233-6257 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511042 Pseudomonas phage CF126, partial genome 37591-37615 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511051 Pseudomonas phage BR181, partial genome 21514-21538 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511041 Pseudomonas phage CF69, partial genome 37619-37643 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MF490237 Pseudomonas phage vB_PaeP_E220, complete genome 32754-32778 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511049 Pseudomonas phage BR326, partial genome 21514-21538 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511045 Pseudomonas phage BR208, partial genome 21514-21538 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511044 Pseudomonas phage BR197, partial genome 37619-37643 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511050 Pseudomonas phage BR150, partial genome 37547-37571 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511048 Pseudomonas phage BR320, partial genome 37547-37571 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511046 Pseudomonas phage BR313, partial genome 21514-21538 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 KM389216 UNVERIFIED: Pseudomonas phage F_ET605sp/Pa1651 clone contig00001 genomic sequence 26186-26210 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511047 Pseudomonas phage BR319, partial genome 37723-37747 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511043 Pseudomonas phage BR228, partial genome 33668-33692 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 KM389247 UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence 7770-7794 4 0.84
LT999999_1 1.1|568745|25|LT999999|CRISPRCasFinder 568745-568769 25 MK511039 Pseudomonas phage CF24, partial genome 37619-37643 4 0.84

1. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MT424636 (Synechococcus phage S-SBP1, complete genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtagcagacattgtcgatcct	Protospacer
***************** **** .

2. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

3. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MT118301 (Pseudomonas phage Epa33, complete genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

4. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

5. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to NZ_CP034552 (Bacillus cereus ATCC 14579 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
gcgtttagcagatattgacgatgta	Protospacer
  ** *******.************

6. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to NC_004721 (Bacillus cereus ATCC 14579 plasmid pBClin15, complete sequence) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
gcgtttagcagatattgacgatgta	Protospacer
  ** *******.************

7. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511042 (Pseudomonas phage CF126, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

8. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511051 (Pseudomonas phage BR181, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

9. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511041 (Pseudomonas phage CF69, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

10. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MF490237 (Pseudomonas phage vB_PaeP_E220, complete genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

11. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511049 (Pseudomonas phage BR326, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

12. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511045 (Pseudomonas phage BR208, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

13. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511044 (Pseudomonas phage BR197, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

14. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511050 (Pseudomonas phage BR150, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

15. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511048 (Pseudomonas phage BR320, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

16. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511046 (Pseudomonas phage BR313, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

17. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to KM389216 (UNVERIFIED: Pseudomonas phage F_ET605sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

18. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511047 (Pseudomonas phage BR319, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

19. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511043 (Pseudomonas phage BR228, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

20. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

21. spacer 1.1|568745|25|LT999999|CRISPRCasFinder matches to MK511039 (Pseudomonas phage CF24, partial genome) position: , mismatch: 4, identity: 0.84 

cggtgtagcagacattgacgatgta	CRISPR spacer
cggtgtcgcagaccttgacgatgac	Protospacer
****** ****** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage