Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028725 Enterococcus faecalis strain CVM N60443F plasmid pN60443F-2, complete sequence 0 crisprs NA 0 0 0 0
CP028726 Enterococcus faecalis strain CVM N60443F plasmid pN60443F-1, complete sequence 0 crisprs NA 0 0 0 0
CP028724 Enterococcus faecalis strain CVM N60443F chromosome, complete genome 5 crisprs NA 0 35 0 0

Results visualization

1. CP028724
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028724_1 177601-178690 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028724_2 399244-399741 Orphan II-A,II-B
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028724_3 607281-607394 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028724_4 1227638-1227711 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028724_5 1839936-1841291 Orphan II-A,II-B
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 KY303907 Enterococcus phage EF-P29, complete genome 5001-5030 0 1.0
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 KY472224 Enterococcus phage EF-P10, complete genome 2074-2103 0 1.0
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 NC_041959 Enterococcus phage IME-EF1, complete genome 18616-18645 0 1.0
CP028724_1 1.7|178033|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178033-178062 30 NC_028671 Enterococcus phage vB_EfaS_IME197, complete genome 16328-16357 0 1.0
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 NC_009904 Enterococcus phage phiEF24C, complete genome 106838-106866 0 1.0
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 AP009390 Enterococcus phage phiEF24C DNA, complete genome 106838-106866 0 1.0
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 106838-106866 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 139227-139256 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_009904 Enterococcus phage phiEF24C, complete genome 99378-99407 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP009390 Enterococcus phage phiEF24C DNA, complete genome 99378-99407 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 CAJDJY010000002 Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence 104020-104049 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MN854830 Enterococcus phage PBEF129, complete genome 138623-138652 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MN854830 Enterococcus phage PBEF129, complete genome 139174-139203 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 99378-99407 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 LR031359 Enterococcus phage 156, complete genome 104020-104049 0 1.0
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KJ801817 Enterococcus phage ECP3, complete genome 138131-138160 0 1.0
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NZ_CP022485 Enterococcus faecalis ARO1/DG plasmid pARO1.2, complete sequence 14606-14635 0 1.0
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NZ_AP018540 Enterococcus faecalis strain KUB3006 plasmid pKUB3006-2, complete sequence 73628-73657 0 1.0
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NZ_CP030044 Enterococcus faecalis strain C25 plasmid pC25-2, complete sequence 67167-67196 0 1.0
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 LC547238 Entercoccus phage phiM1EF2 DNA, nearly complete genome 2918-2947 0 1.0
CP028724_5 5.5|1840236|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840236-1840265 30 MK721189 Enterococcus phage vB_EfaS_Ef2.2, complete genome 56226-56255 0 1.0
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 KY303907 Enterococcus phage EF-P29, complete genome 30081-30110 0 1.0
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 KY472224 Enterococcus phage EF-P10, complete genome 26045-26074 0 1.0
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 NC_029016 Enterococcus phage vB_EfaS_IME198, complete genome 31504-31533 0 1.0
CP028724_5 5.11|1840632|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840632-1840661 30 GQ452243 Enterococcus phage phiEf11, complete genome 12574-12603 0 1.0
CP028724_5 5.11|1840632|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840632-1840661 30 NC_028671 Enterococcus phage vB_EfaS_IME197, complete genome 11483-11512 0 1.0
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 GQ478085 Enterococcus phage phiFL2B, complete genome 14692-14721 0 1.0
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NC_013643 Enterococcus phage phiFL2A, complete genome 14103-14132 0 1.0
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 26991-27020 0 1.0
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 MH791415 UNVERIFIED: Enterococcus phage EfsWh-1, complete genome 55180-55209 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 MH618488 Enterococcus phage vB_EfaS_HEf13, complete genome 1673-1702 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 NC_018086 Enterococcus phage BC-611, complete genome 48187-48216 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 NC_041960 Enterococcus phage SAP6, complete genome 20297-20326 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 AB712291 Enterococcus phage BC-611 DNA, complete genome 48187-48216 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 MN871443 UNVERIFIED: Enterococcus phage EfsWh_1, complete genome 55180-55209 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 MK570225 Enterococcus phage vB_EfaS_PHB08, complete genome 3553-3582 1 0.967
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 KJ801817 Enterococcus phage ECP3, complete genome 133592-133620 1 0.966
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 MN854830 Enterococcus phage PBEF129, complete genome 1619-1647 1 0.966
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 MN854830 Enterococcus phage PBEF129, complete genome 143139-143167 1 0.966
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_009904 Enterococcus phage phiEF24C, complete genome 99930-99959 1 0.967
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP009390 Enterococcus phage phiEF24C DNA, complete genome 99930-99959 1 0.967
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 99930-99959 1 0.967
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK721192 Enterococcus phage vB_EfaM_Ef2.3, complete genome 140931-140960 1 0.967
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NC_004670 Enterococcus faecalis V583 plasmid pTEF3, complete sequence 12025-12054 1 0.967
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 76144-76173 1 0.967
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MK721189 Enterococcus phage vB_EfaS_Ef2.2, complete genome 53834-53863 1 0.967
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 HE962497 Streptococcus phage SP-QS1 complete genome 48237-48266 1 0.967
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MN103542 Enterococcus phage vB_EfaS_EF1c55, complete genome 4108-4137 1 0.967
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 NC_041959 Enterococcus phage IME-EF1, complete genome 16373-16402 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 MH618488 Enterococcus phage vB_EfaS_HEf13, complete genome 26426-26455 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 LC547238 Entercoccus phage phiM1EF2 DNA, nearly complete genome 30943-30972 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 NC_041959 Enterococcus phage IME-EF1, complete genome 43659-43688 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 MH791415 UNVERIFIED: Enterococcus phage EfsWh-1, complete genome 30482-30511 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 HE962497 Streptococcus phage SP-QS1 complete genome 20856-20885 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 KJ127303 Enterococcus phage VD13, complete genome 25275-25304 1 0.967
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 MN871443 UNVERIFIED: Enterococcus phage EfsWh_1, complete genome 30482-30511 1 0.967
CP028724_5 5.11|1840632|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840632-1840661 30 KJ608188 Enterococcus phage EFC-1, complete genome 28943-28972 1 0.967
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 GQ478087 Enterococcus phage phiFL3B, complete genome 15516-15545 1 0.967
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NC_013648 Enterococcus phage phiFL3A, complete genome 15210-15239 1 0.967
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 GQ452243 Enterococcus phage phiEf11, complete genome 39497-39526 1 0.967
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NC_028671 Enterococcus phage vB_EfaS_IME197, complete genome 39141-39170 1 0.967
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 MK721187 Enterococcus phage vB_EfaS_Ef6.1, complete genome 27427-27456 1 0.967
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 MK721194 Enterococcus phage vB_EfaS_Ef7.1, complete genome 50367-50396 2 0.933
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 NC_029016 Enterococcus phage vB_EfaS_IME198, complete genome 56042-56071 2 0.933
CP028724_1 1.7|178033|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178033-178062 30 KJ608188 Enterococcus phage EFC-1, complete genome 33789-33818 2 0.933
CP028724_1 1.7|178033|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178033-178062 30 GQ452243 Enterococcus phage phiEf11, complete genome 17417-17446 2 0.933
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 NC_029026 Enterococcus phage EFLK1, complete genome 21921-21949 2 0.931
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 1299-1327 2 0.931
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 142895-142923 2 0.931
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 136106-136135 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 136723-136752 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 137410-137439 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_009904 Enterococcus phage phiEF24C, complete genome 95939-95968 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_009904 Enterococcus phage phiEF24C, complete genome 97565-97594 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP009390 Enterococcus phage phiEF24C DNA, complete genome 95939-95968 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP009390 Enterococcus phage phiEF24C DNA, complete genome 97565-97594 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 CAJDJY010000002 Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence 101204-101233 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 CAJDJY010000002 Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence 102112-102141 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 CAJDJY010000002 Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence 107217-107246 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MN854830 Enterococcus phage PBEF129, complete genome 137036-137065 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 95939-95968 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 97565-97594 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 LR031359 Enterococcus phage 156, complete genome 101204-101233 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 LR031359 Enterococcus phage 156, complete genome 102112-102141 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 LR031359 Enterococcus phage 156, complete genome 107217-107246 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KJ801817 Enterococcus phage ECP3, complete genome 140315-140344 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018715 Enterococcus phage phiM1EF22 DNA, complete sequence 100936-100965 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018715 Enterococcus phage phiM1EF22 DNA, complete sequence 101225-101254 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018715 Enterococcus phage phiM1EF22 DNA, complete sequence 101544-101573 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018715 Enterococcus phage phiM1EF22 DNA, complete sequence 102766-102795 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 CAJDJZ010000002 Enterococcus phage vB_EfaH_149 genome assembly, contig: phage149-genome, whole genome shotgun sequence 104986-105015 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 CAJDJZ010000002 Enterococcus phage vB_EfaH_149 genome assembly, contig: phage149-genome, whole genome shotgun sequence 107347-107376 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018714 Enterococcus phage phiEF17H DNA, complete sequence 103763-103792 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018714 Enterococcus phage phiEF17H DNA, complete sequence 104052-104081 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK693030 Enterococcus phage vB_EfaM_Ef2.1, complete genome 135364-135393 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_029026 Enterococcus phage EFLK1, complete genome 29460-29489 2 0.933
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_029026 Enterococcus phage EFLK1, complete genome 30764-30793 2 0.933
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NZ_CP015884 Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence 121698-121727 2 0.933
CP028724_2 2.4|399478|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399478-399507 30 LC547238 Entercoccus phage phiM1EF2 DNA, nearly complete genome 26521-26550 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MH791415 UNVERIFIED: Enterococcus phage EfsWh-1, complete genome 682-711 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 NC_018086 Enterococcus phage BC-611, complete genome 50221-50250 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 AB712291 Enterococcus phage BC-611 DNA, complete genome 50221-50250 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MN871443 UNVERIFIED: Enterococcus phage EfsWh_1, complete genome 682-711 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 NC_029016 Enterococcus phage vB_EfaS_IME198, complete genome 1194-1223 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MK800154 Enterococcus phage Entf1, complete genome 31633-31662 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 KY303907 Enterococcus phage EF-P29, complete genome 2766-2795 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 NC_041960 Enterococcus phage SAP6, complete genome 17960-17989 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MK570225 Enterococcus phage vB_EfaS_PHB08, complete genome 1118-1147 2 0.933
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 KY472224 Enterococcus phage EF-P10, complete genome 56805-56834 2 0.933
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 MK800154 Enterococcus phage Entf1, complete genome 1604-1633 2 0.933
CP028724_5 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT 1840500-1840529 30 MN103542 Enterococcus phage vB_EfaS_EF1c55, complete genome 29259-29288 2 0.933
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 GQ478082 Enterococcus phage phiFL1B, complete genome 14692-14721 2 0.933
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 GQ478083 Enterococcus phage phiFL1C, complete genome 14426-14455 2 0.933
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NC_013646 Enterococcus phage phiFL1A, complete genome 14445-14474 2 0.933
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 MT119359 Enterococcus phage heks, complete genome 31812-31841 2 0.933
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 MK125140 Enterococcus phage Nonaheksakonda, complete genome 28370-28399 2 0.933
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 NC_042023 Enterococcus phage phiSHEF5, complete genome 14060-14089 2 0.933
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 MK693030 Enterococcus phage vB_EfaM_Ef2.1, complete genome 1588-1616 3 0.897
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 MK693030 Enterococcus phage vB_EfaM_Ef2.1, complete genome 140191-140219 3 0.897
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_009904 Enterococcus phage phiEF24C, complete genome 104316-104345 3 0.9
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP009390 Enterococcus phage phiEF24C DNA, complete genome 104316-104345 3 0.9
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MN854830 Enterococcus phage PBEF129, complete genome 1799-1828 3 0.9
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MN854830 Enterococcus phage PBEF129, complete genome 143319-143348 3 0.9
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 104316-104345 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MT080590 UNVERIFIED: Staphylococcus phage vB_SauM_EW27, complete genome 21178-21207 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 KY779848 Staphylococcus phage qdsa001, complete genome 83238-83267 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 KX532239 Staphylococcus phage StAP1, complete genome 63257-63286 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 LC492751 Staphylococcus phage KSAP7 genomic DNA, compelete genome 49908-49937 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 JX194239 Staphylococcus phage SA11, complete genome 72996-73025 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 LC492752 Staphylococcus phage KSAP11 genomic DNA, compelete genome 49728-49757 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MT080584 UNVERIFIED: Staphylococcus phage vB_SauM_EW15, complete genome 114694-114723 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MT080587 UNVERIFIED: Staphylococcus phage vB_SauM_EW20, complete genome 84813-84842 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 AP019522 Staphylococcal phage MR003 DNA, complete genome 85650-85679 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 NC_022090 Staphylococcus phage vB_SauM_Remus, complete genome 49611-49640 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 KP881332 Staphylococcus phage Stau2, complete genome 55504-55533 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MT080588 UNVERIFIED: Staphylococcus phage vB_SauM_EW22, complete genome 61036-61065 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MT080595 UNVERIFIED: Staphylococcus phage vB_SauM_EW41, partial genome 42288-42317 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 NC_020877 Staphylococcus phage vB_SauM_Romulus, complete genome 49611-49640 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 KX171213 Staphylococcus phage vB_SscM-2, complete genome 115550-115579 3 0.9
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 NC_047767 Staphylococcus phage vB_SscM-1, complete genome 115549-115578 3 0.9
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 HE962497 Streptococcus phage SP-QS1 complete genome 45275-45304 4 0.867
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 KJ127303 Enterococcus phage VD13, complete genome 47310-47339 4 0.867
CP028724_1 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177637-177666 30 MN103542 Enterococcus phage vB_EfaS_EF1c55, complete genome 6061-6090 4 0.867
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK268686 Enterococcus phage vB_EfaH_EF1TV, complete genome 140237-140266 4 0.867
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KJ801817 Enterococcus phage ECP3, complete genome 137581-137610 4 0.867
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK721192 Enterococcus phage vB_EfaM_Ef2.3, complete genome 1513-1542 4 0.867
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK721192 Enterococcus phage vB_EfaM_Ef2.3, complete genome 144584-144613 4 0.867
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_029026 Enterococcus phage EFLK1, complete genome 24056-24085 4 0.867
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_029026 Enterococcus phage EFLK1, complete genome 26949-26978 4 0.867
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 KX171213 Staphylococcus phage vB_SscM-2, complete genome 88542-88571 4 0.867
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 NC_047767 Staphylococcus phage vB_SscM-1, complete genome 88541-88570 4 0.867
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 NZ_CP013842 Clostridium botulinum strain AM1051 plasmid pRSJ13_1, complete sequence 9906-9935 5 0.833
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 NZ_CP013687 Clostridium botulinum strain F1425 plasmid pRSJ9_1, complete sequence 2955-2984 5 0.833
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 NZ_CP014220 Clostridium botulinum strain B515 plasmid pRSJ21_1, complete sequence 9244-9273 5 0.833
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 NZ_CP028860 Clostridium botulinum strain CFSAN064329 plasmid pCFSAN064329, complete sequence 8280-8309 5 0.833
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 NZ_CP013851 Clostridium botulinum strain B305 plasmid pRSJ6_1, complete sequence 2893-2922 5 0.833
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 NC_009700 Clostridium botulinum F str. Langeland plasmid pCLI, complete sequence 14087-14116 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_009904 Enterococcus phage phiEF24C, complete genome 98704-98733 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP009390 Enterococcus phage phiEF24C DNA, complete genome 98704-98733 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 98704-98733 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 AP018714 Enterococcus phage phiEF17H DNA, complete sequence 104372-104401 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NC_030946 Streptococcus phage phiARI0923, complete genome 30076-30105 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MT900487 Streptococcus phage 23TH, complete genome 3049-3078 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 MK448914 Streptococcus phage Javan348, complete genome 3149-3178 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065495 Streptococcus phage IPP58, complete genome 3247-3276 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065484 Streptococcus phage IPP44, complete genome 3247-3276 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065463 Streptococcus phage IPP22, complete genome 3247-3276 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065494 Streptococcus phage IPP57, complete genome 3247-3276 5 0.833
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065459 Streptococcus phage IPP18, complete genome 3247-3276 5 0.833
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP012912 Streptococcus suis strain NSUI060 plasmid pNSUI060a, complete sequence 8467-8496 5 0.833
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 620128-620157 5 0.833
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 JN638751 Bacillus phage G, complete genome 215907-215936 5 0.833
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 NC_027352 Bacillus phage JBP901, complete genome 22214-22243 5 0.833
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 1231-1260 5 0.833
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NZ_AP019826 Leptotrichia hofstadii strain JCM16775 plasmid pJCM16775-3, complete sequence 2748-2777 5 0.833
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NZ_LT985310 Escherichia coli strain CIP106223 plasmid RCS93_pII, complete sequence 18562-18591 5 0.833
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 MH375074 Enterococcus phage LY0323, complete genome 11789-11818 5 0.833
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 MK982307 Enterococcus phage MSF2, complete genome 33836-33865 5 0.833
CP028724_5 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841094-1841123 30 KX284704 Enterococcus phage SANTOR1, complete genome 25134-25163 5 0.833
CP028724_1 1.5|177901|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177901-177930 30 MN855861 Bacteriophage sp. isolate 284, complete genome 2480-2509 6 0.8
CP028724_1 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177967-177996 30 NZ_CP039926 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129c, complete sequence 171-200 6 0.8
CP028724_1 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177967-177996 30 NZ_CP033033 Agrobacterium tumefaciens strain 12D1 plasmid pTi12D1, complete sequence 210-239 6 0.8
CP028724_1 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177967-177996 30 NZ_MK318973 Agrobacterium rhizogenes strain Colt5.8 plasmid pOC-Colt5.8, complete sequence 190-219 6 0.8
CP028724_1 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178099-178127 29 NC_015427 Clostridium botulinum BKT015925 plasmid p4BKT015925, complete sequence 34649-34677 6 0.793
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065458 Streptococcus phage IPP17, complete genome 3149-3178 6 0.8
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065462 Streptococcus phage IPP21, complete genome 3149-3178 6 0.8
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 KY065470 Streptococcus phage IPP29, complete genome 3149-3178 6 0.8
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 MH629685 Synechococcus virus S-PRM1, complete genome 87282-87311 6 0.8
CP028724_2 2.1|399280|30|CP028724|CRISPRCasFinder 399280-399309 30 NC_011774 Bacillus cereus G9842 plasmid pG9842_140, complete sequence 45872-45901 6 0.8
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NZ_CP053900 Proteus mirabilis strain YPM35 plasmid pJPM35-2, complete sequence 27198-27227 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_CP018328 Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-4, complete sequence 12041-12070 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_CP018328 Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-4, complete sequence 27838-27867 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_CP035017 Lactobacillus plantarum strain 12_3 plasmid pldE, complete sequence 8037-8066 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_AP018406 Lactobacillus plantarum strain SN35N plasmid pSN35N-1, complete sequence 7302-7331 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_LT907984 Lactobacillus sakei subsp. sakei 23K plasmid pJ23A1, complete sequence 52933-52962 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 254206-254235 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_CP009647 Bacillus pseudomycoides strain BTZ plasmid pBTZ_4, complete sequence 3142-3171 6 0.8
CP028724_5 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT 1839972-1840001 30 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 460991-461020 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP023526 Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence 237215-237244 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 437514-437543 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 65677-65706 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 73456-73485 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 496391-496420 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KX160216 Lactococcus phage 98202, complete genome 5947-5976 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 AY682195 Lactobacillus plantarum bacteriophage LP65, complete genome 8391-8420 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NC_006565 Lactobacillus phage LP65, complete genome 8391-8420 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KX160218 Lactococcus phage 98204, complete genome 4726-4755 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KX160217 Lactococcus phage 98203, complete genome 5365-5394 6 0.8
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MN855957 Myoviridae sp. isolate 155, partial genome 9301-9330 6 0.8
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 NZ_CP026605 Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence 159280-159309 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 MT133560 Pseudomonas phage fnug, complete genome 185791-185820 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 KU521356 Pseudomonas phage KTN4, complete genome 186343-186372 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 MW057919 Pseudomonas phage vB_PaeM_kmuB, complete genome 185137-185166 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 MN034767 Leviviridae sp. isolate H4_Rhizo_Litter_19_scaffold_469 RNA-dependent RNA polymerase (H4RhizoLitter19469_000001), hypothetical protein (H4RhizoLitter19469_000002), hypothetical protein (H4RhizoLitter19469_000003), and hypothetical protein (H4RhizoLitter19469_000004) genes, complete cds 1274-1303 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 LC541428 Staphylococcus phage vB_SauS_JS02 DNA, complete genome 40382-40411 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NC_004629 Pseudomonas phage phiKZ, complete genome 184950-184979 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 MN871480 UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome 98008-98037 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 DI373487 KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof 122090-122119 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 MN871489 UNVERIFIED: Pseudomonas phage PaZh_1, complete genome 129921-129950 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NC_042081 Pseudomonas phage SL2, complete genome 101341-101370 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NC_042060 Pseudomonas phage PA7, partial genome 122090-122119 6 0.8
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 AP019418 Pseudomonas phage PA02 DNA, nearly complete genome 39427-39456 6 0.8
CP028724_5 5.12|1840698|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840698-1840727 30 NZ_KJ776578 Clostridium botulinum strain CDC3875 plasmid pCDC3875, complete sequence 26197-26226 6 0.8
CP028724_5 5.12|1840698|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840698-1840727 30 NZ_KJ776580 Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence 31008-31037 6 0.8
CP028724_5 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841028-1841057 30 KY290955 Aeromonas phage 65.2, complete genome 106696-106725 6 0.8
CP028724_5 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841028-1841057 30 NC_015251 Aeromonas phage 65, complete genome 106713-106742 6 0.8
CP028724_5 5.19|1841160|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841160-1841189 30 NZ_CP015884 Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence 96068-96097 6 0.8
CP028724_5 5.20|1841226|30|CP028724|CRISPRCasFinder,CRT 1841226-1841255 30 MK867354 Synechococcus phage S-SCSM1, complete genome 151260-151289 6 0.8
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 CP031730 Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence 124131-124160 7 0.767
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 MN694614 Marine virus AFVG_250M469, complete genome 12506-12535 7 0.767
CP028724_1 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177835-177864 30 MN694392 Marine virus AFVG_250M8, complete genome 32033-32062 7 0.767
CP028724_1 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177967-177996 30 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1026415-1026444 7 0.767
CP028724_1 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 177967-177996 30 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 268339-268368 7 0.767
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NZ_CP024036 Bacillus aryabhattai strain K13 plasmid unnamed1 85043-85072 7 0.767
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 LC557520 Staphylococcus phage vB_SsapH-Golestan101-M DNA, complete genome 5546-5575 7 0.767
CP028724_1 1.10|178230|29|CP028724|PILER-CR,CRISPRCasFinder,CRT 178230-178258 29 MK268344 Salmonella phage Munch, complete genome 277843-277871 7 0.759
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 MN693240 Marine virus AFVG_25M497, complete genome 9268-9297 7 0.767
CP028724_1 1.13|178427|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178427-178456 30 KU645528 Acidianus tailed spindle virus isolate 1, complete genome 3836-3865 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 KF664572 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1068-1097 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 FJ449748 Vibrio phage CTX strain E1781 RstR (rstR) gene, complete cds 1054-1083 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466609 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1065-1094 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466609 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8106-8135 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466610 Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 1266-1295 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466610 Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 8307-8336 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ499847 Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), Ace (ace), ZOT (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds; and unknown gene 1240-1269 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 DQ012295 Vibrio phage CTX CtxB (ctxB) gene, partial cds; RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds 1339-1368 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485644 Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1268-1297 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485644 Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8316-8345 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 KF664567 Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1058-1087 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 KF664567 Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8105-8134 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 FJ449743 Vibrio phage CTX strain MG116926 RstR (rstR) gene, complete cds 1054-1083 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466612 Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1065-1094 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466612 Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8113-8142 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485649 Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1054-1083 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485649 Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8095-8124 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485646 Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1054-1083 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485646 Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8102-8131 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 MF155889 Vibrio virus CTXphi, complete genome 413-442 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 FJ449738 Vibrio phage CTX strain 07.95vp RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds 1245-1274 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485648 Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1054-1083 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485648 Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8102-8131 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 KT728931 Vibrio phage pre-CTX, complete genome 945-974 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485645 Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1268-1297 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485645 Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8316-8345 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ466608 Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds 1266-1295 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485647 Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 1054-1083 7 0.767
CP028724_1 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178559-178588 30 GQ485647 Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds 8102-8131 7 0.767
CP028724_2 2.1|399280|30|CP028724|CRISPRCasFinder 399280-399309 30 AP013520 Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S39-C26 12136-12165 7 0.767
CP028724_2 2.6|399610|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399610-399639 30 NC_047762 Xanthomonas phage XAJ24, complete genome 13115-13144 7 0.767
CP028724_2 2.7|399676|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399676-399705 30 CP016195 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-1, complete sequence 216206-216235 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MN855807 Siphoviridae sp. isolate 122, partial genome 5187-5216 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KY554766 Lactococcus phage AM6, complete genome 11786-11815 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KY554763 Lactococcus phage LW32, complete genome 11339-11368 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MT500540 Listeria phage LP-HM00113468, complete genome 16635-16664 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NC_049806 Lactococcus phage LW31, complete genome 11339-11368 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MK448986 Streptococcus phage Javan570, complete genome 23273-23302 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 L13696 Bacteriophage L2 (from Mycoplasma), complete genome 6839-6868 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KY554765 Lactococcus phage LW4, complete genome 11398-11427 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MN528768 Lactococcus phage P596, complete genome 10959-10988 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KY554764 Lactococcus phage LW33, complete genome 11637-11666 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NC_049805 Lactococcus phage phiQ1 DNA, complete genome 51827-51856 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 KY554767 Lactococcus phage AM7, complete genome 11786-11815 7 0.767
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NC_001447 Acholeplasma phage L2, complete genome 6839-6868 7 0.767
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NC_019538 Aeromonas phage CC2, complete genome 123472-123501 7 0.767
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 181359-181388 7 0.767
CP028724_5 5.12|1840698|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840698-1840727 30 NZ_CP014218 Clostridium botulinum strain B515 plasmid pRSJ21_3, complete sequence 9126-9155 7 0.767
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 MH179477 Aeromonas phage 60AhydR15PP, complete genome 151274-151303 7 0.767
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NC_014635 Aeromonas phage phiAS4, complete genome 51356-51385 7 0.767
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NC_020879 Aeromonas phage Aes012, complete genome 116920-116949 7 0.767
CP028724_5 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840830-1840859 30 NZ_CP025802 Yersinia ruckeri strain SC09 plasmid pLT, complete sequence 26191-26220 7 0.767
CP028724_5 5.15|1840896|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840896-1840925 30 NZ_CP016597 Bacillus cereus strain K8 plasmid pBCK802, complete sequence 47444-47473 7 0.767
CP028724_5 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841028-1841057 30 MT490303 Prochlorococcus phage P-HS2, complete genome 16533-16562 7 0.767
CP028724_5 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841028-1841057 30 MN694626 Marine virus AFVG_250M967, complete genome 9439-9468 7 0.767
CP028724_5 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841028-1841057 30 NC_020847 Cyanophage MED4-184 genomic sequence 16533-16562 7 0.767
CP028724_5 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1841028-1841057 30 JF974321 Cyanophage MED4-117 genomic sequence 13699-13728 7 0.767
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NZ_CP032859 Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed2, complete sequence 108-137 8 0.733
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NZ_CP043503 Bacillus paralicheniformis strain A4-3 plasmid unnamed2, complete sequence 378-407 8 0.733
CP028724_1 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178164-178193 30 NZ_CP032874 Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed2, complete sequence 2065-2094 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693610 Marine virus AFVG_250M347, complete genome 6085-6114 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693919 Marine virus AFVG_250M503, complete genome 31048-31077 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694187 Marine virus AFVG_250M1090, complete genome 5659-5688 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694712 Marine virus AFVG_250M502, complete genome 31049-31078 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693995 Marine virus AFVG_250M873, complete genome 48118-48147 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693748 Marine virus AFVG_250M1092, complete genome 48742-48771 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693983 Marine virus AFVG_250M348, complete genome 47697-47726 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694702 Marine virus AFVG_250M1088, complete genome 48534-48563 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693937 Marine virus AFVG_250M350, complete genome 47590-47619 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694478 Marine virus AFVG_250M504, complete genome 5116-5145 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN693780 Marine virus AFVG_250M1089, complete genome 48227-48256 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694535 Marine virus AFVG_250M1087, complete genome 48067-48096 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694384 Marine virus AFVG_250M349, complete genome 47546-47575 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694270 Marine virus AFVG_250M505, complete genome 5238-5267 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694656 Marine virus AFVG_250M501, complete genome 4846-4875 8 0.733
CP028724_1 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178295-178324 30 MN694622 Marine virus AFVG_250M1091, complete genome 48776-48805 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 MN693571 Marine virus AFVG_25M499, complete genome 9235-9264 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 MN693372 Marine virus AFVG_25M493, complete genome 22203-22232 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 MN693321 Marine virus AFVG_25M500, complete genome 9255-9284 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 MT681669 Aeromonas phage PZL-Ah1, complete genome 31232-31261 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 JX872508 Stenotrophomonas phage IME15, complete genome 7229-7258 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 NC_047942 Escherichia phage Ebrios, complete genome 7220-7249 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NC_011785 Borreliella burgdorferi ZS7 plasmid ZS7_lp28-4, complete sequence 23331-23360 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NC_018993 Borrelia burgdorferi 297 plasmid 297_lp28-4, complete sequence 23360-23389 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NC_017407 Borreliella burgdorferi JD1 plasmid JD1 lp28-4, complete sequence 25867-25896 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NC_017416 Borreliella burgdorferi N40 plasmid N40_lp28-4, complete sequence 25147-25176 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NZ_CP031403 Borreliella burgdorferi strain MM1 plasmid plsm_lp28-4, complete sequence 23382-23411 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NC_001854 Borreliella burgdorferi B31 plasmid lp28-4, complete sequence 24444-24473 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NC_001856 Borreliella burgdorferi B31 plasmid lp38, complete sequence 30126-30155 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NZ_CP019853 Borreliella burgdorferi plasmid lp38, complete sequence 30139-30168 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NZ_CP019764 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence 30132-30161 8 0.733
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NZ_CP017217 Borreliella burgdorferi strain B331 plasmid B331_lp38, complete sequence 30202-30231 8 0.733
CP028724_2 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399346-399375 30 NC_009795 Campylobacter concisus 13826 plasmid pCCON31, complete sequence 17771-17800 8 0.733
CP028724_2 2.3|399412|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399412-399441 30 NZ_CP007767 Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence 2347-2376 8 0.733
CP028724_2 2.3|399412|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399412-399441 30 NC_012040 Campylobacter lari RM2100 plasmid pCL2100, complete sequence 4820-4849 8 0.733
CP028724_2 2.7|399676|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399676-399705 30 MN693396 Marine virus AFVG_25M191, complete genome 8067-8096 8 0.733
CP028724_2 2.7|399676|30|CP028724|CRISPRCasFinder,PILER-CR,CRT 399676-399705 30 MN693591 Marine virus AFVG_25M357, complete genome 29282-29311 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP020413 Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence 265643-265672 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_LR134422 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13 13691-13720 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NC_016982 Lactococcus garvieae 21881 plasmid pGL5 complete sequence 66545-66574 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 216041-216070 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP020349 Pasteurella multocida subsp. septica strain CIRMBP-0873 plasmid unnamed2, complete sequence 26741-26770 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 CP029293 Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed6 103982-104011 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_CP016702 Lactococcus lactis subsp. lactis strain 275 plasmid p275D, complete sequence 26026-26055 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 NZ_MF547664 Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence 49568-49597 8 0.733
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MN693578 Marine virus AFVG_25M520, complete genome 28636-28665 8 0.733
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 LR588166 Pseudomonas phage vB_PaeM_MIJ3 44128-44157 8 0.733
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 MH121069 Pseudomonas phage vB_PaeM_PA5oct, complete genome 160667-160696 8 0.733
CP028724_1 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178361-178390 30 MN693460 Marine virus AFVG_25M501, complete genome 9259-9288 9 0.7
CP028724_1 1.13|178427|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178427-178456 30 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 583967-583996 9 0.7
CP028724_1 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT 178493-178522 30 NZ_CP026601 Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence 28795-28824 9 0.7
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MH617123 Microviridae sp. isolate ctcd70, complete genome 2872-2901 9 0.7
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 MH937461 Streptococcus phage CHPC642, complete genome 20575-20604 9 0.7
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MK448817 Streptococcus phage Javan59, complete genome 11424-11453 9 0.7
CP028724_5 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840368-1840397 30 MK449004 Streptococcus phage Javan68, complete genome 7500-7529 9 0.7
CP028724_5 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840434-1840463 30 AP014123 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C41-MedDCM-OCT-S29-C50, *** SEQUENCING IN PROGRESS *** 32347-32376 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_KY463452 Escherichia coli strain WCHEC050622 plasmid pMCR_WCHEC1622, complete sequence 22118-22147 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_KP324830 Escherichia coli isolate FP671 plasmid pHNFP671, complete sequence 40200-40229 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP035638 Enterobacter cloacae strain EN3600 plasmid unnamed6, complete sequence 49341-49370 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 MN542377 Klebsiella pneumoniae subsp. pneumoniae strain 494 plasmid pKPC2_sg1, complete sequence 66385-66414 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 MN542378 Klebsiella pneumoniae subsp. pneumoniae strain 607 plasmid pKPC2_sg2, complete sequence 66385-66414 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 LC549805 Escherichia coli VNCEc117 plasmid pVNCEc117 DNA, complete sequence 44992-45021 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP033354 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-2, complete sequence 3011-3040 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP032987 Escherichia coli strain BE2-5 plasmid pMCR_BE2-5, complete sequence 41525-41554 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP025711 Escherichia coli strain YDC107 plasmid pYDC107_41, complete sequence 2179-2208 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP035195 Klebsiella pneumoniae strain LH102-A plasmid pLH102-A, complete sequence 20709-20738 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP045957 Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010527 plasmid pAUSMDU00010527, complete sequence 2179-2208 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MF978389 Escherichia coli strain GDT6F36 plasmid pHNGDF36-1, complete sequence 8704-8733 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MF990207 Escherichia coli strain GDP6F1 plasmid pHNGDF1-1, complete sequence 3788-3817 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MF678351 Escherichia coli strain WCHEC025943 plasmid pMCR3_WCHEC1943, complete sequence 31703-31732 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MF136778 Escherichia coli strain HKSHmcr1_P2_EC plasmid pHKSHmcr1_P2_p1, complete sequence 16403-16432 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_KX580713 Escherichia coli strain ZJ623 plasmid unnamed, complete sequence 5629-5658 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_KY352406 Salmonella enterica subsp. enterica serovar Typhimurium strain YL14P053 plasmid pMCR16_P053, complete sequence 31390-31419 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NC_022650 Escherichia coli JJ1886 plasmid pJJ1886_4, complete sequence 17317-17346 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_KX377410 Klebsiella pneumoniae strain WCHKP1511 plasmid pMCR_1511, complete sequence 35827-35856 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 67651-67680 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP042602 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-3_MCR3, complete sequence 3548-3577 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP030221 Salmonella enterica strain SA20021456 plasmid pSA20021456.2, complete sequence 16247-16276 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP024128 Escherichia coli strain 14EC001 plasmid p14EC001a, complete sequence 45705-45734 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP044383 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-3_MCR3, complete sequence 47828-47857 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP051225 Escherichia coli strain SCZE5 plasmid pSCZE3 4106-4135 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NC_023907 Escherichia coli strain HS102707 plasmid pHS102707, complete sequence 7091-7120 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_AP021897 Escherichia coli strain 2018-02-2CC plasmid p2018_02_02CC, complete sequence 19697-19726 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MH043623 Escherichia coli strain GDZJ002 plasmid pGDZJ002-1, complete sequence 29280-29309 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MH043626 Escherichia coli strain GDZJ004 plasmid pGDZJ004, complete sequence 29086-29115 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MG552133 Escherichia coli strain ECSC102 plasmid pECSC102, complete sequence 27121-27150 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MF489760 Escherichia coli strain WCHEC-LL123 plasmid pMCR3_WCHEC-LL123, complete sequence 29088-29117 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_MH043625 Escherichia coli strain GDZJ003 plasmid pGDZJ003-1-MCR-3, complete sequence 29097-29126 9 0.7
CP028724_5 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR 1840566-1840595 30 NZ_CP027203 Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence 16830-16859 9 0.7
CP028724_5 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT 1840104-1840133 30 CP043941 Acinetobacter lwoffii strain ZS207 plasmid pZS-1, complete sequence 15493-15522 10 0.667
CP028724_5 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT 1840170-1840199 30 MN693468 Marine virus AFVG_25M247, complete genome 2602-2631 10 0.667

1. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY303907 (Enterococcus phage EF-P29, complete genome) position: , mismatch: 0, identity: 1.0

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattataaaacgcataaagagttcaa	Protospacer
******************************

2. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY472224 (Enterococcus phage EF-P10, complete genome) position: , mismatch: 0, identity: 1.0

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattataaaacgcataaagagttcaa	Protospacer
******************************

3. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_041959 (Enterococcus phage IME-EF1, complete genome) position: , mismatch: 0, identity: 1.0

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattataaaacgcataaagagttcaa	Protospacer
******************************

4. spacer 1.7|178033|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 0, identity: 1.0

aactgattgataatagttcaccattcatca	CRISPR spacer
aactgattgataatagttcaccattcatca	Protospacer
******************************

5. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 0, identity: 1.0

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcaggttttaagtctttaaact	Protospacer
*****************************

6. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 0, identity: 1.0

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcaggttttaagtctttaaact	Protospacer
*****************************

7. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 0, identity: 1.0

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcaggttttaagtctttaaact	Protospacer
*****************************

8. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

9. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

10. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

11. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJY010000002 (Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

12. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

13. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

14. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

15. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to LR031359 (Enterococcus phage 156, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

16. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KJ801817 (Enterococcus phage ECP3, complete genome) position: , mismatch: 0, identity: 1.0

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagtt	Protospacer
******************************

17. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP022485 (Enterococcus faecalis ARO1/DG plasmid pARO1.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtttttagtagctctatattcttctaga	CRISPR spacer
ttgtttttagtagctctatattcttctaga	Protospacer
******************************

18. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NZ_AP018540 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtttttagtagctctatattcttctaga	CRISPR spacer
ttgtttttagtagctctatattcttctaga	Protospacer
******************************

19. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP030044 (Enterococcus faecalis strain C25 plasmid pC25-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtttttagtagctctatattcttctaga	CRISPR spacer
ttgtttttagtagctctatattcttctaga	Protospacer
******************************

20. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to LC547238 (Entercoccus phage phiM1EF2 DNA, nearly complete genome) position: , mismatch: 0, identity: 1.0

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagtttgaccaagctttat	Protospacer
******************************

21. spacer 5.5|1840236|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK721189 (Enterococcus phage vB_EfaS_Ef2.2, complete genome) position: , mismatch: 0, identity: 1.0

gtttagcaagtcactttttagcagtgggaa	CRISPR spacer
gtttagcaagtcactttttagcagtgggaa	Protospacer
******************************

22. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to KY303907 (Enterococcus phage EF-P29, complete genome) position: , mismatch: 0, identity: 1.0

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttt	Protospacer
******************************

23. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to KY472224 (Enterococcus phage EF-P10, complete genome) position: , mismatch: 0, identity: 1.0

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttt	Protospacer
******************************

24. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to NC_029016 (Enterococcus phage vB_EfaS_IME198, complete genome) position: , mismatch: 0, identity: 1.0

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttt	Protospacer
******************************

25. spacer 5.11|1840632|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to GQ452243 (Enterococcus phage phiEf11, complete genome) position: , mismatch: 0, identity: 1.0

gcgagaaaaaacgtatggtggaaattgttg	CRISPR spacer
gcgagaaaaaacgtatggtggaaattgttg	Protospacer
******************************

26. spacer 5.11|1840632|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 0, identity: 1.0

gcgagaaaaaacgtatggtggaaattgttg	CRISPR spacer
gcgagaaaaaacgtatggtggaaattgttg	Protospacer
******************************

27. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to GQ478085 (Enterococcus phage phiFL2B, complete genome) position: , mismatch: 0, identity: 1.0

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacattacacaacgctttc	Protospacer
******************************

28. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_013643 (Enterococcus phage phiFL2A, complete genome) position: , mismatch: 0, identity: 1.0

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacattacacaacgctttc	Protospacer
******************************

29. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 0, identity: 1.0

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcacatcaagtttc	Protospacer
******************************

30. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MH791415 (UNVERIFIED: Enterococcus phage EfsWh-1, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
caagcattataaaacgcataaagagttcaa	Protospacer
.*****************************

31. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MH618488 (Enterococcus phage vB_EfaS_HEf13, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
caagcattataaaacgcataaagagttcaa	Protospacer
.*****************************

32. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_018086 (Enterococcus phage BC-611, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
caagcattataaaacgcataaagagttcaa	Protospacer
.*****************************

33. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_041960 (Enterococcus phage SAP6, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
caagcattataaaacgcataaagagttcaa	Protospacer
.*****************************

34. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB712291 (Enterococcus phage BC-611 DNA, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
caagcattataaaacgcataaagagttcaa	Protospacer
.*****************************

35. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN871443 (UNVERIFIED: Enterococcus phage EfsWh_1, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
caagcattataaaacgcataaagagttcaa	Protospacer
.*****************************

36. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK570225 (Enterococcus phage vB_EfaS_PHB08, complete genome) position: , mismatch: 1, identity: 0.967

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattacaaaacgcataaagagttcaa	Protospacer
*********.********************

37. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KJ801817 (Enterococcus phage ECP3, complete genome) position: , mismatch: 1, identity: 0.966

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcgggttttaagtctttaaact	Protospacer
*********.*******************

38. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 1, identity: 0.966

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcgggttttaagtctttaaact	Protospacer
*********.*******************

39. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 1, identity: 0.966

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcgggttttaagtctttaaact	Protospacer
*********.*******************

40. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 1, identity: 0.967

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagat	Protospacer
**************************** *

41. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 1, identity: 0.967

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagat	Protospacer
**************************** *

42. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 1, identity: 0.967

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagat	Protospacer
**************************** *

43. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK721192 (Enterococcus phage vB_EfaM_Ef2.3, complete genome) position: , mismatch: 1, identity: 0.967

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttttttgtcaatagat	Protospacer
**************************** *

44. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NC_004670 (Enterococcus faecalis V583 plasmid pTEF3, complete sequence) position: , mismatch: 1, identity: 0.967

ttgtttttagtagctctatattcttctaga	CRISPR spacer
ttatttttagtagctctatattcttctaga	Protospacer
**.***************************

45. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 1, identity: 0.967

ttgtttttagtagctctatattcttctaga	CRISPR spacer
ttatttttagtagctctatattcttctaga	Protospacer
**.***************************

46. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MK721189 (Enterococcus phage vB_EfaS_Ef2.2, complete genome) position: , mismatch: 1, identity: 0.967

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagtttgaccaatctttat	Protospacer
*********************** ******

47. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to HE962497 (Streptococcus phage SP-QS1 complete genome) position: , mismatch: 1, identity: 0.967

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagtttgaccaatctttat	Protospacer
*********************** ******

48. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MN103542 (Enterococcus phage vB_EfaS_EF1c55, complete genome) position: , mismatch: 1, identity: 0.967

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagtttgaccaatctttat	Protospacer
*********************** ******

49. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to NC_041959 (Enterococcus phage IME-EF1, complete genome) position: , mismatch: 1, identity: 0.967

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagtttgaccaaactttat	Protospacer
***********************.******

50. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to MH618488 (Enterococcus phage vB_EfaS_HEf13, complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

51. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to LC547238 (Entercoccus phage phiM1EF2 DNA, nearly complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

52. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to NC_041959 (Enterococcus phage IME-EF1, complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

53. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to MH791415 (UNVERIFIED: Enterococcus phage EfsWh-1, complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

54. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to HE962497 (Streptococcus phage SP-QS1 complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

55. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to KJ127303 (Enterococcus phage VD13, complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

56. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to MN871443 (UNVERIFIED: Enterococcus phage EfsWh_1, complete genome) position: , mismatch: 1, identity: 0.967

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagcagacttgctataaagctttg	Protospacer
***************************** 

57. spacer 5.11|1840632|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KJ608188 (Enterococcus phage EFC-1, complete genome) position: , mismatch: 1, identity: 0.967

gcgagaaaaaacgtatggtggaaattgttg	CRISPR spacer
gcgagaaaaaacgtatggtggaaattgtag	Protospacer
**************************** *

58. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to GQ478087 (Enterococcus phage phiFL3B, complete genome) position: , mismatch: 1, identity: 0.967

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacattacacaacactttc	Protospacer
************************.*****

59. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_013648 (Enterococcus phage phiFL3A, complete genome) position: , mismatch: 1, identity: 0.967

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacattacacaacactttc	Protospacer
************************.*****

60. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to GQ452243 (Enterococcus phage phiEf11, complete genome) position: , mismatch: 1, identity: 0.967

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacattacacaacactttc	Protospacer
************************.*****

61. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 1, identity: 0.967

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacattacacaacactttc	Protospacer
************************.*****

62. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK721187 (Enterococcus phage vB_EfaS_Ef6.1, complete genome) position: , mismatch: 1, identity: 0.967

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcatatcaagtttc	Protospacer
*******************.**********

63. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK721194 (Enterococcus phage vB_EfaS_Ef7.1, complete genome) position: , mismatch: 2, identity: 0.933

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcactataaaactcataaagagttcaa	Protospacer
******.******** **************

64. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_029016 (Enterococcus phage vB_EfaS_IME198, complete genome) position: , mismatch: 2, identity: 0.933

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattacaaaacgcctaaagagttcaa	Protospacer
*********.******* ************

65. spacer 1.7|178033|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KJ608188 (Enterococcus phage EFC-1, complete genome) position: , mismatch: 2, identity: 0.933

aactgattgataatagttcaccattcatca	CRISPR spacer
aactgattgataatagttcgccgttcatca	Protospacer
*******************.**.*******

66. spacer 1.7|178033|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ452243 (Enterococcus phage phiEf11, complete genome) position: , mismatch: 2, identity: 0.933

aactgattgataatagttcaccattcatca	CRISPR spacer
agctgattgataatagttcgccattcatca	Protospacer
*.*****************.**********

67. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_029026 (Enterococcus phage EFLK1, complete genome) position: , mismatch: 2, identity: 0.931

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttataatgcaggtttcaagtctttaaact	Protospacer
***.***********.*************

68. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 2, identity: 0.931

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttataatgcaggtttcaagtctttaaact	Protospacer
***.***********.*************

69. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 2, identity: 0.931

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttataatgcaggtttcaagtctttaaact	Protospacer
***.***********.*************

70. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

71. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

72. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

73. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

74. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

75. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

76. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

77. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJY010000002 (Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacagtatagtttgttatttgtcaatagtt	Protospacer
**** *********** *************

78. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJY010000002 (Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

79. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJY010000002 (Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagtt	Protospacer
********. ********************

80. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

81. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

82. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

83. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to LR031359 (Enterococcus phage 156, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacagtatagtttgttatttgtcaatagtt	Protospacer
**** *********** *************

84. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to LR031359 (Enterococcus phage 156, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

85. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to LR031359 (Enterococcus phage 156, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagtt	Protospacer
********. ********************

86. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KJ801817 (Enterococcus phage ECP3, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

87. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018715 (Enterococcus phage phiM1EF22 DNA, complete sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

88. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018715 (Enterococcus phage phiM1EF22 DNA, complete sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

89. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018715 (Enterococcus phage phiM1EF22 DNA, complete sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tactctatattttgttttttgtcaatagtt	Protospacer
*** ***** ********************

90. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018715 (Enterococcus phage phiM1EF22 DNA, complete sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagtt	Protospacer
********. ********************

91. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJZ010000002 (Enterococcus phage vB_EfaH_149 genome assembly, contig: phage149-genome, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacagtatagtttgttatttgtcaatagtt	Protospacer
**** *********** *************

92. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJZ010000002 (Enterococcus phage vB_EfaH_149 genome assembly, contig: phage149-genome, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagtt	Protospacer
********. ********************

93. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018714 (Enterococcus phage phiEF17H DNA, complete sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagtttgttatttgtcaatagat	Protospacer
**************** *********** *

94. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018714 (Enterococcus phage phiEF17H DNA, complete sequence) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tactctatattttgttttttgtcaatagtt	Protospacer
*** ***** ********************

95. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK693030 (Enterococcus phage vB_EfaM_Ef2.1, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

96. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_029026 (Enterococcus phage EFLK1, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

97. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_029026 (Enterococcus phage EFLK1, complete genome) position: , mismatch: 2, identity: 0.933

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatcttttgttttttgtcaatagtt	Protospacer
********  ********************

98. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP015884 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence) position: , mismatch: 2, identity: 0.933

ttgtttttagtagctctatattcttctaga	CRISPR spacer
ttgtttttagtagctttataatcttctaga	Protospacer
***************.**** *********

99. spacer 2.4|399478|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to LC547238 (Entercoccus phage phiM1EF2 DNA, nearly complete genome) position: , mismatch: 2, identity: 0.933

accctccatggtacacttccagacggtgtc	CRISPR spacer
acccaccatggtacacttccagacgatgtc	Protospacer
**** ********************.****

100. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MH791415 (UNVERIFIED: Enterococcus phage EfsWh-1, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagcgtttgaccaatctttat	Protospacer
************ ********** ******

101. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to NC_018086 (Enterococcus phage BC-611, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagttcgaccaatctttat	Protospacer
****************.****** ******

102. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to AB712291 (Enterococcus phage BC-611 DNA, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagttcgaccaatctttat	Protospacer
****************.****** ******

103. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MN871443 (UNVERIFIED: Enterococcus phage EfsWh_1, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagcgtttgaccaatctttat	Protospacer
************ ********** ******

104. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to NC_029016 (Enterococcus phage vB_EfaS_IME198, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagactttgaccaaactttat	Protospacer
************* *********.******

105. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MK800154 (Enterococcus phage Entf1, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagagtttgacctatctttat	Protospacer
********************* * ******

106. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to KY303907 (Enterococcus phage EF-P29, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagactttgaccaaactttat	Protospacer
************* *********.******

107. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to NC_041960 (Enterococcus phage SAP6, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccaaagtttgaccaatctttat	Protospacer
***********.*********** ******

108. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MK570225 (Enterococcus phage vB_EfaS_PHB08, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagactttgaccaaactttat	Protospacer
************* *********.******

109. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to KY472224 (Enterococcus phage EF-P10, complete genome) position: , mismatch: 2, identity: 0.933

acacttttccagagtttgaccaagctttat	CRISPR spacer
acacttttccagactttgaccaaactttat	Protospacer
************* *********.******

110. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to MK800154 (Enterococcus phage Entf1, complete genome) position: , mismatch: 2, identity: 0.933

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagctgacttgctataaagctttg	Protospacer
********** ****************** 

111. spacer 5.9|1840500|30|CP028724|CRISPRCasFinder,CRT matches to MN103542 (Enterococcus phage vB_EfaS_EF1c55, complete genome) position: , mismatch: 2, identity: 0.933

cacttttagcagacttgctataaagctttt	CRISPR spacer
cacttttagctgacttgctataaagctttg	Protospacer
********** ****************** 

112. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to GQ478082 (Enterococcus phage phiFL1B, complete genome) position: , mismatch: 2, identity: 0.933

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatagacacattacacaacactttc	Protospacer
********.***************.*****

113. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to GQ478083 (Enterococcus phage phiFL1C, complete genome) position: , mismatch: 2, identity: 0.933

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatagacacattacacaacactttc	Protospacer
********.***************.*****

114. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_013646 (Enterococcus phage phiFL1A, complete genome) position: , mismatch: 2, identity: 0.933

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatagacacattacacaacactttc	Protospacer
********.***************.*****

115. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT119359 (Enterococcus phage heks, complete genome) position: , mismatch: 2, identity: 0.933

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcatatcaaatttc	Protospacer
*******************.*****.****

116. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK125140 (Enterococcus phage Nonaheksakonda, complete genome) position: , mismatch: 2, identity: 0.933

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcatatcaaatttc	Protospacer
*******************.*****.****

117. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_042023 (Enterococcus phage phiSHEF5, complete genome) position: , mismatch: 2, identity: 0.933

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggttaaaggtgtagcacatcaaatttc	Protospacer
*****.*******************.****

118. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK693030 (Enterococcus phage vB_EfaM_Ef2.1, complete genome) position: , mismatch: 3, identity: 0.897

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcgggttttaagtctttatatt	Protospacer
*********.*************** *.*

119. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK693030 (Enterococcus phage vB_EfaM_Ef2.1, complete genome) position: , mismatch: 3, identity: 0.897

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttacaatgcgggttttaagtctttatatt	Protospacer
*********.*************** *.*

120. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 3, identity: 0.9

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagat	Protospacer
********. ****************** *

121. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 3, identity: 0.9

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagat	Protospacer
********. ****************** *

122. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 3, identity: 0.9

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagat	Protospacer
********. ****************** *

123. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN854830 (Enterococcus phage PBEF129, complete genome) position: , mismatch: 3, identity: 0.9

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagat	Protospacer
********. ****************** *

124. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 3, identity: 0.9

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgttttgttttttgtcaatagat	Protospacer
********. ****************** *

125. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT080590 (UNVERIFIED: Staphylococcus phage vB_SauM_EW27, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

126. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KY779848 (Staphylococcus phage qdsa001, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

127. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KX532239 (Staphylococcus phage StAP1, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

128. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to LC492751 (Staphylococcus phage KSAP7 genomic DNA, compelete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

129. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to JX194239 (Staphylococcus phage SA11, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

130. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to LC492752 (Staphylococcus phage KSAP11 genomic DNA, compelete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

131. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT080584 (UNVERIFIED: Staphylococcus phage vB_SauM_EW15, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

132. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT080587 (UNVERIFIED: Staphylococcus phage vB_SauM_EW20, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

133. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to AP019522 (Staphylococcal phage MR003 DNA, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

134. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_022090 (Staphylococcus phage vB_SauM_Remus, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

135. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KP881332 (Staphylococcus phage Stau2, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

136. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT080588 (UNVERIFIED: Staphylococcus phage vB_SauM_EW22, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

137. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT080595 (UNVERIFIED: Staphylococcus phage vB_SauM_EW41, partial genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

138. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_020877 (Staphylococcus phage vB_SauM_Romulus, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
aaaaaaaagactaggaattatcctagtcta	Protospacer
.******************* ******** 

139. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KX171213 (Staphylococcus phage vB_SscM-2, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
taaaaaaagactagaaattaatctagtctt	Protospacer
 *************.******.********

140. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_047767 (Staphylococcus phage vB_SscM-1, complete genome) position: , mismatch: 3, identity: 0.9

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
taaaaaaagactagaaattaatctagtctt	Protospacer
 *************.******.********

141. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to HE962497 (Streptococcus phage SP-QS1 complete genome) position: , mismatch: 4, identity: 0.867

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattataaaaagcataaggagttctc	Protospacer
************** ******.******  

142. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KJ127303 (Enterococcus phage VD13, complete genome) position: , mismatch: 4, identity: 0.867

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattataaaaagcataaggagttctc	Protospacer
************** ******.******  

143. spacer 1.1|177637|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN103542 (Enterococcus phage vB_EfaS_EF1c55, complete genome) position: , mismatch: 4, identity: 0.867

taagcattataaaacgcataaagagttcaa	CRISPR spacer
taagcattataaaaagcataaggagttctc	Protospacer
************** ******.******  

144. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268686 (Enterococcus phage vB_EfaH_EF1TV, complete genome) position: , mismatch: 4, identity: 0.867

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgctttgttttttgtcaataact	Protospacer
********. *****************..*

145. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KJ801817 (Enterococcus phage ECP3, complete genome) position: , mismatch: 4, identity: 0.867

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgctttgttttttgtcaataact	Protospacer
********. *****************..*

146. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK721192 (Enterococcus phage vB_EfaM_Ef2.3, complete genome) position: , mismatch: 4, identity: 0.867

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacaatatagtttgttatttgtcaatagaa	Protospacer
**** *********** ***********  

147. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK721192 (Enterococcus phage vB_EfaM_Ef2.3, complete genome) position: , mismatch: 4, identity: 0.867

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacaatatagtttgttatttgtcaatagaa	Protospacer
**** *********** ***********  

148. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_029026 (Enterococcus phage EFLK1, complete genome) position: , mismatch: 4, identity: 0.867

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacaatatagtttgttatttgtcaatagaa	Protospacer
**** *********** ***********  

149. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_029026 (Enterococcus phage EFLK1, complete genome) position: , mismatch: 4, identity: 0.867

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatgctttgttttttgtcaataact	Protospacer
********. *****************..*

150. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KX171213 (Staphylococcus phage vB_SscM-2, complete genome) position: , mismatch: 4, identity: 0.867

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
ataaaaaagactagaaattaatctagtctt	Protospacer
. ************.******.********

151. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_047767 (Staphylococcus phage vB_SscM-1, complete genome) position: , mismatch: 4, identity: 0.867

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
ataaaaaagactagaaattaatctagtctt	Protospacer
. ************.******.********

152. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013842 (Clostridium botulinum strain AM1051 plasmid pRSJ13_1, complete sequence) position: , mismatch: 5, identity: 0.833

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
gcctactaaatcacctgttttaataggagt	Protospacer
.* * .********************* **

153. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013687 (Clostridium botulinum strain F1425 plasmid pRSJ9_1, complete sequence) position: , mismatch: 5, identity: 0.833

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
gcctactaaatcacctgttttaataggagt	Protospacer
.* * .********************* **

154. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014220 (Clostridium botulinum strain B515 plasmid pRSJ21_1, complete sequence) position: , mismatch: 5, identity: 0.833

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
gcctactaaatcacctgttttaataggagt	Protospacer
.* * .********************* **

155. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028860 (Clostridium botulinum strain CFSAN064329 plasmid pCFSAN064329, complete sequence) position: , mismatch: 5, identity: 0.833

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
gcctactaaatcacctgttttaataggagt	Protospacer
.* * .********************* **

156. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013851 (Clostridium botulinum strain B305 plasmid pRSJ6_1, complete sequence) position: , mismatch: 5, identity: 0.833

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
gcctactaaatcacctgttttaataggagt	Protospacer
.* * .********************* **

157. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009700 (Clostridium botulinum F str. Langeland plasmid pCLI, complete sequence) position: , mismatch: 5, identity: 0.833

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
acctactaaatcccctgttttaataggagt	Protospacer
** * .****** ************** **

158. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tagtttatcttttgttttttgtcaatagtt	Protospacer
**  .***  ********************

159. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tagtttatcttttgttttttgtcaatagtt	Protospacer
**  .***  ********************

160. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tagtttatcttttgttttttgtcaatagtt	Protospacer
**  .***  ********************

161. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to AP018714 (Enterococcus phage phiEF17H DNA, complete sequence) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tcctccttaatttgttttttgtcaatagtt	Protospacer
* * *. **.********************

162. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_030946 (Streptococcus phage phiARI0923, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

163. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MT900487 (Streptococcus phage 23TH, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

164. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK448914 (Streptococcus phage Javan348, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

165. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065495 (Streptococcus phage IPP58, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

166. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065484 (Streptococcus phage IPP44, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

167. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065463 (Streptococcus phage IPP22, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

168. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065494 (Streptococcus phage IPP57, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

169. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065459 (Streptococcus phage IPP18, complete genome) position: , mismatch: 5, identity: 0.833

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaagaaat	Protospacer
** ******* ************** *. *

170. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP012912 (Streptococcus suis strain NSUI060 plasmid pNSUI060a, complete sequence) position: , mismatch: 5, identity: 0.833

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaaaacatgaaaattaaactatttt	Protospacer
********** ************* *. * 

171. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 5, identity: 0.833

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggagaaaaaaaatgaaaattaaaaaatttg	Protospacer
****.****************** .*. **

172. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 5, identity: 0.833

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggtaaaaaatgaaaattaatttaaatg	Protospacer
***** **************** . * ***

173. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_027352 (Bacillus phage JBP901, complete genome) position: , mismatch: 5, identity: 0.833

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
ataaaaaagactaggttttaacctagtctc	Protospacer
. *************  ************.

174. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 5, identity: 0.833

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
cacaaaaagacaaggaattaaccttgtctc	Protospacer
 * ******** ************ ****.

175. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019826 (Leptotrichia hofstadii strain JCM16775 plasmid pJCM16775-3, complete sequence) position: , mismatch: 5, identity: 0.833

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
gaaagaatttttaaaagatgtaccagaaaa	Protospacer
*   *** ** *******************

176. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985310 (Escherichia coli strain CIP106223 plasmid RCS93_pII, complete sequence) position: , mismatch: 5, identity: 0.833

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
ggatgaaagtgtaaaagatgtatcagaaac	Protospacer
*  ***** *************.****** 

177. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MH375074 (Enterococcus phage LY0323, complete genome) position: , mismatch: 5, identity: 0.833

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcacataaaatgga	Protospacer
********************** **.*   

178. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 5, identity: 0.833

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcacataaaatgga	Protospacer
********************** **.*   

179. spacer 5.18|1841094|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KX284704 (Enterococcus phage SANTOR1, complete genome) position: , mismatch: 5, identity: 0.833

tggggctaaaggtgtagcacatcaagtttc	CRISPR spacer
tggggctaaaggtgtagcacataaaatgga	Protospacer
********************** **.*   

180. spacer 1.5|177901|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN855861 (Bacteriophage sp. isolate 284, complete genome) position: , mismatch: 6, identity: 0.8

atccagtattcattcgttatgcacctccta	CRISPR spacer
atacagtattcattcgttatggtactgtta	Protospacer
** ******************   ** .**

181. spacer 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039926 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129c, complete sequence) position: , mismatch: 6, identity: 0.8

ccaagttagagatggcgaaggcggccgtca	CRISPR spacer
tcaatagagagatggcgaaggtagccgtca	Protospacer
.***   **************..*******

182. spacer 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033033 (Agrobacterium tumefaciens strain 12D1 plasmid pTi12D1, complete sequence) position: , mismatch: 6, identity: 0.8

ccaagttagagatggcgaaggcggccgtca	CRISPR spacer
tcaatagagagatggcgaaggtagccgtca	Protospacer
.***   **************..*******

183. spacer 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK318973 (Agrobacterium rhizogenes strain Colt5.8 plasmid pOC-Colt5.8, complete sequence) position: , mismatch: 6, identity: 0.8

ccaagttagagatggcgaaggcggccgtca	CRISPR spacer
tcaatagagagatggcgaaggtagccgtca	Protospacer
.***   **************..*******

184. spacer 1.8|178099|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_015427 (Clostridium botulinum BKT015925 plasmid p4BKT015925, complete sequence) position: , mismatch: 6, identity: 0.793

ttacaatgcaggttttaagtctttaaact	CRISPR spacer
ttttaatccaggttttaattctttaaatc	Protospacer
** .*** ********** ********..

185. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065458 (Streptococcus phage IPP17, complete genome) position: , mismatch: 6, identity: 0.8

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaaggaat	Protospacer
** ******* ************** .. *

186. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065462 (Streptococcus phage IPP21, complete genome) position: , mismatch: 6, identity: 0.8

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaaggaat	Protospacer
** ******* ************** .. *

187. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KY065470 (Streptococcus phage IPP29, complete genome) position: , mismatch: 6, identity: 0.8

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
taaactatagattgttttttgtcaaggaat	Protospacer
** ******* ************** .. *

188. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MH629685 (Synechococcus virus S-PRM1, complete genome) position: , mismatch: 6, identity: 0.8

aactagaagacatgtatttaaaagtatggt-	CRISPR spacer
aacgagaagacatgtatttacaa-tacaatc	Protospacer
*** **************** ** **...* 

189. spacer 2.1|399280|30|CP028724|CRISPRCasFinder matches to NC_011774 (Bacillus cereus G9842 plasmid pG9842_140, complete sequence) position: , mismatch: 6, identity: 0.8

tcatcatagtatcgtaaaactctttctggt	CRISPR spacer
ccatcatagtaacgtaaaactcgttctaca	Protospacer
.********** ********** ****.  

190. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP053900 (Proteus mirabilis strain YPM35 plasmid pJPM35-2, complete sequence) position: , mismatch: 6, identity: 0.8

ttgtttttagtagctctatattcttctaga	CRISPR spacer
cggttattagtagctttatattcttctggt	Protospacer
. *** *********.***********.* 

191. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP018328 (Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-4, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
cacatgtaatttttgagctaatgcttcttg	Protospacer
..* ***********  ************ 

192. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP018328 (Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-4, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
cacatgtaatttttgagctaatgcttcttg	Protospacer
..* ***********  ************ 

193. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP035017 (Lactobacillus plantarum strain 12_3 plasmid pldE, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
cacatgtaatttttgagctaatgcttcttg	Protospacer
..* ***********  ************ 

194. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_AP018406 (Lactobacillus plantarum strain SN35N plasmid pSN35N-1, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
cacatgtaatttttgagctaatgcttcttg	Protospacer
..* ***********  ************ 

195. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_LT907984 (Lactobacillus sakei subsp. sakei 23K plasmid pJ23A1, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
cacatgtaatttttgagctaatgcttcttg	Protospacer
..* ***********  ************ 

196. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
ctcttgtaatttttgaactaatgcttgatt	Protospacer
. *************  *********  **

197. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP009647 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_4, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
ctcttgtaatttttgaactaatgcttgatt	Protospacer
. *************  *********  **

198. spacer 5.1|1839972|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttgtaatttttgccctaatgcttcttt	CRISPR spacer
ctcttgtaatttttgaactaatgcttgatt	Protospacer
. *************  *********  **

199. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacgacatg-	CRISPR spacer
gcaggtaaaaaatgaaaattaaa-gttattt	Protospacer
* *** ***************** * .**  

200. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaac-gacatg	CRISPR spacer
tgaggtaaataatgaaaattaaactggcgt-	Protospacer
 **** *** ************** *.*.* 

201. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaaacaatgaaatttaaaaaaggtg	Protospacer
********* ******* ***** .* .**

202. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacga-catg	CRISPR spacer
ggaggaaaaaaatgaaattcaaagaagcac-	Protospacer
***************** *.*** .* **. 

203. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaac-gacatg	CRISPR spacer
tgaggtaaataatgaaaattaaactggcgt-	Protospacer
 **** *** ************** *.*.* 

204. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KX160216 (Lactococcus phage 98202, complete genome) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacga-catg	CRISPR spacer
ggaggaagaaaatggaaattaaaaaagcgt-	Protospacer
*******.******.******** .* *.* 

205. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to AY682195 (Lactobacillus plantarum bacteriophage LP65, complete genome) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggatgaataaaatgaaaattaaatatgatg	Protospacer
*** *** ***************..  ***

206. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NC_006565 (Lactobacillus phage LP65, complete genome) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggatgaataaaatgaaaattaaatatgatg	Protospacer
*** *** ***************..  ***

207. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KX160218 (Lactococcus phage 98204, complete genome) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacga-catg	CRISPR spacer
ggaggaagaaaatggaaattaaaaaagcgt-	Protospacer
*******.******.******** .* *.* 

208. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KX160217 (Lactococcus phage 98203, complete genome) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacga-catg	CRISPR spacer
ggaggaagaaaatggaaattaaaaaagcgt-	Protospacer
*******.******.******** .* *.* 

209. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MN855957 (Myoviridae sp. isolate 155, partial genome) position: , mismatch: 6, identity: 0.8

ggaggaaaaaaatgaaaattaaacgacatg-	CRISPR spacer
ggaggaaaaaaatgaaaagt-attgaagtgc	Protospacer
****************** * * .** .** 

210. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026605 (Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
gcatttaagactagcaattaaccttgtctt	Protospacer
* *   ******** ********* *****

211. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT133560 (Pseudomonas phage fnug, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

212. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KU521356 (Pseudomonas phage KTN4, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

213. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MW057919 (Pseudomonas phage vB_PaeM_kmuB, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

214. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MN034767 (Leviviridae sp. isolate H4_Rhizo_Litter_19_scaffold_469 RNA-dependent RNA polymerase (H4RhizoLitter19469_000001), hypothetical protein (H4RhizoLitter19469_000002), hypothetical protein (H4RhizoLitter19469_000003), and hypothetical protein (H4RhizoLitter19469_000004) genes, complete cds) position: , mismatch: 6, identity: 0.8

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
gtttgaaattgtacaatatgtacaatacga	Protospacer
************* ** ****** * * .*

215. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to LC541428 (Staphylococcus phage vB_SauS_JS02 DNA, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
gtttgatattgttaaagatgtacgactaga	Protospacer
****** ***** ********** *  *.*

216. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_004629 (Pseudomonas phage phiKZ, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

217. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MN871480 (UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

218. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to DI373487 (KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

219. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MN871489 (UNVERIFIED: Pseudomonas phage PaZh_1, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

220. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_042081 (Pseudomonas phage SL2, complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

221. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_042060 (Pseudomonas phage PA7, partial genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

222. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to AP019418 (Pseudomonas phage PA02 DNA, nearly complete genome) position: , mismatch: 6, identity: 0.8

gtttgaa---attgtaaaagatgtaccagaaaa	CRISPR spacer
---ggaactcattgtaacagatgtaccagaaga	Protospacer
    ***   ******* *************.*

223. spacer 5.12|1840698|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ776578 (Clostridium botulinum strain CDC3875 plasmid pCDC3875, complete sequence) position: , mismatch: 6, identity: 0.8

--taaagcagcttctaaaacagaaggtgaaat	CRISPR spacer
aatgaagt--tttctaaaacacaaggtgaaat	Protospacer
  *.***.  .********** **********

224. spacer 5.12|1840698|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ776580 (Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence) position: , mismatch: 6, identity: 0.8

--taaagcagcttctaaaacagaaggtgaaat	CRISPR spacer
aatgaagt--tttctaaaacacaaggtgaaat	Protospacer
  *.***.  .********** **********

225. spacer 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to KY290955 (Aeromonas phage 65.2, complete genome) position: , mismatch: 6, identity: 0.8

ttcaagaaagctatggaagttctgaagcaa	CRISPR spacer
tttgtagaagctattgaagttctgaagcaa	Protospacer
**.. ..******* ***************

226. spacer 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_015251 (Aeromonas phage 65, complete genome) position: , mismatch: 6, identity: 0.8

ttcaagaaagctatggaagttctgaagcaa	CRISPR spacer
tttgtagaagctattgaagttctgaagcaa	Protospacer
**.. ..******* ***************

227. spacer 5.19|1841160|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015884 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence) position: , mismatch: 6, identity: 0.8

taaaaacaagacgaaatgaggaaattaaca-	CRISPR spacer
aaaaaacaagacgacatgcggaaa-aaatac	Protospacer
 ************* *** *****  **.* 

228. spacer 5.20|1841226|30|CP028724|CRISPRCasFinder,CRT matches to MK867354 (Synechococcus phage S-SCSM1, complete genome) position: , mismatch: 6, identity: 0.8

caatgtaaatgctcattatgatttacatat	CRISPR spacer
gatggaaaatcctcattatgatttccatat	Protospacer
 *  * **** ************* *****

229. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to CP031730 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
acccgttaaatcaccaattttaataggctc	Protospacer
** . ********** .*********** .

230. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694614 (Marine virus AFVG_250M469, complete genome) position: , mismatch: 7, identity: 0.767

----acgtcttaaatcacctgttttaataggcgt	CRISPR spacer
atcagcgcc----atcacctattttaataggcgt	Protospacer
    .**.*    *******.*************

231. spacer 1.4|177835|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694392 (Marine virus AFVG_250M8, complete genome) position: , mismatch: 7, identity: 0.767

acgtcttaaatcacctgttttaa---taggcgt	CRISPR spacer
ttgtcttaaatcaccttttttaaccttatg---	Protospacer
 .************** ******   ** *   

232. spacer 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

ccaagttagagatggcgaaggcggccgtca	CRISPR spacer
actgggcagcgatggcgacggcggccgtca	Protospacer
 * .* .** ******** ***********

233. spacer 1.6|177967|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

---ccaagttagagatggcgaaggcggccgtca	CRISPR spacer
atgccgcgc---agatggcgaacgcggccgtca	Protospacer
   **. *.   ********** **********

234. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024036 (Bacillus aryabhattai strain K13 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
ttttctatactatgttttttgtcaataagt	Protospacer
* . ***** * ***************. *

235. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to LC557520 (Staphylococcus phage vB_SsapH-Golestan101-M DNA, complete genome) position: , mismatch: 7, identity: 0.767

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
atcatgctagtttatttcttgtcaatagtt	Protospacer
  **.  ******.***.************

236. spacer 1.10|178230|29|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 7, identity: 0.759

aaggaggcactattaaatgactgagaaaa	CRISPR spacer
caggagtcactattaaatgacttggggat	Protospacer
 ***** *************** .*..* 

237. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693240 (Marine virus AFVG_25M497, complete genome) position: , mismatch: 7, identity: 0.767

acatctttacgtgttactgcatcagctgca	CRISPR spacer
gcatctttacgtgttactggatcaagcaaa	Protospacer
.****************** ****. .. *

238. spacer 1.13|178427|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KU645528 (Acidianus tailed spindle virus isolate 1, complete genome) position: , mismatch: 7, identity: 0.767

acacctgaggaaattaacaatagtaaagtg	CRISPR spacer
gctactgaagaaattcacaatagtaaattt	Protospacer
.*  ****.****** *********** * 

239. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KF664572 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

240. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to FJ449748 (Vibrio phage CTX strain E1781 RstR (rstR) gene, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

241. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466609 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

242. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466609 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

243. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466610 (Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

244. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466610 (Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

245. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ499847 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), Ace (ace), ZOT (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds; and unknown gene) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

246. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to DQ012295 (Vibrio phage CTX CtxB (ctxB) gene, partial cds; RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

247. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485644 (Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

248. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485644 (Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

249. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KF664567 (Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

250. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KF664567 (Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

251. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to FJ449743 (Vibrio phage CTX strain MG116926 RstR (rstR) gene, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

252. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466612 (Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

253. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466612 (Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

254. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485649 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

255. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485649 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

256. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485646 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

257. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485646 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

258. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MF155889 (Vibrio virus CTXphi, complete genome) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

259. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to FJ449738 (Vibrio phage CTX strain 07.95vp RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

260. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485648 (Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

261. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485648 (Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

262. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to KT728931 (Vibrio phage pre-CTX, complete genome) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataatacccctatagttgtgctt	Protospacer
. ******* *.***************.. 

263. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485645 (Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

264. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485645 (Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

265. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

266. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485647 (Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

267. spacer 1.15|178559|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to GQ485647 (Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 7, identity: 0.767

gccatacattacacccctatagttgtgtcg	CRISPR spacer
aacatacataccacccctatagttgtgctt	Protospacer
. *******  ****************.. 

268. spacer 2.1|399280|30|CP028724|CRISPRCasFinder matches to AP013520 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S39-C26) position: , mismatch: 7, identity: 0.767

tcatcatagtatcgtaaaactctttctggt	CRISPR spacer
ctaaaatagtatcgtaaaactttttctttt	Protospacer
..*  ****************.*****  *

269. spacer 2.6|399610|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 7, identity: 0.767

ctcagtcgcttcattctttgtagctctact	CRISPR spacer
gtcagtcgcttcatgctttgtacgcctcca	Protospacer
 ************* *******  .** * 

270. spacer 2.7|399676|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to CP016195 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-1, complete sequence) position: , mismatch: 7, identity: 0.767

tgttagatgatggcattattacagaagaag	CRISPR spacer
aaattaatgatggcatgtttacagaagaag	Protospacer
 . * .**********  ************

271. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MN855807 (Siphoviridae sp. isolate 122, partial genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

272. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KY554766 (Lactococcus phage AM6, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

273. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KY554763 (Lactococcus phage LW32, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

274. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaaacaatgaaatttaaaaaaggta	Protospacer
********* ******* ***** .* .*.

275. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NC_049806 (Lactococcus phage LW31, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

276. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MK448986 (Streptococcus phage Javan570, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaataaaatggaaattaaagtaaaat	Protospacer
******* ******.********  * *  

277. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to L13696 (Bacteriophage L2 (from Mycoplasma), complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
gatttaaaaaaatgaaaatcaaacgaagtg	Protospacer
*.   **************.****** .**

278. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KY554765 (Lactococcus phage LW4, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

279. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MN528768 (Lactococcus phage P596, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactac	Protospacer
********.******** ***** .**   

280. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KY554764 (Lactococcus phage LW33, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

281. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NC_049805 (Lactococcus phage phiQ1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

282. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to KY554767 (Lactococcus phage AM7, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaagaaatgaaatttaaagaactat	Protospacer
********.******** ***** .**   

283. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NC_001447 (Acholeplasma phage L2, complete genome) position: , mismatch: 7, identity: 0.767

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
gatttaaaaaaatgaaaatcaaacgaagtg	Protospacer
*.   **************.****** .**

284. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_019538 (Aeromonas phage CC2, complete genome) position: , mismatch: 7, identity: 0.767

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
attcaaatttgtaaaagatgtatcagaagg	Protospacer
.**..** **************.*****..

285. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 7, identity: 0.767

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
gaatcgaattgtaaaaaatgtaccagatga	Protospacer
*  * .**********.********** .*

286. spacer 5.12|1840698|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014218 (Clostridium botulinum strain B515 plasmid pRSJ21_3, complete sequence) position: , mismatch: 7, identity: 0.767

taaagcagcttctaaaacagaaggtgaaat	CRISPR spacer
taaagcagcttataaaagagaagtatcaag	Protospacer
*********** ***** *****    ** 

287. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MH179477 (Aeromonas phage 60AhydR15PP, complete genome) position: , mismatch: 7, identity: 0.767

aaagaaatggacacattacacaacgctttc	CRISPR spacer
tatgaaatggacaaatttcacaacgctcca	Protospacer
 * ********** *** *********.. 

288. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 7, identity: 0.767

aaagaaatggacacattacacaacgctttc	CRISPR spacer
tatgaaatggacaaatttcacaacgctcca	Protospacer
 * ********** *** *********.. 

289. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_020879 (Aeromonas phage Aes012, complete genome) position: , mismatch: 7, identity: 0.767

aaagaaatggacacattacacaacgctttc	CRISPR spacer
tatgaaatggacaaatttcacaacgctcca	Protospacer
 * ********** *** *********.. 

290. spacer 5.14|1840830|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025802 (Yersinia ruckeri strain SC09 plasmid pLT, complete sequence) position: , mismatch: 7, identity: 0.767

aaagaaatggacacattacacaacgctttc	CRISPR spacer
aaagaaatggacacgttacgcaaagagcta	Protospacer
**************.****.*** *  .* 

291. spacer 5.15|1840896|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016597 (Bacillus cereus strain K8 plasmid pBCK802, complete sequence) position: , mismatch: 7, identity: 0.767

gtgcaacaaaagaatattgttgtcaatggt	CRISPR spacer
tttttataaaaggatattgttgtcaattgt	Protospacer
 * . *.*****.************** **

292. spacer 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MT490303 (Prochlorococcus phage P-HS2, complete genome) position: , mismatch: 7, identity: 0.767

ttcaagaaagctatggaagttctgaagcaa	CRISPR spacer
ctaaagaaaggtatggaagttcttaacaat	Protospacer
.* ******* ************ **  * 

293. spacer 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MN694626 (Marine virus AFVG_250M967, complete genome) position: , mismatch: 7, identity: 0.767

ttcaagaaagctatggaagttctgaagcaa	CRISPR spacer
ctcaagaaagctatggaaggtatgcctcat	Protospacer
.****************** * **   ** 

294. spacer 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_020847 (Cyanophage MED4-184 genomic sequence) position: , mismatch: 7, identity: 0.767

ttcaagaaagctatggaagttctgaagcaa	CRISPR spacer
ctaaagaaaggtatggaagttcttaacaat	Protospacer
.* ******* ************ **  * 

295. spacer 5.17|1841028|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to JF974321 (Cyanophage MED4-117 genomic sequence) position: , mismatch: 7, identity: 0.767

ttcaagaaagctatggaagttctgaagcaa	CRISPR spacer
ctaaagaaaggtatggaagttcttaataat	Protospacer
.* ******* ************ **  * 

296. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032859 (Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagttttttgtttgtctgttaaa	Protospacer
************* ** ****** .* .  

297. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043503 (Bacillus paralicheniformis strain A4-3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagttttttgtttgtctgttaaa	Protospacer
************* ** ****** .* .  

298. spacer 1.9|178164|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032874 (Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tacactatagtttgttttttgtcaatagtt	CRISPR spacer
tacactatagttttttgtttgtctgttaaa	Protospacer
************* ** ****** .* .  

299. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693610 (Marine virus AFVG_250M347, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

300. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693919 (Marine virus AFVG_250M503, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
catttgaaagaaaagatggtgttgttggct	Protospacer
*. ***.** **************** .  

301. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694187 (Marine virus AFVG_250M1090, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

302. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694712 (Marine virus AFVG_250M502, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
catttgaaagaaaagatggtgttgttggct	Protospacer
*. ***.** **************** .  

303. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693995 (Marine virus AFVG_250M873, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

304. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693748 (Marine virus AFVG_250M1092, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

305. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693983 (Marine virus AFVG_250M348, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

306. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694702 (Marine virus AFVG_250M1088, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

307. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693937 (Marine virus AFVG_250M350, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

308. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694478 (Marine virus AFVG_250M504, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
catttgaaagaaaagatggtgttgttggct	Protospacer
*. ***.** **************** .  

309. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693780 (Marine virus AFVG_250M1089, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

310. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694535 (Marine virus AFVG_250M1087, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

311. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694384 (Marine virus AFVG_250M349, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

312. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694270 (Marine virus AFVG_250M505, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
catttgaaagaaaagatggtgttgttggct	Protospacer
*. ***.** **************** .  

313. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694656 (Marine virus AFVG_250M501, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
catttgaaagaaaagatggtgttgttggct	Protospacer
*. ***.** **************** .  

314. spacer 1.11|178295|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN694622 (Marine virus AFVG_250M1091, complete genome) position: , mismatch: 8, identity: 0.733

cggttggaataaaagatggtgttgttcaaa	CRISPR spacer
ggcctggaataaaatattgtgttgttcttc	Protospacer
 * .********** ** *********   

315. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693571 (Marine virus AFVG_25M499, complete genome) position: , mismatch: 8, identity: 0.733

acatctttacgtgttactgcatcagctgca	CRISPR spacer
gcatctttacgtgttactggatcaagcaag	Protospacer
.****************** ****. .. .

316. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693372 (Marine virus AFVG_25M493, complete genome) position: , mismatch: 8, identity: 0.733

acatctttacgtgttactgcatcagctgca	CRISPR spacer
gcatctttacgtgttactggatcaagcaag	Protospacer
.****************** ****. .. .

317. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693321 (Marine virus AFVG_25M500, complete genome) position: , mismatch: 8, identity: 0.733

acatctttacgtgttactgcatcagctgca	CRISPR spacer
gcatctttacgtgttactggatcaagcaag	Protospacer
.****************** ****. .. .

318. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MT681669 (Aeromonas phage PZL-Ah1, complete genome) position: , mismatch: 8, identity: 0.733

acatctttacgtgttactgcatcagctgca	CRISPR spacer
tgttcttgacgtgttcctgcatcagcaggt	Protospacer
   **** ******* ********** *  

319. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to JX872508 (Stenotrophomonas phage IME15, complete genome) position: , mismatch: 8, identity: 0.733

acatctttacgtgttactgcatcagctgca	CRISPR spacer
tgttcttgacgtgttcctgcatcagcaggt	Protospacer
   **** ******* ********** *  

320. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_047942 (Escherichia phage Ebrios, complete genome) position: , mismatch: 8, identity: 0.733

acatctttacgtgttactgcatcagctgca	CRISPR spacer
tgttcttgacgtgttcctgcatcagcaggt	Protospacer
   **** ******* ********** *  

321. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_011785 (Borreliella burgdorferi ZS7 plasmid ZS7_lp28-4, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

322. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_018993 (Borrelia burgdorferi 297 plasmid 297_lp28-4, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

323. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_017407 (Borreliella burgdorferi JD1 plasmid JD1 lp28-4, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

324. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_017416 (Borreliella burgdorferi N40 plasmid N40_lp28-4, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

325. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031403 (Borreliella burgdorferi strain MM1 plasmid plsm_lp28-4, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

326. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_001854 (Borreliella burgdorferi B31 plasmid lp28-4, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

327. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NC_001856 (Borreliella burgdorferi B31 plasmid lp38, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

328. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019853 (Borreliella burgdorferi plasmid lp38, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

329. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019764 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

330. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017217 (Borreliella burgdorferi strain B331 plasmid B331_lp38, complete sequence) position: , mismatch: 8, identity: 0.733

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
atctagaagacacgtatttaaaaaaaatac	Protospacer
* **********.**********. *  ..

331. spacer 2.2|399346|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NC_009795 (Campylobacter concisus 13826 plasmid pCCON31, complete sequence) position: , mismatch: 8, identity: 0.733

ttgtttttagtagctctatattcttctaga	CRISPR spacer
gtgtttttagtagctctttatcctttatat	Protospacer
 **************** ***.***.  . 

332. spacer 2.3|399412|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.733

gatcatgatacccctactaattataatagg	CRISPR spacer
gatcataataaccctactaattatgtatta	Protospacer
******.*** *************.    .

333. spacer 2.3|399412|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to NC_012040 (Campylobacter lari RM2100 plasmid pCL2100, complete sequence) position: , mismatch: 8, identity: 0.733

gatcatgatacccctactaattataatagg	CRISPR spacer
gatcataataaccctactaattatgtatta	Protospacer
******.*** *************.    .

334. spacer 2.7|399676|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to MN693396 (Marine virus AFVG_25M191, complete genome) position: , mismatch: 8, identity: 0.733

tgttagatgatggcattattacagaagaag	CRISPR spacer
atagagatggtggtattattacagaagctg	Protospacer
    *****.***.*************  *

335. spacer 2.7|399676|30|CP028724|CRISPRCasFinder,PILER-CR,CRT matches to MN693591 (Marine virus AFVG_25M357, complete genome) position: , mismatch: 8, identity: 0.733

tgttagatgatggcattattacagaagaag	CRISPR spacer
atagagatggtggtattattacagaagctg	Protospacer
    *****.***.*************  *

336. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
tgtctcaaaaaatgaaaattcaacgacaat	Protospacer
 *    ************** *******  

337. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_LR134422 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ataggaaaaaaatgaaaaataaacataaat	Protospacer
. **************** *****.  *  

338. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NC_016982 (Lactococcus garvieae 21881 plasmid pGL5 complete sequence) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
aaagtaaaaaaatgaaaattaaagagaaag	Protospacer
..** ****************** .. * *

339. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggtaaaaaatgaaaattgaattaagct	Protospacer
***** **************.**. * .. 

340. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP020349 (Pasteurella multocida subsp. septica strain CIRMBP-0873 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
tcaggaaaaaaatgaaaattgaagcagaca	Protospacer
  ******************.**  * *..

341. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to CP029293 (Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed6) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
aaagtaaaaaaatgaaaattaaagagaaag	Protospacer
..** ****************** .. * *

342. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_CP016702 (Lactococcus lactis subsp. lactis strain 275 plasmid p275D, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
aaagtaaaaaaatgaaaattaaagagaaag	Protospacer
..** ****************** .. * *

343. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to NZ_MF547664 (Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
ggaggaaaataatgaaaataaaattttcag	Protospacer
********* ********* ***.  .  *

344. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MN693578 (Marine virus AFVG_25M520, complete genome) position: , mismatch: 8, identity: 0.733

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
tgatgaaaaaaatgaaaagtaaacccaagt	Protospacer
 ** ************** *****   *  

345. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to LR588166 (Pseudomonas phage vB_PaeM_MIJ3) position: , mismatch: 8, identity: 0.733

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
aggaaacattgtaaaagatgcacaagaaaa	Protospacer
.   .* *************.** ******

346. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MH121069 (Pseudomonas phage vB_PaeM_PA5oct, complete genome) position: , mismatch: 8, identity: 0.733

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
aggaaacattgtaaaagatgcacaagaaaa	Protospacer
.   .* *************.** ******

347. spacer 1.12|178361|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to MN693460 (Marine virus AFVG_25M501, complete genome) position: , mismatch: 9, identity: 0.7

acatctttacgtgttactgcatcagctgca	CRISPR spacer
gcatttttacgtgttactggatcaagcaag	Protospacer
.***.************** ****. .. .

348. spacer 1.13|178427|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 9, identity: 0.7

acacctgaggaaattaacaatagtaaagtg	CRISPR spacer
acacctgaagaaattaacaatttagctata	Protospacer
********.************   .  .*.

349. spacer 1.14|178493|30|CP028724|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aactagaagacatgtatttaaaagtatggt	CRISPR spacer
gttaagaagacatgtaattaaaattatatg	Protospacer
. . ************ ****** ***.  

350. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MH617123 (Microviridae sp. isolate ctcd70, complete genome) position: , mismatch: 9, identity: 0.7

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
acagaaaaaaaatgaaaatgaaacgttcaa	Protospacer
. **.************** ***** .  .

351. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to MH937461 (Streptococcus phage CHPC642, complete genome) position: , mismatch: 9, identity: 0.7

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
aaaggaaaaaaatgaaatttaaatacgaat	Protospacer
..*************** *****..  *  

352. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK448817 (Streptococcus phage Javan59, complete genome) position: , mismatch: 9, identity: 0.7

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
attgattgaactaggaattaacgtagtctt	Protospacer
.  .*  ..************* *******

353. spacer 5.7|1840368|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MK449004 (Streptococcus phage Javan68, complete genome) position: , mismatch: 9, identity: 0.7

gaaaaaaagactaggaattaacctagtctt	CRISPR spacer
attgattgaactaggaattaacgtagtctt	Protospacer
.  .*  ..************* *******

354. spacer 5.8|1840434|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to AP014123 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C41-MedDCM-OCT-S29-C50, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7

gtttgaaattgtaaaagatgtaccagaaaa	CRISPR spacer
gccattgattgtaaaagatgtacctgaagc	Protospacer
*..   .***************** ***. 

355. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY463452 (Escherichia coli strain WCHEC050622 plasmid pMCR_WCHEC1622, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

356. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP324830 (Escherichia coli isolate FP671 plasmid pHNFP671, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

357. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035638 (Enterobacter cloacae strain EN3600 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

358. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MN542377 (Klebsiella pneumoniae subsp. pneumoniae strain 494 plasmid pKPC2_sg1, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

359. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to MN542378 (Klebsiella pneumoniae subsp. pneumoniae strain 607 plasmid pKPC2_sg2, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

360. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to LC549805 (Escherichia coli VNCEc117 plasmid pVNCEc117 DNA, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

361. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033354 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-2, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

362. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032987 (Escherichia coli strain BE2-5 plasmid pMCR_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

363. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025711 (Escherichia coli strain YDC107 plasmid pYDC107_41, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

364. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035195 (Klebsiella pneumoniae strain LH102-A plasmid pLH102-A, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

365. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045957 (Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010527 plasmid pAUSMDU00010527, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

366. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF978389 (Escherichia coli strain GDT6F36 plasmid pHNGDF36-1, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

367. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF990207 (Escherichia coli strain GDP6F1 plasmid pHNGDF1-1, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

368. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF678351 (Escherichia coli strain WCHEC025943 plasmid pMCR3_WCHEC1943, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

369. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF136778 (Escherichia coli strain HKSHmcr1_P2_EC plasmid pHKSHmcr1_P2_p1, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

370. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX580713 (Escherichia coli strain ZJ623 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

371. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY352406 (Salmonella enterica subsp. enterica serovar Typhimurium strain YL14P053 plasmid pMCR16_P053, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

372. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_022650 (Escherichia coli JJ1886 plasmid pJJ1886_4, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

373. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX377410 (Klebsiella pneumoniae strain WCHKP1511 plasmid pMCR_1511, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

374. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

375. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042602 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-3_MCR3, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

376. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030221 (Salmonella enterica strain SA20021456 plasmid pSA20021456.2, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

377. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024128 (Escherichia coli strain 14EC001 plasmid p14EC001a, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

378. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044383 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-3_MCR3, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

379. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051225 (Escherichia coli strain SCZE5 plasmid pSCZE3) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

380. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NC_023907 (Escherichia coli strain HS102707 plasmid pHS102707, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

381. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP021897 (Escherichia coli strain 2018-02-2CC plasmid p2018_02_02CC, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

382. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH043623 (Escherichia coli strain GDZJ002 plasmid pGDZJ002-1, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

383. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH043626 (Escherichia coli strain GDZJ004 plasmid pGDZJ004, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

384. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG552133 (Escherichia coli strain ECSC102 plasmid pECSC102, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

385. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF489760 (Escherichia coli strain WCHEC-LL123 plasmid pMCR3_WCHEC-LL123, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

386. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH043625 (Escherichia coli strain GDZJ003 plasmid pGDZJ003-1-MCR-3, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

387. spacer 5.10|1840566|30|CP028724|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027203 (Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence) position: , mismatch: 9, identity: 0.7

gttttcatttaagtagtgcgcttgatatgc	CRISPR spacer
gccaatatttaagtagtgcgctggataaaa	Protospacer
*..  .**************** **** . 

388. spacer 5.3|1840104|30|CP028724|CRISPRCasFinder,CRT matches to CP043941 (Acinetobacter lwoffii strain ZS207 plasmid pZS-1, complete sequence) position: , mismatch: 10, identity: 0.667

ggaggaaaaaaatgaaaattaaacgacatg	CRISPR spacer
atcataaaaaaatgaaaattaaaggatgca	Protospacer
.  . ****************** **....

389. spacer 5.4|1840170|30|CP028724|CRISPRCasFinder,CRT matches to MN693468 (Marine virus AFVG_25M247, complete genome) position: , mismatch: 10, identity: 0.667

acacttttccagagtttgaccaagctttat	CRISPR spacer
tggcttttccagagtttgaacaagtgaagc	Protospacer
  .**************** ****.   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage