Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035316 Escherichia coli strain D72 plasmid pD72-IncP, complete sequence 0 crisprs NA 0 0 2 0
CP035312 Escherichia coli strain D72 chromosome, complete genome 10 crisprs csa3,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4 0 20 7 0
CP035314 Escherichia coli strain D72 plasmid pD72-F33, complete sequence 0 crisprs csa3 0 0 0 0
CP035313 Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence 0 crisprs NA 0 0 1 0
CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 0 crisprs NA 0 0 3 0

Results visualization

1. CP035315
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9150 10 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_2 26596 : 27347 2 Rhodobacter_phage(50.0%) NA NA
DBSCAN-SWA_3 30715 : 37058 8 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP035312
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_1 69340-69544 Unclear NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_2 624060-624312 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_3 942292-942747 Unclear I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_4 968296-968569 TypeI-E I-E
4 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_5 969377-970198 TypeI-E I-E
13 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_6 1517641-1517758 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_7 2132089-2132212 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_9 3071799-3071943 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_10 3302712-3302808 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035312_11 3807672-3807813 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035312_5 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969833-969864 32 NZ_CP042584 Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence 72360-72391 0 1.0
CP035312_8 8.1|2775207|40|CP035312|CRISPRCasFinder 2775207-2775246 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP035312_5 5.13|970138|32|CP035312|CRISPRCasFinder,CRT 970138-970169 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 1 0.969
CP035312_7 7.1|2132132|38|CP035312|CRISPRCasFinder 2132132-2132169 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP035312_3 3.10|942443|32|CP035312|CRT 942443-942474 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
CP035312_3 3.10|942443|32|CP035312|CRT 942443-942474 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
CP035312_3 3.10|942443|32|CP035312|CRT 942443-942474 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
CP035312_3 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder 942442-942474 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
CP035312_3 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder 942442-942474 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
CP035312_3 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder 942442-942474 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
CP035312_5 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969528-969559 32 MF547662 Clostridioides phage LIBA6276, complete genome 37369-37400 4 0.875
CP035312_5 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969528-969559 32 MF547663 Clostridioides phage LIBA2945, complete genome 37369-37400 4 0.875
CP035312_3 3.10|942443|32|CP035312|CRT 942443-942474 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
CP035312_5 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969528-969559 32 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 83504-83535 5 0.844
CP035312_3 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder 942442-942474 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
CP035312_4 4.4|968508|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 968508-968539 32 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 43472-43503 6 0.812
CP035312_5 5.4|969589|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969589-969620 32 NZ_CP025114 Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence 241497-241528 6 0.812
CP035312_5 5.4|969589|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969589-969620 32 NZ_CP044544 Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence 137039-137070 6 0.812
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
CP035312_3 3.11|942504|32|CP035312|CRT 942504-942535 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
CP035312_5 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969833-969864 32 MT446416 UNVERIFIED: Escherichia virus TH47, complete genome 160213-160244 7 0.781
CP035312_5 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969833-969864 32 KM507819 Escherichia phage 121Q, complete genome 77721-77752 7 0.781
CP035312_5 5.13|970138|32|CP035312|CRISPRCasFinder,CRT 970138-970169 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
CP035312_3 3.4|942503|33|CP035312|PILER-CR,CRISPRCasFinder 942503-942535 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
CP035312_3 3.11|942504|32|CP035312|CRT 942504-942535 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
CP035312_3 3.14|942687|32|CP035312|CRT 942687-942718 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP035312_4 4.3|968447|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 968447-968478 32 NC_018454 Cronobacter phage phiES15, complete genome 8781-8812 8 0.75
CP035312_4 4.3|968447|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 968447-968478 32 JQ780327 Cronobacter phage phiES15, complete sequence 8781-8812 8 0.75
CP035312_5 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 970016-970047 32 NZ_CP013415 Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence 218852-218883 8 0.75
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
CP035312_3 3.9|942382|32|CP035312|CRT 942382-942413 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 57083-57114 9 0.719
CP035312_5 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969528-969559 32 MN693584 Marine virus AFVG_25M163, complete genome 29591-29622 9 0.719
CP035312_5 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969528-969559 32 MN103543 Pseudomonas phage vB_PaeM_PS119XW, complete genome 258501-258532 9 0.719
CP035312_5 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969528-969559 32 MK599315 Pseudomonas phage PA1C, complete genome 257887-257918 9 0.719
CP035312_5 5.4|969589|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969589-969620 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1548232-1548263 9 0.719
CP035312_5 5.9|969894|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969894-969925 32 AP014022 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S32-C75, *** SEQUENCING IN PROGRESS *** 22698-22729 9 0.719
CP035312_5 5.9|969894|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969894-969925 32 AP014023 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S35-C64, *** SEQUENCING IN PROGRESS *** 23700-23731 9 0.719
CP035312_5 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 970016-970047 32 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 208455-208486 9 0.719
CP035312_5 5.13|970138|32|CP035312|CRISPRCasFinder,CRT 970138-970169 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
CP035312_3 3.10|942443|32|CP035312|CRT 942443-942474 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
CP035312_3 3.10|942443|32|CP035312|CRT 942443-942474 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
CP035312_4 4.2|968386|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 968386-968417 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 55281-55312 10 0.688
CP035312_4 4.4|968508|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 968508-968539 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 50199-50230 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 19612-19643 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 115804-115835 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 116173-116204 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 182725-182756 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 110105-110136 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 109122-109153 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 221496-221527 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 207469-207500 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 199664-199695 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 13581-13612 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 73431-73462 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 187798-187829 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 106322-106353 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 148086-148117 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 93116-93147 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 185318-185349 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 219648-219679 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 158306-158337 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 93116-93147 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 167798-167829 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 128806-128837 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 91681-91712 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 183046-183077 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 37794-37825 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 36345-36376 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 124973-125004 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 184389-184420 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 94449-94480 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 26677-26708 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 182833-182864 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 183156-183187 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 183101-183132 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 197454-197485 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 205427-205458 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 191663-191694 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 49708-49739 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 126184-126215 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 93117-93148 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 181554-181585 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 182609-182640 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 182936-182967 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 182670-182701 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 183046-183077 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 182572-182603 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 180358-180389 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 176026-176057 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 130052-130083 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 182677-182708 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 182461-182492 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 41577-41608 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 203153-203184 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 109234-109265 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 20553-20584 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 58755-58786 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 179219-179250 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 194749-194780 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 146284-146315 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 176467-176498 10 0.688
CP035312_5 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969406-969437 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 45801-45832 10 0.688
CP035312_5 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969833-969864 32 MF403008 Agrobacterium phage Atu_ph07, complete genome 280549-280580 10 0.688
CP035312_5 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 970016-970047 32 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 27173-27204 10 0.688
CP035312_5 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 970016-970047 32 NZ_CP041350 Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence 149091-149122 10 0.688
CP035312_5 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 970016-970047 32 NZ_CP004365 Komagataeibacter xylinus E25 plasmid pGX5, complete sequence 172655-172686 10 0.688
CP035312_5 5.13|970138|32|CP035312|CRISPRCasFinder,CRT 970138-970169 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
CP035312_11 11.1|3807724|38|CP035312|CRISPRCasFinder 3807724-3807761 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737
CP035312_3 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder 942442-942474 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
CP035312_3 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder 942442-942474 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
CP035312_5 5.6|969711|32|CP035312|PILER-CR,CRISPRCasFinder,CRT 969711-969742 32 MN694507 Marine virus AFVG_250M1178, complete genome 3229-3260 11 0.656

1. spacer 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042584 (Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence) position: , mismatch: 0, identity: 1.0

actgcaaagttcttcacgctggtttttatgca	CRISPR spacer
actgcaaagttcttcacgctggtttttatgca	Protospacer
********************************

2. spacer 8.1|2775207|40|CP035312|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

3. spacer 5.13|970138|32|CP035312|CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
***********************.********

4. spacer 7.1|2132132|38|CP035312|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 3.10|942443|32|CP035312|CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

6. spacer 3.10|942443|32|CP035312|CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

7. spacer 3.10|942443|32|CP035312|CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

8. spacer 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

9. spacer 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

10. spacer 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

11. spacer 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 4, identity: 0.875

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** * 

12. spacer 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 4, identity: 0.875

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** * 

13. spacer 3.10|942443|32|CP035312|CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc	Protospacer
*  * ******.******** ***********

14. spacer 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cctataaaa	Protospacer
*** ******************* ..**** * 

15. spacer 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc	Protospacer
 *  * ******.******** ***********

16. spacer 4.4|968508|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgagtccgtcagcggtgcgccgctg-caaca	CRISPR spacer
gtcgagtaagtcagcggtgcgccgcgatcaac-	Protospacer
* *****  **************** . **** 

17. spacer 5.4|969589|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

atcggacg-atggcgatcgcaatcgcgcgggaa	CRISPR spacer
-ttagacgcatggcgattgcaatcgcgtgggat	Protospacer
 *..**** ********.*********.**** 

18. spacer 5.4|969589|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044544 (Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence) position: , mismatch: 6, identity: 0.812

atcggacg-atggcgatcgcaatcgcgcgggaa	CRISPR spacer
-ttagacgcatggcgattgcaatcgcgtgggat	Protospacer
 *..**** ********.*********.**** 

19. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

20. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

21. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

22. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

23. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

24. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

25. spacer 3.11|942504|32|CP035312|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
ccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
 *******.**************** *.. *.

26. spacer 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MT446416 (UNVERIFIED: Escherichia virus TH47, complete genome) position: , mismatch: 7, identity: 0.781

actgcaaagttcttcacgctggtt-----tttatgca	CRISPR spacer
actgcaaagttcttcaagctgtttagctgttt-----	Protospacer
**************** **** **     ***     

27. spacer 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 7, identity: 0.781

actgcaaagttcttcacgctggtt-----tttatgca	CRISPR spacer
actgcaaagttcttcaagctgtttagctgttt-----	Protospacer
**************** **** **     ***     

28. spacer 5.13|970138|32|CP035312|CRISPRCasFinder,CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781

gacgcactggatgcgatgatggatatcacttg-	CRISPR spacer
gacgcactgtatgcaatgatgga-atcggaggc	Protospacer
********* ****.******** ***.   * 

29. spacer 3.4|942503|33|CP035312|PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

30. spacer 3.11|942504|32|CP035312|CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
atgcggtcatggatgctgatgttgcagtgatg	Protospacer
*.*.********.***** ******** * ..

31. spacer 3.14|942687|32|CP035312|CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

32. spacer 4.3|968447|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_018454 (Cronobacter phage phiES15, complete genome) position: , mismatch: 8, identity: 0.75

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

33. spacer 4.3|968447|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to JQ780327 (Cronobacter phage phiES15, complete sequence) position: , mismatch: 8, identity: 0.75

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

34. spacer 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 8, identity: 0.75

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
aatctacaggccgtgacggttgtcatggaggc	Protospacer
     *****************.*** *** *

35. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

36. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

37. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

38. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

39. spacer 3.9|942382|32|CP035312|CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gcaaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
* ********  *************..*  . 

40. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatatcacccagcactccggg	Protospacer
  *  ******************** ** .  

41. spacer 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MN693584 (Marine virus AFVG_25M163, complete genome) position: , mismatch: 9, identity: 0.719

tacagtttccataaattcacctcgtttatata	CRISPR spacer
ggggatatctataaactcacctcgtttatatt	Protospacer
 . ..* **.*****.*************** 

42. spacer 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 9, identity: 0.719

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

43. spacer 5.3|969528|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 9, identity: 0.719

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

44. spacer 5.4|969589|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

atcggacgatggcgatcgcaatcgcgcgggaa	CRISPR spacer
aaaagacgatggcgatcgcaatcgtgcctttc	Protospacer
*  .********************.**     

45. spacer 5.9|969894|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to AP014022 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S32-C75, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ccagccgaaacaacgccagcaaaatcgaccgc	CRISPR spacer
ccagccaaaacatcgccagcaaaaccttggag	Protospacer
******.***** ***********.*    . 

46. spacer 5.9|969894|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to AP014023 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S35-C64, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ccagccgaaacaacgccagcaaaatcgaccgc	CRISPR spacer
ccagccaaaacatcgccagcaaaaccctggag	Protospacer
******.***** ***********.*    . 

47. spacer 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 9, identity: 0.719

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gctgcacagggtgtgacggttgccattgccga	Protospacer
 * * ***** .****************    

48. spacer 5.13|970138|32|CP035312|CRISPRCasFinder,CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggccgaggc	Protospacer
******** ************** ..*.    

49. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

50. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

51. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

52. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

53. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

54. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

55. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

56. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

57. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

58. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

59. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

60. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

61. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

62. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

63. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

64. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

65. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**  

66. spacer 3.10|942443|32|CP035312|CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg	Protospacer
 *******.************ ***.   .. 

67. spacer 3.10|942443|32|CP035312|CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg	Protospacer
 *******.************ ***.   .. 

68. spacer 4.2|968386|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcacggaattgttatgctgttcccctgaccg	CRISPR spacer
tcttcggaattgccatgctgttccccttccat	Protospacer
  . ********..*************  *  

69. spacer 4.4|968508|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgagtccgtcagcggtgcgccgctgcaaca	CRISPR spacer
ttggagtccgacatcggtgcgccgcttttcga	Protospacer
   ******* ** ************ .   *

70. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

71. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

72. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

73. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

74. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

75. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

76. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

77. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

78. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

79. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

80. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

81. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

82. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

83. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

84. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

85. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

86. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

87. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

88. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

89. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

90. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

91. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

92. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

93. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

94. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

95. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

96. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

97. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

98. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

99. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

100. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

101. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

102. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

103. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

104. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

105. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

106. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

107. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

108. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

109. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

110. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

111. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

112. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

113. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

114. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

115. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

116. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

117. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

118. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

119. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

120. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

121. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

122. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

123. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

124. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

125. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

126. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

127. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

128. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

129. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

130. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

131. spacer 5.1|969406|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .  

132. spacer 5.8|969833|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MF403008 (Agrobacterium phage Atu_ph07, complete genome) position: , mismatch: 10, identity: 0.688

actgcaaagttcttcacgctggtttttatgca	CRISPR spacer
cataagaagtgcttcacgctggttttcatcag	Protospacer
  *. .**** ***************.**  .

133. spacer 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 10, identity: 0.688

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gacggacaggccgccacggttgccatcaggaa	Protospacer
   **********. ***********...*  

134. spacer 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041350 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gatggacaggctgtgacggtcgccatcaggaa	Protospacer
   ********.********.*****...*  

135. spacer 5.11|970016|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004365 (Komagataeibacter xylinus E25 plasmid pGX5, complete sequence) position: , mismatch: 10, identity: 0.688

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gatggacaggctgtgacggtcgccatcaggaa	Protospacer
   ********.********.*****...*  

136. spacer 5.13|970138|32|CP035312|CRISPRCasFinder,CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggcagaagc	Protospacer
******** ************** .. .    

137. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

138. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

139. spacer 11.1|3807724|38|CP035312|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

140. spacer 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

141. spacer 3.3|942442|33|CP035312|PILER-CR,CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

142. spacer 5.6|969711|32|CP035312|PILER-CR,CRISPRCasFinder,CRT matches to MN694507 (Marine virus AFVG_250M1178, complete genome) position: , mismatch: 11, identity: 0.656

aaccttgtcgggtcgcccgtgcgtcatgatga	CRISPR spacer
tggtatgtcgggtagcccgtgcgccatgcccg	Protospacer
 . . ******** *********.**** . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 977562 : 990745 12 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_2 1058304 : 1145796 95 Enterobacteria_phage(68.52%) plate,portal,integrase,tail,transposase,holin,terminase,capsid,head,tRNA attL 1071756:1071772|attR 1149317:1149333
DBSCAN-SWA_3 1646228 : 1655669 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1748396 : 1758666 11 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_5 2205944 : 2263650 60 Enterobacteria_phage(50.0%) portal,tail,transposase,holin,terminase,protease NA
DBSCAN-SWA_6 2903157 : 2988360 90 Salmonella_phage(60.0%) plate,protease,portal,integrase,tail,terminase,lysis,capsid,head,tRNA attL 2896120:2896135|attR 2992239:2992254
DBSCAN-SWA_7 3571042 : 3583841 15 Enterobacteria_phage(40.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP035316
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11181 11 Moraxella_phage(20.0%) NA NA
DBSCAN-SWA_2 22656 : 26622 3 Pseudomonas_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP035313
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 96184 105 Escherichia_phage(60.61%) integrase,transposase,terminase,head,plate,portal,holin,tail,lysis attL 72306:72321|attR 87421:87436
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage