Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP036355 Bacillus sp. SYJ plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP036354 Bacillus sp. SYJ plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP036356 Bacillus sp. SYJ chromosome, complete genome 8 crisprs NA 33 23 0 0

Results visualization

1. CP036356
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_1 75321-75421 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_2 429274-431109 Orphan NA
45 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_3 1394365-1394472 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_4 1673608-1673729 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_5 1791809-1791884 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_6 2744591-2744838 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_7 3360994-3361102 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036356_8 4976521-4976676 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 431443-431460 0 1.0
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 431533-431550 0 1.0
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 431578-431595 0 1.0
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 431443-431460 0 1.0
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 431533-431550 0 1.0
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 431578-431595 0 1.0
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 431443-431460 0 1.0
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 431533-431550 0 1.0
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 431578-431595 0 1.0
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 431443-431460 0 1.0
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 431533-431550 0 1.0
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 431578-431595 0 1.0
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 431443-431460 0 1.0
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 431533-431550 0 1.0
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 431578-431595 0 1.0
CP036356_2 2.24|430183|18|CP036356|CRT 430183-430200 18 CP036356.1 429256-429273 0 1.0
CP036356_2 2.30|430435|18|CP036356|CRT 430435-430452 18 CP036356.1 429256-429273 0 1.0
CP036356_2 2.33|430561|18|CP036356|CRT 430561-430578 18 CP036356.1 429256-429273 0 1.0
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 CP036356.1 431227-431253 0 1.0
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 431497-431514 0 1.0
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 431542-431559 0 1.0
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 3598695-3598712 0 1.0
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 CP036356.1 431227-431253 0 1.0
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 431497-431514 0 1.0
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 431542-431559 0 1.0
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 3598695-3598712 0 1.0
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP036356.1 431443-431469 0 1.0
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP036356.1 431578-431604 0 1.0
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 CP036356.1 431533-431559 0 1.0
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP036356.1 431443-431469 0 1.0
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP036356.1 431578-431604 0 1.0
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 CP036356.1 431533-431559 0 1.0
CP036356_2 2.45|431074|18|CP036356|CRT 431074-431091 18 CP036356.1 431281-431298 0 1.0
CP036356_2 2.1|429292|18|CP036356|CRT 429292-429309 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.1|429292|18|CP036356|CRT 429292-429309 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.1|429292|18|CP036356|CRT 429292-429309 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.3|429364|18|CP036356|CRT 429364-429381 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.3|429364|18|CP036356|CRT 429364-429381 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.3|429364|18|CP036356|CRT 429364-429381 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 431272-431289 1 0.944
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 431623-431640 1 0.944
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.5|429436|18|CP036356|CRT 429436-429453 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 431272-431289 1 0.944
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 431623-431640 1 0.944
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.7|429517|18|CP036356|CRT 429517-429534 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.9|429598|18|CP036356|CRT 429598-429615 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.9|429598|18|CP036356|CRT 429598-429615 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.9|429598|18|CP036356|CRT 429598-429615 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 431272-431289 1 0.944
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 431623-431640 1 0.944
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.11|429670|18|CP036356|CRT 429670-429687 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 431272-431289 1 0.944
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 431623-431640 1 0.944
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.13|429751|18|CP036356|CRT 429751-429768 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.15|429823|18|CP036356|CRT 429823-429840 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.15|429823|18|CP036356|CRT 429823-429840 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.15|429823|18|CP036356|CRT 429823-429840 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 431272-431289 1 0.944
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 431398-431415 1 0.944
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 431623-431640 1 0.944
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 3598659-3598676 1 0.944
CP036356_2 2.17|429895|18|CP036356|CRT 429895-429912 18 CP036356.1 3598713-3598730 1 0.944
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 CP036356.1 3598650-3598676 1 0.963
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 CP036356.1 3598650-3598676 1 0.963
CP036356_2 2.21|430066|18|CP036356|CRT 430066-430083 18 CP036356.1 431443-431460 1 0.944
CP036356_2 2.21|430066|18|CP036356|CRT 430066-430083 18 CP036356.1 431533-431550 1 0.944
CP036356_2 2.21|430066|18|CP036356|CRT 430066-430083 18 CP036356.1 431578-431595 1 0.944
CP036356_2 2.22|430102|18|CP036356|CRT 430102-430119 18 CP036356.1 431488-431505 1 0.944
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 CP036356.1 3598650-3598676 1 0.963
CP036356_2 2.28|430354|18|CP036356|CRT 430354-430371 18 CP036356.1 431488-431505 1 0.944
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 CP036356.1 3598650-3598676 1 0.963
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 CP036356.1 431488-431514 1 0.963
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 431236-431253 1 0.944
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 431407-431424 1 0.944
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 431452-431469 1 0.944
CP036356_2 2.37|430732|18|CP036356|CRT 430732-430749 18 CP036356.1 431587-431604 1 0.944
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 CP036356.1 431488-431514 1 0.963
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 431236-431253 1 0.944
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 431407-431424 1 0.944
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 431452-431469 1 0.944
CP036356_2 2.39|430813|18|CP036356|CRT 430813-430830 18 CP036356.1 431587-431604 1 0.944
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP036356.1 431488-431514 1 0.963
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP036356.1 431398-431424 1 0.963
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP036356.1 431533-431559 1 0.963
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP036356.1 431623-431649 1 0.963
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 CP036356.1 431443-431469 1 0.963
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 CP036356.1 431578-431604 1 0.963
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP036356.1 431398-431424 1 0.963
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP036356.1 431533-431559 1 0.963
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP036356.1 431623-431649 1 0.963
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 CP036356.1 431443-431469 1 0.963
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 CP036356.1 431578-431604 1 0.963
CP036356_2 2.45|431074|18|CP036356|CRT 431074-431091 18 CP036356.1 431632-431649 1 0.944
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 CP036356.1 3598704-3598730 2 0.926
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 CP036356.1 431272-431298 2 0.926
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 CP036356.1 3598704-3598730 2 0.926
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 CP036356.1 431272-431298 2 0.926
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 CP036356.1 3598704-3598730 2 0.926
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 CP036356.1 431272-431298 2 0.926
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 CP036356.1 431272-431298 2 0.926
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 CP036356.1 3598704-3598730 2 0.926
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 CP036356.1 431191-431217 2 0.926
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 CP036356.1 431191-431217 2 0.926
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP036356.1 431227-431253 2 0.926
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP036356.1 431272-431298 2 0.926
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 CP036356.1 431398-431424 2 0.926
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 CP036356.1 431623-431649 2 0.926
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP036356.1 431272-431298 2 0.926
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 CP036356.1 431398-431424 2 0.926
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 CP036356.1 431623-431649 2 0.926

1. spacer 2.5|429436|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

2. spacer 2.5|429436|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

3. spacer 2.5|429436|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

4. spacer 2.7|429517|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

5. spacer 2.7|429517|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

6. spacer 2.7|429517|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

7. spacer 2.11|429670|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

8. spacer 2.11|429670|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

9. spacer 2.11|429670|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

10. spacer 2.13|429751|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

11. spacer 2.13|429751|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

12. spacer 2.13|429751|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

13. spacer 2.17|429895|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

14. spacer 2.17|429895|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

15. spacer 2.17|429895|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

16. spacer 2.24|430183|18|CP036356|CRT matches to position: 429256-429273, mismatch: 0, identity: 1.0

cgctaccggacctcgagg	CRISPR spacer
cgctaccggacctcgagg	Protospacer
******************

17. spacer 2.30|430435|18|CP036356|CRT matches to position: 429256-429273, mismatch: 0, identity: 1.0

cgctaccggacctcgagg	CRISPR spacer
cgctaccggacctcgagg	Protospacer
******************

18. spacer 2.33|430561|18|CP036356|CRT matches to position: 429256-429273, mismatch: 0, identity: 1.0

cgctaccggacctcgagg	CRISPR spacer
cgctaccggacctcgagg	Protospacer
******************

19. spacer 2.36|430687|27|CP036356|CRT matches to position: 431227-431253, mismatch: 0, identity: 1.0

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggtgctcaagg	Protospacer
***************************

20. spacer 2.37|430732|18|CP036356|CRT matches to position: 431497-431514, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

21. spacer 2.37|430732|18|CP036356|CRT matches to position: 431542-431559, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

22. spacer 2.37|430732|18|CP036356|CRT matches to position: 3598695-3598712, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

23. spacer 2.38|430768|27|CP036356|CRT matches to position: 431227-431253, mismatch: 0, identity: 1.0

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggtgctcaagg	Protospacer
***************************

24. spacer 2.39|430813|18|CP036356|CRT matches to position: 431497-431514, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

25. spacer 2.39|430813|18|CP036356|CRT matches to position: 431542-431559, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

26. spacer 2.39|430813|18|CP036356|CRT matches to position: 3598695-3598712, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

27. spacer 2.41|430894|27|CP036356|CRT matches to position: 431443-431469, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

28. spacer 2.41|430894|27|CP036356|CRT matches to position: 431578-431604, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

29. spacer 2.42|430939|27|CP036356|CRT matches to position: 431533-431559, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
***************************

30. spacer 2.43|430984|27|CP036356|CRT matches to position: 431443-431469, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

31. spacer 2.43|430984|27|CP036356|CRT matches to position: 431578-431604, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

32. spacer 2.44|431029|27|CP036356|CRT matches to position: 431533-431559, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
***************************

33. spacer 2.45|431074|18|CP036356|CRT matches to position: 431281-431298, mismatch: 0, identity: 1.0

acctcagggtattcaagg	CRISPR spacer
acctcagggtattcaagg	Protospacer
******************

34. spacer 2.1|429292|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

35. spacer 2.1|429292|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

36. spacer 2.1|429292|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

37. spacer 2.3|429364|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

38. spacer 2.3|429364|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

39. spacer 2.3|429364|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

40. spacer 2.5|429436|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

41. spacer 2.5|429436|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

42. spacer 2.5|429436|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

43. spacer 2.5|429436|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

44. spacer 2.5|429436|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

45. spacer 2.7|429517|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

46. spacer 2.7|429517|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

47. spacer 2.7|429517|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

48. spacer 2.7|429517|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

49. spacer 2.7|429517|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

50. spacer 2.9|429598|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

51. spacer 2.9|429598|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

52. spacer 2.9|429598|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

53. spacer 2.11|429670|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

54. spacer 2.11|429670|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

55. spacer 2.11|429670|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

56. spacer 2.11|429670|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

57. spacer 2.11|429670|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

58. spacer 2.13|429751|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

59. spacer 2.13|429751|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

60. spacer 2.13|429751|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

61. spacer 2.13|429751|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

62. spacer 2.13|429751|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

63. spacer 2.15|429823|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

64. spacer 2.15|429823|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

65. spacer 2.15|429823|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

66. spacer 2.17|429895|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

67. spacer 2.17|429895|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

68. spacer 2.17|429895|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

69. spacer 2.17|429895|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

70. spacer 2.17|429895|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

71. spacer 2.18|429931|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

72. spacer 2.20|430021|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

73. spacer 2.21|430066|18|CP036356|CRT matches to position: 431443-431460, mismatch: 1, identity: 0.944

tgctaccggacctcgagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
**************.***

74. spacer 2.21|430066|18|CP036356|CRT matches to position: 431533-431550, mismatch: 1, identity: 0.944

tgctaccggacctcgagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
**************.***

75. spacer 2.21|430066|18|CP036356|CRT matches to position: 431578-431595, mismatch: 1, identity: 0.944

tgctaccggacctcgagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
**************.***

76. spacer 2.22|430102|18|CP036356|CRT matches to position: 431488-431505, mismatch: 1, identity: 0.944

cgccactggacctcaagg	CRISPR spacer
cgctactggacctcaagg	Protospacer
***.**************

77. spacer 2.26|430264|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

78. spacer 2.28|430354|18|CP036356|CRT matches to position: 431488-431505, mismatch: 1, identity: 0.944

cgccactggacctcaagg	CRISPR spacer
cgctactggacctcaagg	Protospacer
***.**************

79. spacer 2.35|430642|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

80. spacer 2.36|430687|27|CP036356|CRT matches to position: 431488-431514, mismatch: 1, identity: 0.963

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcaaggtgctcaagg	Protospacer
***************.***********

81. spacer 2.37|430732|18|CP036356|CRT matches to position: 431236-431253, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcagggtgctcaagg	Protospacer
******.***********

82. spacer 2.37|430732|18|CP036356|CRT matches to position: 431407-431424, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

83. spacer 2.37|430732|18|CP036356|CRT matches to position: 431452-431469, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

84. spacer 2.37|430732|18|CP036356|CRT matches to position: 431587-431604, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

85. spacer 2.38|430768|27|CP036356|CRT matches to position: 431488-431514, mismatch: 1, identity: 0.963

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcaaggtgctcaagg	Protospacer
***************.***********

86. spacer 2.39|430813|18|CP036356|CRT matches to position: 431236-431253, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcagggtgctcaagg	Protospacer
******.***********

87. spacer 2.39|430813|18|CP036356|CRT matches to position: 431407-431424, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

88. spacer 2.39|430813|18|CP036356|CRT matches to position: 431452-431469, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

89. spacer 2.39|430813|18|CP036356|CRT matches to position: 431587-431604, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

90. spacer 2.40|430849|27|CP036356|CRT matches to position: 431488-431514, mismatch: 1, identity: 0.963

cgctactggacctcaaggtgttcaagg	CRISPR spacer
cgctactggacctcaaggtgctcaagg	Protospacer
********************.******

91. spacer 2.41|430894|27|CP036356|CRT matches to position: 431398-431424, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.********************

92. spacer 2.41|430894|27|CP036356|CRT matches to position: 431533-431559, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
********************.******

93. spacer 2.41|430894|27|CP036356|CRT matches to position: 431623-431649, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.***********

94. spacer 2.42|430939|27|CP036356|CRT matches to position: 431443-431469, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

95. spacer 2.42|430939|27|CP036356|CRT matches to position: 431578-431604, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

96. spacer 2.43|430984|27|CP036356|CRT matches to position: 431398-431424, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.********************

97. spacer 2.43|430984|27|CP036356|CRT matches to position: 431533-431559, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
********************.******

98. spacer 2.43|430984|27|CP036356|CRT matches to position: 431623-431649, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.***********

99. spacer 2.44|431029|27|CP036356|CRT matches to position: 431443-431469, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

100. spacer 2.44|431029|27|CP036356|CRT matches to position: 431578-431604, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

101. spacer 2.45|431074|18|CP036356|CRT matches to position: 431632-431649, mismatch: 1, identity: 0.944

acctcagggtattcaagg	CRISPR spacer
acctcagggtgttcaagg	Protospacer
**********.*******

102. spacer 2.18|429931|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

103. spacer 2.19|429976|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

104. spacer 2.20|430021|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

105. spacer 2.25|430219|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

106. spacer 2.26|430264|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

107. spacer 2.31|430471|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

108. spacer 2.34|430597|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

109. spacer 2.35|430642|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

110. spacer 2.36|430687|27|CP036356|CRT matches to position: 431191-431217, mismatch: 2, identity: 0.926

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggacctcaagg	Protospacer
******************  *******

111. spacer 2.38|430768|27|CP036356|CRT matches to position: 431191-431217, mismatch: 2, identity: 0.926

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggacctcaagg	Protospacer
******************  *******

112. spacer 2.40|430849|27|CP036356|CRT matches to position: 431227-431253, mismatch: 2, identity: 0.926

cgctactggacctcaaggtgttcaagg	CRISPR spacer
cgctactggacctcagggtgctcaagg	Protospacer
***************.****.******

113. spacer 2.41|430894|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
***************.***.*******

114. spacer 2.42|430939|27|CP036356|CRT matches to position: 431398-431424, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.*************.******

115. spacer 2.42|430939|27|CP036356|CRT matches to position: 431623-431649, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.****.******

116. spacer 2.43|430984|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
***************.***.*******

117. spacer 2.44|431029|27|CP036356|CRT matches to position: 431398-431424, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.*************.******

118. spacer 2.44|431029|27|CP036356|CRT matches to position: 431623-431649, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.****.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 2 0.926
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 2 0.926
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 2 0.926
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 3 0.889
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 3 0.889
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 3 0.889
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 3 0.889
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MT446392 UNVERIFIED: Escherichia virus TH15, complete genome 67531-67557 3 0.889
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 MN693226 Marine virus AFVG_25M419, complete genome 12225-12251 3 0.889
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MT446392 UNVERIFIED: Escherichia virus TH15, complete genome 67531-67557 3 0.889
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 MN693226 Marine virus AFVG_25M419, complete genome 12225-12251 3 0.889
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 KT264760 Gokushovirus WZ-2015a isolate 12Fra21, complete genome 5191-5215 3 0.88
CP036356_2 2.6|429472|27|CP036356|CRT 429472-429498 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1995-2021 4 0.852
CP036356_2 2.8|429553|27|CP036356|CRT 429553-429579 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1995-2021 4 0.852
CP036356_2 2.12|429706|27|CP036356|CRT 429706-429732 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1995-2021 4 0.852
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 MH884513 Bacillus phage vB_BpsS-36, complete genome 21540-21566 4 0.852
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 22441-22467 4 0.852
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 MN101228 Klebsiella phage KPN4, complete genome 27774-27800 4 0.852
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 MN101228 Klebsiella phage KPN4, complete genome 28986-29012 4 0.852
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 MT446415 UNVERIFIED: Escherichia virus TH44, complete genome 2868-2894 4 0.852
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 4 0.852
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 4 0.852
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 4 0.852
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 4 0.852
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 MH884513 Bacillus phage vB_BpsS-36, complete genome 21540-21566 4 0.852
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 22441-22467 4 0.852
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 MN101228 Klebsiella phage KPN4, complete genome 27774-27800 4 0.852
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 MN101228 Klebsiella phage KPN4, complete genome 28986-29012 4 0.852
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 MT446415 UNVERIFIED: Escherichia virus TH44, complete genome 2868-2894 4 0.852
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 719922-719948 4 0.852
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 NC_024210 Escherichia phage e4/1c, complete genome 8033-8059 4 0.852
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 4 0.852
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 4 0.852
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 4 0.852
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 4 0.852
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 MH884513 Bacillus phage vB_BpsS-36, complete genome 21540-21566 4 0.852
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 22441-22467 4 0.852
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 MN101228 Klebsiella phage KPN4, complete genome 27774-27800 4 0.852
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 MN101228 Klebsiella phage KPN4, complete genome 28986-29012 4 0.852
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 MT446415 UNVERIFIED: Escherichia virus TH44, complete genome 2868-2894 4 0.852
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 22441-22467 4 0.852
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 MN101228 Klebsiella phage KPN4, complete genome 27774-27800 4 0.852
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 MN101228 Klebsiella phage KPN4, complete genome 28986-29012 4 0.852
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 178449-178475 4 0.852
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 EU246945 Lactobacillus phage Lrm1, complete sequence 17376-17402 4 0.852
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NC_011104 Lactobacillus phage Lrm1, complete genome 17376-17402 4 0.852
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 719922-719948 4 0.852
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 NC_024210 Escherichia phage e4/1c, complete genome 8033-8059 4 0.852
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 4 0.852
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 4 0.852
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 4 0.852
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 4 0.852
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 719922-719948 4 0.852
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 NC_024210 Escherichia phage e4/1c, complete genome 8033-8059 4 0.852
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 4 0.852
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 4 0.852
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 4 0.852
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 4 0.852
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 MH884513 Bacillus phage vB_BpsS-36, complete genome 21540-21566 4 0.852
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 22441-22467 4 0.852
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 MN101228 Klebsiella phage KPN4, complete genome 27774-27800 4 0.852
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 MN101228 Klebsiella phage KPN4, complete genome 28986-29012 4 0.852
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 MT446415 UNVERIFIED: Escherichia virus TH44, complete genome 2868-2894 4 0.852
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 FR682616 Roseovarius sp. 217 phage 1 partial genome sequence 14631-14657 4 0.852
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 FR719956 Roseovarius Plymouth Podovirus 1 partial sequence 14631-14657 4 0.852
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 FR682616 Roseovarius sp. 217 phage 1 partial genome sequence 14631-14657 4 0.852
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 FR719956 Roseovarius Plymouth Podovirus 1 partial sequence 14631-14657 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2677-2703 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2785-2811 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 8366-8392 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 8420-8446 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 8474-8500 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168901-168927 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 4 0.852
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 4 0.852
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MH513984 Mycobacterium phage Steamy, complete genome 4653-4679 4 0.852
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MN855617 Myoviridae sp. isolate 527, complete genome 7158-7184 4 0.852
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2632-2658 4 0.852
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 MN693092 Marine virus AFVG_25M37, complete genome 19120-19146 4 0.852
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MH513984 Mycobacterium phage Steamy, complete genome 4653-4679 4 0.852
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MN855617 Myoviridae sp. isolate 527, complete genome 7158-7184 4 0.852
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2632-2658 4 0.852
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 MN693092 Marine virus AFVG_25M37, complete genome 19120-19146 4 0.852
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 570384-570408 4 0.84
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 NZ_CP040346 Bacillus albus strain DLOU-Yingkou plasmid unnamed2, complete sequence 52379-52403 4 0.84
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 NZ_LR134433 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24 307060-307084 4 0.84
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 KC430106 Bacillus phage BPS10C, complete genome 153087-153111 4 0.84
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 AP013516 Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44 11070-11094 4 0.84
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 AP013516 Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44 11082-11106 4 0.84
CP036356_2 2.6|429472|27|CP036356|CRT 429472-429498 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2040-2066 5 0.815
CP036356_2 2.8|429553|27|CP036356|CRT 429553-429579 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2040-2066 5 0.815
CP036356_2 2.12|429706|27|CP036356|CRT 429706-429732 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2040-2066 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 2984-3010 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 3074-3100 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 178449-178475 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 723561-723587 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 478126-478152 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2893-2919 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2983-3009 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 394-420 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 484-510 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 177-203 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 267-293 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 EU246945 Lactobacillus phage Lrm1, complete sequence 17376-17402 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 MH937462 Streptococcus phage CHPC663, complete genome 17555-17581 5 0.815
CP036356_2 2.18|429931|27|CP036356|CRT 429931-429957 27 NC_011104 Lactobacillus phage Lrm1, complete genome 17376-17402 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 2984-3010 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 3074-3100 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 178449-178475 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 723561-723587 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 478126-478152 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2893-2919 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2983-3009 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 394-420 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 484-510 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 177-203 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 267-293 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 EU246945 Lactobacillus phage Lrm1, complete sequence 17376-17402 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 MH937462 Streptococcus phage CHPC663, complete genome 17555-17581 5 0.815
CP036356_2 2.20|430021|27|CP036356|CRT 430021-430047 27 NC_011104 Lactobacillus phage Lrm1, complete genome 17376-17402 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 5 0.815
CP036356_2 2.23|430138|27|CP036356|CRT 430138-430164 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 2984-3010 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 3074-3100 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 178449-178475 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 723561-723587 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 478126-478152 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2893-2919 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2983-3009 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 394-420 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 484-510 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 177-203 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 267-293 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 EU246945 Lactobacillus phage Lrm1, complete sequence 17376-17402 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 MH937462 Streptococcus phage CHPC663, complete genome 17555-17581 5 0.815
CP036356_2 2.26|430264|27|CP036356|CRT 430264-430290 27 NC_011104 Lactobacillus phage Lrm1, complete genome 17376-17402 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 MH884513 Bacillus phage vB_BpsS-36, complete genome 21540-21566 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 2984-3010 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 3074-3100 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 723561-723587 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 478126-478152 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2893-2919 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2983-3009 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 394-420 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 484-510 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 177-203 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 267-293 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 MT446415 UNVERIFIED: Escherichia virus TH44, complete genome 2868-2894 5 0.815
CP036356_2 2.27|430309|27|CP036356|CRT 430309-430335 27 MH937462 Streptococcus phage CHPC663, complete genome 17555-17581 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 5 0.815
CP036356_2 2.29|430390|27|CP036356|CRT 430390-430416 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 DQ222855 Bacillus anthracis phage Gamma isolate 53, complete genome 30899-30925 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 DQ289555 Bacillus anthracis phage W Beta, complete genome 33699-33725 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 NC_007734 Bacillus phage WBeta, complete genome 33699-33725 5 0.815
CP036356_2 2.32|430516|27|CP036356|CRT 430516-430542 27 DQ222854 Bacillus anthracis phage Gamma collagen region, complete sequence 3816-3842 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 2984-3010 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP053975 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence 3074-3100 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 178449-178475 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 723561-723587 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 478126-478152 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2893-2919 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NC_018512 Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence 2983-3009 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 394-420 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NC_004334 Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence 484-510 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 177-203 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NZ_CP009344 Bacillus thuringiensis HD1002 plasmid 7, complete sequence 267-293 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 EU246945 Lactobacillus phage Lrm1, complete sequence 17376-17402 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 MH937462 Streptococcus phage CHPC663, complete genome 17555-17581 5 0.815
CP036356_2 2.35|430642|27|CP036356|CRT 430642-430668 27 NC_011104 Lactobacillus phage Lrm1, complete genome 17376-17402 5 0.815
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 134821-134847 5 0.815
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 5 0.815
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 MN693092 Marine virus AFVG_25M37, complete genome 19120-19146 5 0.815
CP036356_2 2.36|430687|27|CP036356|CRT 430687-430713 27 NC_022968 Enterobacteria phage 4MG, complete genome 48915-48941 5 0.815
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 134821-134847 5 0.815
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 5 0.815
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 MN693092 Marine virus AFVG_25M37, complete genome 19120-19146 5 0.815
CP036356_2 2.38|430768|27|CP036356|CRT 430768-430794 27 NC_022968 Enterobacteria phage 4MG, complete genome 48915-48941 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2839-2865 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169009-169035 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169063-169089 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169117-169143 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 KY705251 Streptococcus phage P0091, complete genome 17095-17121 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20008-20034 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 MH937499 Streptococcus phage CHPC1062, complete genome 17279-17305 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 MT354570 Pseudomonas phage phiB1_1, complete genome 30767-30793 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 274933-274959 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 275041-275067 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 NC_021795 Cellulophaga phage phi17:1, complete genome 26453-26479 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 MK373793 Escherichia phage vB_EcoS_MM01, complete genome 10523-10549 5 0.815
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 MN693092 Marine virus AFVG_25M37, complete genome 19120-19146 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 274825-274851 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 274933-274959 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 275041-275067 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2677-2703 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2785-2811 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168901-168927 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169117-169143 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NZ_CP040335 Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence 9129-9155 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MG812496 Gordonia phage SallySpecial, complete genome 11678-11704 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MH622922 Microviridae sp. isolate ctce123, complete genome 4046-4072 5 0.815
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 NC_021795 Cellulophaga phage phi17:1, complete genome 26426-26452 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 274825-274851 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 274933-274959 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 275041-275067 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2677-2703 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2731-2757 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP012105 Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence 2785-2811 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168901-168927 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 168955-168981 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 169117-169143 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NZ_CP040335 Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence 9129-9155 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MG812496 Gordonia phage SallySpecial, complete genome 11678-11704 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MH622922 Microviridae sp. isolate ctce123, complete genome 4046-4072 5 0.815
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 NC_021795 Cellulophaga phage phi17:1, complete genome 26426-26452 5 0.815
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 NC_049380 Vibrio phage JSF3, complete genome 17817-17841 5 0.8
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 KP280062 Vibrio phage phi 1, complete genome 50723-50747 5 0.8
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 NC_049350 Vibrio phage VCO139, complete genome 50483-50507 5 0.8
CP036356_6 6.2|2744713|25|CP036356|CRISPRCasFinder 2744713-2744737 25 NC_021540 Vibrio phage JA-1, complete genome 50790-50814 5 0.8
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 6 0.778
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 6 0.778
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 6 0.778
CP036356_2 2.19|429976|27|CP036356|CRT 429976-430002 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 6 0.778
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 6 0.778
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 6 0.778
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 6 0.778
CP036356_2 2.25|430219|27|CP036356|CRT 430219-430245 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 6 0.778
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 6 0.778
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 6 0.778
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 6 0.778
CP036356_2 2.31|430471|27|CP036356|CRT 430471-430497 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 6 0.778
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 MT776810 Gordonia phage BigChungus, complete genome 22339-22365 6 0.778
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 MN284906 Gordonia phage CherryonLim, complete genome 24076-24102 6 0.778
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 MK967385 Gordonia phage SheckWes, complete genome 22302-22328 6 0.778
CP036356_2 2.34|430597|27|CP036356|CRT 430597-430623 27 MT776808 Gordonia phage Feastonyeet, complete genome 22339-22365 6 0.778
CP036356_2 2.40|430849|27|CP036356|CRT 430849-430875 27 MH576968 Streptomyces phage Wofford, complete genome 74327-74353 6 0.778
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 KY705251 Streptococcus phage P0091, complete genome 17095-17121 6 0.778
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20008-20034 6 0.778
CP036356_2 2.41|430894|27|CP036356|CRT 430894-430920 27 MH937499 Streptococcus phage CHPC1062, complete genome 17279-17305 6 0.778
CP036356_2 2.42|430939|27|CP036356|CRT 430939-430965 27 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 134821-134847 6 0.778
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 KY705251 Streptococcus phage P0091, complete genome 17095-17121 6 0.778
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MG708274 Streptococcus phage vB_SthS_VA214, complete genome 20008-20034 6 0.778
CP036356_2 2.43|430984|27|CP036356|CRT 430984-431010 27 MH937499 Streptococcus phage CHPC1062, complete genome 17279-17305 6 0.778
CP036356_2 2.44|431029|27|CP036356|CRT 431029-431055 27 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 134821-134847 6 0.778

1. spacer 2.23|430138|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 2, identity: 0.926

tgccactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** ***************.********

2. spacer 2.29|430390|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 2, identity: 0.926

tgccactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** ***************.********

3. spacer 2.32|430516|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 2, identity: 0.926

tgccactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** ***************.********

4. spacer 2.19|429976|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

5. spacer 2.25|430219|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

6. spacer 2.31|430471|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

7. spacer 2.34|430597|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

8. spacer 2.41|430894|27|CP036356|CRT matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ggctaccggccctcaaggtattcaagg	Protospacer
 ******** *********.*******

9. spacer 2.42|430939|27|CP036356|CRT matches to MN693226 (Marine virus AFVG_25M419, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
agctaccggccctcaaggtcctcaagg	Protospacer
 ******** ********* *******

10. spacer 2.43|430984|27|CP036356|CRT matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ggctaccggccctcaaggtattcaagg	Protospacer
 ******** *********.*******

11. spacer 2.44|431029|27|CP036356|CRT matches to MN693226 (Marine virus AFVG_25M419, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
agctaccggccctcaaggtcctcaagg	Protospacer
 ******** ********* *******

12. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to KT264760 (Gokushovirus WZ-2015a isolate 12Fra21, complete genome) position: , mismatch: 3, identity: 0.88

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
ggtaaaggaggaagttaaagaatga	Protospacer
******.******** ******* *

13. spacer 2.6|429472|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

cgctaccggtgccactggacctcgagg	CRISPR spacer
cgctaccggtgctactggacctaccgg	Protospacer
************.*********   **

14. spacer 2.8|429553|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

cgctaccggtgccactggacctcgagg	CRISPR spacer
cgctaccggtgctactggacctaccgg	Protospacer
************.*********   **

15. spacer 2.12|429706|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

cgctaccggtgccactggacctcgagg	CRISPR spacer
cgctaccggtgctactggacctaccgg	Protospacer
************.*********   **

16. spacer 2.18|429931|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

17. spacer 2.18|429931|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

18. spacer 2.18|429931|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

19. spacer 2.18|429931|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

20. spacer 2.18|429931|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

21. spacer 2.19|429976|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

22. spacer 2.19|429976|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

23. spacer 2.19|429976|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

24. spacer 2.19|429976|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

25. spacer 2.20|430021|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

26. spacer 2.20|430021|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

27. spacer 2.20|430021|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

28. spacer 2.20|430021|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

29. spacer 2.20|430021|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

30. spacer 2.23|430138|27|CP036356|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tcccactggacttcagggcattctcgg	Protospacer
* *********.***********  **

31. spacer 2.23|430138|27|CP036356|CRT matches to NC_024210 (Escherichia phage e4/1c, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tgataccggaccgcagggcattcaagg	Protospacer
** .**.***** **************

32. spacer 2.25|430219|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

33. spacer 2.25|430219|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

34. spacer 2.25|430219|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

35. spacer 2.25|430219|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

36. spacer 2.26|430264|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

37. spacer 2.26|430264|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

38. spacer 2.26|430264|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

39. spacer 2.26|430264|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

40. spacer 2.26|430264|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

41. spacer 2.27|430309|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

42. spacer 2.27|430309|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

43. spacer 2.27|430309|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

44. spacer 2.27|430309|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.852

----cgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    ****    *******************

45. spacer 2.27|430309|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
** .***** ******** ********

46. spacer 2.27|430309|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
** .***** ******** ********

47. spacer 2.29|430390|27|CP036356|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tcccactggacttcagggcattctcgg	Protospacer
* *********.***********  **

48. spacer 2.29|430390|27|CP036356|CRT matches to NC_024210 (Escherichia phage e4/1c, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tgataccggaccgcagggcattcaagg	Protospacer
** .**.***** **************

49. spacer 2.31|430471|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

50. spacer 2.31|430471|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

51. spacer 2.31|430471|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

52. spacer 2.31|430471|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

53. spacer 2.32|430516|27|CP036356|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tcccactggacttcagggcattctcgg	Protospacer
* *********.***********  **

54. spacer 2.32|430516|27|CP036356|CRT matches to NC_024210 (Escherichia phage e4/1c, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tgataccggaccgcagggcattcaagg	Protospacer
** .**.***** **************

55. spacer 2.34|430597|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

56. spacer 2.34|430597|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

57. spacer 2.34|430597|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

58. spacer 2.34|430597|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

59. spacer 2.35|430642|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

60. spacer 2.35|430642|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

61. spacer 2.35|430642|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

62. spacer 2.35|430642|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

63. spacer 2.35|430642|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

64. spacer 2.36|430687|27|CP036356|CRT matches to FR682616 (Roseovarius sp. 217 phage 1 partial genome sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

65. spacer 2.36|430687|27|CP036356|CRT matches to FR719956 (Roseovarius Plymouth Podovirus 1 partial sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

66. spacer 2.38|430768|27|CP036356|CRT matches to FR682616 (Roseovarius sp. 217 phage 1 partial genome sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

67. spacer 2.38|430768|27|CP036356|CRT matches to FR719956 (Roseovarius Plymouth Podovirus 1 partial sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

68. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * ************** ********

69. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * ************** ********

70. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * ************** ********

71. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
acctactggaccccaaggagttcaagg	Protospacer
  **********.***** ********

72. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
acctactggaccccaaggagttcaagg	Protospacer
  **********.***** ********

73. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
acctactggaccccaaggagttcaagg	Protospacer
  **********.***** ********

74. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * ************** ********

75. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * ************** ********

76. spacer 2.40|430849|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

77. spacer 2.40|430849|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

78. spacer 2.40|430849|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

79. spacer 2.40|430849|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

80. spacer 2.41|430894|27|CP036356|CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgaccccggacctcagggtgttcaagg	Protospacer
** . **********.***********

81. spacer 2.41|430894|27|CP036356|CRT matches to MN855617 (Myoviridae sp. isolate 527, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agataccggaccgcaaggtattcaagg	Protospacer
 * ********* ******.*******

82. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tccaaccggacctcaaggaattcaagg	Protospacer
* * ************** .*******

83. spacer 2.42|430939|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
******.***************   **

84. spacer 2.43|430984|27|CP036356|CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgaccccggacctcagggtgttcaagg	Protospacer
** . **********.***********

85. spacer 2.43|430984|27|CP036356|CRT matches to MN855617 (Myoviridae sp. isolate 527, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agataccggaccgcaaggtattcaagg	Protospacer
 * ********* ******.*******

86. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tccaaccggacctcaaggaattcaagg	Protospacer
* * ************** .*******

87. spacer 2.44|431029|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
******.***************   **

88. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
tataaaagaggaagtaaaagaagaa	Protospacer
 .********************  *

89. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NZ_CP040346 (Bacillus albus strain DLOU-Yingkou plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
ggatctagaggaagtaaaagaatca	Protospacer
**    *******************

90. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtaatagaggaagtaaaagaagaa	Protospacer
.**** ****************  *

91. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to KC430106 (Bacillus phage BPS10C, complete genome) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtagaagaggaagtaaaagaagaa	Protospacer
.***.*****************  *

92. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to AP013516 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtaaaagaagaagtaaaagaagaa	Protospacer
.********.************  *

93. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to AP013516 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtaaaagaagaagtaaaagaagaa	Protospacer
.********.************  *

94. spacer 2.6|429472|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctaccggtgccactggacctcgagg	CRISPR spacer
tgctaccggtgctactggacctaccgg	Protospacer
.***********.*********   **

95. spacer 2.8|429553|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctaccggtgccactggacctcgagg	CRISPR spacer
tgctaccggtgctactggacctaccgg	Protospacer
.***********.*********   **

96. spacer 2.12|429706|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctaccggtgccactggacctcgagg	CRISPR spacer
tgctaccggtgctactggacctaccgg	Protospacer
.***********.*********   **

97. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

98. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

99. spacer 2.18|429931|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

100. spacer 2.18|429931|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

101. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

102. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

103. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

104. spacer 2.18|429931|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

105. spacer 2.18|429931|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

106. spacer 2.18|429931|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

107. spacer 2.18|429931|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

108. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

109. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

110. spacer 2.18|429931|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

111. spacer 2.18|429931|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

112. spacer 2.18|429931|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

113. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

114. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

115. spacer 2.20|430021|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

116. spacer 2.20|430021|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

117. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

118. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

119. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

120. spacer 2.20|430021|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

121. spacer 2.20|430021|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

122. spacer 2.20|430021|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

123. spacer 2.20|430021|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

124. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

125. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

126. spacer 2.20|430021|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

127. spacer 2.20|430021|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

128. spacer 2.20|430021|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

129. spacer 2.23|430138|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

130. spacer 2.23|430138|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

131. spacer 2.23|430138|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. ***.**************.*****

132. spacer 2.23|430138|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

133. spacer 2.23|430138|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

134. spacer 2.23|430138|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

135. spacer 2.23|430138|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

136. spacer 2.23|430138|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

137. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

138. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

139. spacer 2.26|430264|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

140. spacer 2.26|430264|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

141. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

142. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

143. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

144. spacer 2.26|430264|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

145. spacer 2.26|430264|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

146. spacer 2.26|430264|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

147. spacer 2.26|430264|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

148. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

149. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

150. spacer 2.26|430264|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

151. spacer 2.26|430264|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

152. spacer 2.26|430264|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

153. spacer 2.27|430309|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
.. .**************.********

154. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

155. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

156. spacer 2.27|430309|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

157. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

158. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

159. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

160. spacer 2.27|430309|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

161. spacer 2.27|430309|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

162. spacer 2.27|430309|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

163. spacer 2.27|430309|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

164. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

165. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

166. spacer 2.27|430309|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
.* .***** ******** ********

167. spacer 2.27|430309|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

168. spacer 2.29|430390|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

169. spacer 2.29|430390|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

170. spacer 2.29|430390|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. ***.**************.*****

171. spacer 2.29|430390|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

172. spacer 2.29|430390|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

173. spacer 2.29|430390|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

174. spacer 2.29|430390|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

175. spacer 2.29|430390|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

176. spacer 2.32|430516|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

177. spacer 2.32|430516|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

178. spacer 2.32|430516|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. ***.**************.*****

179. spacer 2.32|430516|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

180. spacer 2.32|430516|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

181. spacer 2.32|430516|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

182. spacer 2.32|430516|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

183. spacer 2.32|430516|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

184. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

185. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

186. spacer 2.35|430642|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

187. spacer 2.35|430642|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

188. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

189. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

190. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

191. spacer 2.35|430642|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

192. spacer 2.35|430642|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

193. spacer 2.35|430642|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

194. spacer 2.35|430642|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

195. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

196. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

197. spacer 2.35|430642|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

198. spacer 2.35|430642|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

199. spacer 2.35|430642|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

200. spacer 2.36|430687|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
******. ****************.  

201. spacer 2.36|430687|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
.* .***************..******

202. spacer 2.36|430687|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
.**************.******   **

203. spacer 2.36|430687|27|CP036356|CRT matches to NC_022968 (Enterobacteria phage 4MG, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
accaactggacctcagggtccacaagg	Protospacer
  * *************** * *****

204. spacer 2.38|430768|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
******. ****************.  

205. spacer 2.38|430768|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
.* .***************..******

206. spacer 2.38|430768|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
.**************.******   **

207. spacer 2.38|430768|27|CP036356|CRT matches to NC_022968 (Enterobacteria phage 4MG, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
accaactggacctcagggtccacaagg	Protospacer
  * *************** * *****

208. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggaccccaaggagttcaagg	Protospacer
  * ********.***** ********

209. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggaccccaaggagttcaagg	Protospacer
  * ********.***** ********

210. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggaccccaaggagttcaagg	Protospacer
  * ********.***** ********

211. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

212. spacer 2.40|430849|27|CP036356|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  *********************

213. spacer 2.40|430849|27|CP036356|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  *********************

214. spacer 2.40|430849|27|CP036356|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  *********************

215. spacer 2.40|430849|27|CP036356|CRT matches to MT354570 (Pseudomonas phage phiB1_1, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agggcctggacctcaaggtgtacaagg	Protospacer
 *   **************** *****

216. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

217. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accgacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

218. spacer 2.40|430849|27|CP036356|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
tgagactggacctcaaggtatacaagg	Protospacer
.*  ***************.* *****

219. spacer 2.40|430849|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
.* .***********.***.*******

220. spacer 2.40|430849|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
.*******************.*   **

221. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggatctcaaggagttcaagg	Protospacer
  * ******.******* ********

222. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

223. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accgacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

224. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

225. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

226. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

227. spacer 2.41|430894|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

228. spacer 2.41|430894|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

229. spacer 2.41|430894|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

230. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP040335 (Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggacttcaaggtattcaagg	Protospacer
  * *******.*******.*******

231. spacer 2.41|430894|27|CP036356|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ccccaccggaccccaaggtgtgcaagg	Protospacer
. *.********.******** *****

232. spacer 2.41|430894|27|CP036356|CRT matches to MH622922 (Microviridae sp. isolate ctce123, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
acccatcggaccacaaggtgttcaagg	Protospacer
  *.*.****** **************

233. spacer 2.41|430894|27|CP036356|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agagaccggacctcaaggtatacaagg	Protospacer
 *  ***************.* *****

234. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggatctcaaggagttcaagg	Protospacer
  * ******.******* ********

235. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

236. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accgacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

237. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

238. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

239. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

240. spacer 2.43|430984|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

241. spacer 2.43|430984|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

242. spacer 2.43|430984|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

243. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP040335 (Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggacttcaaggtattcaagg	Protospacer
  * *******.*******.*******

244. spacer 2.43|430984|27|CP036356|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ccccaccggaccccaaggtgtgcaagg	Protospacer
. *.********.******** *****

245. spacer 2.43|430984|27|CP036356|CRT matches to MH622922 (Microviridae sp. isolate ctce123, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
acccatcggaccacaaggtgttcaagg	Protospacer
  *.*.****** **************

246. spacer 2.43|430984|27|CP036356|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agagaccggacctcaaggtatacaagg	Protospacer
 *  ***************.* *****

247. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NC_049380 (Vibrio phage JSF3, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.************** 

248. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to KP280062 (Vibrio phage phi 1, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.************** 

249. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NC_049350 (Vibrio phage VCO139, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.************** 

250. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NC_021540 (Vibrio phage JA-1, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.************** 

251. spacer 2.19|429976|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

252. spacer 2.19|429976|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

253. spacer 2.19|429976|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

254. spacer 2.19|429976|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

255. spacer 2.25|430219|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

256. spacer 2.25|430219|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

257. spacer 2.25|430219|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

258. spacer 2.25|430219|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

259. spacer 2.31|430471|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

260. spacer 2.31|430471|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

261. spacer 2.31|430471|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

262. spacer 2.31|430471|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

263. spacer 2.34|430597|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

264. spacer 2.34|430597|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

265. spacer 2.34|430597|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

266. spacer 2.34|430597|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

267. spacer 2.40|430849|27|CP036356|CRT matches to MH576968 (Streptomyces phage Wofford, complete genome) position: , mismatch: 6, identity: 0.778

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aatgactggacctcaaggtgtccaggg	Protospacer
 .. *****************.**.**

268. spacer 2.41|430894|27|CP036356|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

269. spacer 2.41|430894|27|CP036356|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

270. spacer 2.41|430894|27|CP036356|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

271. spacer 2.42|430939|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
.****** *******.********.  

272. spacer 2.43|430984|27|CP036356|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

273. spacer 2.43|430984|27|CP036356|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

274. spacer 2.43|430984|27|CP036356|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

275. spacer 2.44|431029|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
.****** *******.********.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage