Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035914 Synechococcus sp. WH 8101 chromosome, complete genome 1 crisprs cas3,WYL,csa3,DEDDh 0 1 3 0

Results visualization

1. CP035914
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035914_1 627904-627991 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035914_2 2.1|2061677|35|CP035914|CRT 2061677-2061711 35 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 765616-765650 9 0.743

1. spacer 2.1|2061677|35|CP035914|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.743

acatccaaggcggaactggtgatgacgtcttaaaa	CRISPR spacer
tcatcgaaggcggaactggcgatgacacgttcgag	Protospacer
 **** *************.******.. ** .*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 160153 : 165809 7 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 231801 : 239418 8 Acanthocystis_turfacea_Chlorella_virus(16.67%) NA NA
DBSCAN-SWA_3 2544314 : 2552708 8 Tupanvirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage