Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035797 Brucella melitensis strain B9 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 2 0
CP035798 Brucella melitensis strain B9 chromosome 2, complete sequence 0 crisprs csa3,cas3,DEDDh 0 0 0 0

Results visualization

1. CP035797
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035797_1 2067819-2067901 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035797_1 1.1|2067847|27|CP035797|CRISPRCasFinder 2067847-2067873 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|2067847|27|CP035797|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ataagatgcgcgcaaggaaagatctgt	CRISPR spacer
aacagatgctctcaaggaaagatctga	Protospacer
*  ****** * ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 157693 : 169605 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_2 240314 : 248653 11 Brucella_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage