Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033355 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-3, complete sequence 0 crisprs NA 0 0 0 0
CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 0 crisprs csa3 0 0 3 0
CP033354 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-2, complete sequence 0 crisprs NA 0 0 0 0
CP033356 Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome 2 crisprs PD-DExK,DEDDh,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DinG 0 23 11 0

Results visualization

1. CP033353
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 374 : 31620 27 Escherichia_phage(57.14%) transposase NA
DBSCAN-SWA_2 67619 : 109725 40 Escherichia_phage(46.67%) transposase NA
DBSCAN-SWA_3 198822 : 246900 58 Escherichia_phage(36.36%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033356
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033356_2 961059-962125 TypeI-E I-E
17 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033356_3 978666-979731 TypeI-E I-E
17 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033356_3 3.8|979122|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979122-979153 32 NZ_CP026270 Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence 39148-39179 1 0.969
CP033356_3 3.1|978695|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 978695-978726 32 CP051275 Salmonella phage SW-37, complete genome 23580-23611 2 0.938
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 MT374854 Yersinia phage vB_YpM_6, complete genome 10937-10968 3 0.906
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 MT374853 Yersinia phage vB_YpM_5, complete genome 12313-12344 3 0.906
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 AF083977 Bacteriophage Mu, complete genome 7597-7628 3 0.906
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 M64097 Bacteriophage Mu left end 7595-7626 3 0.906
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 NC_000929 Enterobacteria phage Mu, complete genome 7597-7628 3 0.906
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 MT374854 Yersinia phage vB_YpM_6, complete genome 10936-10968 4 0.879
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 MT374853 Yersinia phage vB_YpM_5, complete genome 12312-12344 4 0.879
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 AF083977 Bacteriophage Mu, complete genome 7596-7628 4 0.879
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 M64097 Bacteriophage Mu left end 7594-7626 4 0.879
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 NC_000929 Enterobacteria phage Mu, complete genome 7596-7628 4 0.879
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 NC_013594 Escherichia phage D108, complete genome 7557-7588 4 0.875
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 KP010268 Enterobacteria phage SfMu, complete genome 8083-8114 4 0.875
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 LR595867 Escherichia virus Mu_3F6 genome assembly, chromosome: 1 7716-7747 4 0.875
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 MT374852 Yersinia phage vB_YpM_3, complete genome 7747-7778 4 0.875
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 MT374856 Yersinia phage vB_YpM_23, complete genome 11649-11680 4 0.875
CP033356_2 2.17|961088|32|CP033356|CRISPRCasFinder,CRT 961088-961119 32 MT591577 Yersinia phage vB_YpM_Tongde, complete genome 29404-29435 4 0.875
CP033356_4 4.1|3571409|27|CP033356|CRISPRCasFinder 3571409-3571435 27 AP013473 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C82-MedDCM-OCT-S28-C40 22555-22581 4 0.852
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 MT591577 Yersinia phage vB_YpM_Tongde, complete genome 29404-29436 5 0.848
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 NC_013594 Escherichia phage D108, complete genome 7556-7588 5 0.848
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 KP010268 Enterobacteria phage SfMu, complete genome 8082-8114 5 0.848
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 LR595867 Escherichia virus Mu_3F6 genome assembly, chromosome: 1 7715-7747 5 0.848
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 MT374852 Yersinia phage vB_YpM_3, complete genome 7746-7778 5 0.848
CP033356_2 2.1|961087|33|CP033356|PILER-CR 961087-961119 33 MT374856 Yersinia phage vB_YpM_23, complete genome 11648-11680 5 0.848
CP033356_2 2.2|961148|33|CP033356|PILER-CR 961148-961180 33 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 119594-119626 5 0.848
CP033356_2 2.18|961149|32|CP033356|CRISPRCasFinder,CRT 961149-961180 32 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 119595-119626 5 0.844
CP033356_4 4.1|3571409|27|CP033356|CRISPRCasFinder 3571409-3571435 27 NC_019739 Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence 129810-129836 5 0.815
CP033356_4 4.1|3571409|27|CP033356|CRISPRCasFinder 3571409-3571435 27 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 1565-1591 5 0.815
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 CP053333 Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence 113183-113214 6 0.812
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 CP053333 Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence 120706-120737 6 0.812
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 68243-68274 6 0.812
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 68247-68278 6 0.812
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 68254-68285 6 0.812
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 68253-68284 6 0.812
CP033356_2 2.18|961149|32|CP033356|CRISPRCasFinder,CRT 961149-961180 32 NZ_CP011808 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence 305581-305612 7 0.781
CP033356_2 2.21|961332|32|CP033356|CRISPRCasFinder,CRT 961332-961363 32 MT162468 Synechococcus phage S-H25, complete genome 90729-90760 7 0.781
CP033356_2 2.26|961638|32|CP033356|CRISPRCasFinder,CRT 961638-961669 32 NZ_LR594663 Variovorax sp. RA8 plasmid 2 279825-279856 7 0.781
CP033356_3 3.15|979549|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979549-979580 32 NZ_CP023073 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666d, complete sequence 24323-24354 7 0.781
CP033356_2 2.2|961148|33|CP033356|PILER-CR 961148-961180 33 NZ_CP011808 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence 305580-305612 8 0.758
CP033356_2 2.23|961454|32|CP033356|CRISPRCasFinder,CRT 961454-961485 32 MN693323 Marine virus AFVG_25M87, complete genome 37357-37388 8 0.75
CP033356_2 2.26|961638|32|CP033356|CRISPRCasFinder,CRT 961638-961669 32 MT108725 Pseudomonas phage Epa5, complete genome 54783-54814 8 0.75
CP033356_2 2.28|961760|32|CP033356|CRISPRCasFinder,CRT 961760-961791 32 NZ_CP049914 Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence 234396-234427 8 0.75
CP033356_2 2.28|961760|32|CP033356|CRISPRCasFinder,CRT 961760-961791 32 NC_018688 Bacillus thuringiensis MC28 plasmid pMC319, complete sequence 85616-85647 8 0.75
CP033356_3 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979061-979092 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1326101-1326132 8 0.75
CP033356_3 3.10|979244|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979244-979275 32 MN908689 Arthrobacter phage DrSierra, complete genome 14906-14937 8 0.75
CP033356_3 3.16|979610|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979610-979641 32 NZ_CP026096 Bacillus asahii strain OM18 plasmid pOM18, complete sequence 34073-34104 8 0.75
CP033356_2 2.12|961759|33|CP033356|PILER-CR 961759-961791 33 NZ_CP049914 Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence 234396-234428 9 0.727
CP033356_2 2.12|961759|33|CP033356|PILER-CR 961759-961791 33 NC_018688 Bacillus thuringiensis MC28 plasmid pMC319, complete sequence 85616-85648 9 0.727
CP033356_2 2.18|961149|32|CP033356|CRISPRCasFinder,CRT 961149-961180 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 345226-345257 9 0.719
CP033356_2 2.18|961149|32|CP033356|CRISPRCasFinder,CRT 961149-961180 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 476514-476545 9 0.719
CP033356_2 2.19|961210|32|CP033356|CRISPRCasFinder,CRT 961210-961241 32 JN672684 Enterobacteria phage F20, partial genome 14629-14660 9 0.719
CP033356_2 2.25|961577|32|CP033356|CRISPRCasFinder,CRT 961577-961608 32 KM507819 Escherichia phage 121Q, complete genome 157385-157416 9 0.719
CP033356_2 2.26|961638|32|CP033356|CRISPRCasFinder,CRT 961638-961669 32 NZ_CP038392 Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-4, complete sequence 49-80 9 0.719
CP033356_2 2.26|961638|32|CP033356|CRISPRCasFinder,CRT 961638-961669 32 NZ_CP027439 Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence 13856-13887 9 0.719
CP033356_2 2.26|961638|32|CP033356|CRISPRCasFinder,CRT 961638-961669 32 MT108731 Pseudomonas phage Epa43, complete genome 17620-17651 9 0.719
CP033356_3 3.6|979000|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979000-979031 32 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 203266-203297 9 0.719
CP033356_3 3.11|979305|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979305-979336 32 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 247366-247397 9 0.719
CP033356_2 2.25|961577|32|CP033356|CRISPRCasFinder,CRT 961577-961608 32 NC_028822 Escherichia phage P483, complete genome 30079-30110 10 0.688
CP033356_2 2.30|961882|32|CP033356|CRISPRCasFinder,CRT 961882-961913 32 NZ_CP046164 Vibrio sp. THAF191c plasmid pTHAF191c_c, complete sequence 362233-362264 10 0.688
CP033356_2 2.30|961882|32|CP033356|CRISPRCasFinder,CRT 961882-961913 32 NZ_CP046067 Vibrio sp. THAF191d plasmid pTHAF191d_c, complete sequence 110732-110763 10 0.688
CP033356_2 2.30|961882|32|CP033356|CRISPRCasFinder,CRT 961882-961913 32 NZ_CP009266 Vibrio coralliilyticus strain OCN014 plasmid pOCN014, complete sequence 36435-36466 10 0.688
CP033356_2 2.30|961882|32|CP033356|CRISPRCasFinder,CRT 961882-961913 32 NZ_CP045357 Vibrio sp. THAF64 plasmid pTHAF64_b, complete sequence 217923-217954 10 0.688
CP033356_2 2.30|961882|32|CP033356|CRISPRCasFinder,CRT 961882-961913 32 MN693596 Marine virus AFVG_25M324, complete genome 45600-45631 10 0.688
CP033356_3 3.12|979366|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979366-979397 32 NZ_CP030922 Escherichia coli strain KL53 plasmid pKL53-S, complete sequence 29059-29090 11 0.656
CP033356_3 3.12|979366|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979366-979397 32 NZ_CP042584 Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence 20787-20818 11 0.656
CP033356_3 3.14|979488|32|CP033356|PILER-CR,CRISPRCasFinder,CRT 979488-979519 32 NZ_CP051164 Geobacillus subterraneus strain CPW16 plasmid pBsrF30, complete sequence 7333-7364 11 0.656

1. spacer 3.8|979122|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026270 (Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

agtgtccacactgcggcgctgaaaaatgcaac	CRISPR spacer
agtgtccgcactgcggcgctgaaaaatgcaac	Protospacer
*******.************************

2. spacer 3.1|978695|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 2, identity: 0.938

agcacacattgtgtgacggtcgccgtctggtt	CRISPR spacer
aacacacattgtgcgacggtcgccgtctggtt	Protospacer
*.***********.******************

3. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to MT374854 (Yersinia phage vB_YpM_6, complete genome) position: , mismatch: 3, identity: 0.906

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgtaaccactgcgatatgggcgatgacacggc	Protospacer
*****************************.. 

4. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to MT374853 (Yersinia phage vB_YpM_5, complete genome) position: , mismatch: 3, identity: 0.906

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgtaaccactgcgatatgggcgatgacacggc	Protospacer
*****************************.. 

5. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to AF083977 (Bacteriophage Mu, complete genome) position: , mismatch: 3, identity: 0.906

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacagc	Protospacer
**.***************************. 

6. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to M64097 (Bacteriophage Mu left end) position: , mismatch: 3, identity: 0.906

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacagc	Protospacer
**.***************************. 

7. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to NC_000929 (Enterobacteria phage Mu, complete genome) position: , mismatch: 3, identity: 0.906

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacagc	Protospacer
**.***************************. 

8. spacer 2.1|961087|33|CP033356|PILER-CR matches to MT374854 (Yersinia phage vB_YpM_6, complete genome) position: , mismatch: 4, identity: 0.879

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgtaaccactgcgatatgggcgatgacacggc	Protospacer
.*****************************.. 

9. spacer 2.1|961087|33|CP033356|PILER-CR matches to MT374853 (Yersinia phage vB_YpM_5, complete genome) position: , mismatch: 4, identity: 0.879

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgtaaccactgcgatatgggcgatgacacggc	Protospacer
.*****************************.. 

10. spacer 2.1|961087|33|CP033356|PILER-CR matches to AF083977 (Bacteriophage Mu, complete genome) position: , mismatch: 4, identity: 0.879

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacagc	Protospacer
.**.***************************. 

11. spacer 2.1|961087|33|CP033356|PILER-CR matches to M64097 (Bacteriophage Mu left end) position: , mismatch: 4, identity: 0.879

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacagc	Protospacer
.**.***************************. 

12. spacer 2.1|961087|33|CP033356|PILER-CR matches to NC_000929 (Enterobacteria phage Mu, complete genome) position: , mismatch: 4, identity: 0.879

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacagc	Protospacer
.**.***************************. 

13. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to NC_013594 (Escherichia phage D108, complete genome) position: , mismatch: 4, identity: 0.875

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacggc	Protospacer
**.**************************.. 

14. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to KP010268 (Enterobacteria phage SfMu, complete genome) position: , mismatch: 4, identity: 0.875

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacggc	Protospacer
**.**************************.. 

15. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to LR595867 (Escherichia virus Mu_3F6 genome assembly, chromosome: 1) position: , mismatch: 4, identity: 0.875

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacggc	Protospacer
**.**************************.. 

16. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 4, identity: 0.875

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacggc	Protospacer
**.**************************.. 

17. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to MT374856 (Yersinia phage vB_YpM_23, complete genome) position: , mismatch: 4, identity: 0.875

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacggc	Protospacer
**.**************************.. 

18. spacer 2.17|961088|32|CP033356|CRISPRCasFinder,CRT matches to MT591577 (Yersinia phage vB_YpM_Tongde, complete genome) position: , mismatch: 4, identity: 0.875

tgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
tgcaaccactgcgatatgggcgatgacacggc	Protospacer
**.**************************.. 

19. spacer 4.1|3571409|27|CP033356|CRISPRCasFinder matches to AP013473 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C82-MedDCM-OCT-S28-C40) position: , mismatch: 4, identity: 0.852

ctccgcctccgcaggcattgatatagc	CRISPR spacer
ctctgcatccgcaggcattgatataag	Protospacer
***.** ******************. 

20. spacer 2.1|961087|33|CP033356|PILER-CR matches to MT591577 (Yersinia phage vB_YpM_Tongde, complete genome) position: , mismatch: 5, identity: 0.848

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacggc	Protospacer
.**.**************************.. 

21. spacer 2.1|961087|33|CP033356|PILER-CR matches to NC_013594 (Escherichia phage D108, complete genome) position: , mismatch: 5, identity: 0.848

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacggc	Protospacer
.**.**************************.. 

22. spacer 2.1|961087|33|CP033356|PILER-CR matches to KP010268 (Enterobacteria phage SfMu, complete genome) position: , mismatch: 5, identity: 0.848

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacggc	Protospacer
.**.**************************.. 

23. spacer 2.1|961087|33|CP033356|PILER-CR matches to LR595867 (Escherichia virus Mu_3F6 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.848

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacggc	Protospacer
.**.**************************.. 

24. spacer 2.1|961087|33|CP033356|PILER-CR matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 5, identity: 0.848

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacggc	Protospacer
.**.**************************.. 

25. spacer 2.1|961087|33|CP033356|PILER-CR matches to MT374856 (Yersinia phage vB_YpM_23, complete genome) position: , mismatch: 5, identity: 0.848

gtgtaaccactgcgatatgggcgatgacacaaa	CRISPR spacer
atgcaaccactgcgatatgggcgatgacacggc	Protospacer
.**.**************************.. 

26. spacer 2.2|961148|33|CP033356|PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.848

gcgggaagcgcagcagaacgcccggtcgcagcg-	CRISPR spacer
gcgcgaaccgcagcagaacgcccgg-cgcttcgg	Protospacer
*** *** ***************** ***  ** 

27. spacer 2.18|961149|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

cgggaagcgcagcagaacgcccggtcgcagcg-	CRISPR spacer
cgcgaaccgcagcagaacgcccgg-cgcttcgg	Protospacer
** *** ***************** ***  ** 

28. spacer 4.1|3571409|27|CP033356|CRISPRCasFinder matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 5, identity: 0.815

ctccgcctccgcaggcattgatatagc	CRISPR spacer
agccgccgccgcaggcattgatattgg	Protospacer
  ***** **************** * 

29. spacer 4.1|3571409|27|CP033356|CRISPRCasFinder matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.815

ctccgcctccgcaggcattgatatagc	CRISPR spacer
ctccacctccgcaggcattggtactac	Protospacer
****.***************.**. .*

30. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to CP053333 (Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcgtca--ggaacgtttctggggtggcctga	CRISPR spacer
--tgcggcaatggaacggttctggggtagcctga	Protospacer
  .*** **  ****** *********.******

31. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to CP053333 (Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcgtca--ggaacgtttctggggtggcctga	CRISPR spacer
--tgcggcaatggaacggttctggggtagcctga	Protospacer
  .*** **  ****** *********.******

32. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcgtca--ggaacgtttctggggtggcctga	CRISPR spacer
--tgcggcaatggaacggttctggggtagcctga	Protospacer
  .*** **  ****** *********.******

33. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcgtca--ggaacgtttctggggtggcctga	CRISPR spacer
--tgcggcaatggaacggttctggggtagcctga	Protospacer
  .*** **  ****** *********.******

34. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcgtca--ggaacgtttctggggtggcctga	CRISPR spacer
--tgcggcaatggaacggttctggggtagcctga	Protospacer
  .*** **  ****** *********.******

35. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcgtca--ggaacgtttctggggtggcctga	CRISPR spacer
--tgcggcaatggaacggttctggggtagcctga	Protospacer
  .*** **  ****** *********.******

36. spacer 2.18|961149|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 7, identity: 0.781

cgggaagcgcagcagaacgcccggtcgcagcg	CRISPR spacer
ttgtccgcgcagcagatcccccggtcgcagcg	Protospacer
. *   ********** * *************

37. spacer 2.21|961332|32|CP033356|CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 7, identity: 0.781

acgatccagatatttggctggatgcaatcggt-	CRISPR spacer
ccgatccagatattatgctggatg-gattgtta	Protospacer
 *************  ******** .**.* * 

38. spacer 2.26|961638|32|CP033356|CRISPRCasFinder,CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 7, identity: 0.781

ccgttgatcagaacggcaacgaacgcacgtac	CRISPR spacer
acgtggtggagatcggcaacgaacgcaagtac	Protospacer
 *** *   *** ************** ****

39. spacer 3.15|979549|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023073 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666d, complete sequence) position: , mismatch: 7, identity: 0.781

tttgaaatcgctattcttattgctgtagcagt	CRISPR spacer
ttcgccgtcgctgtttttattgctgtagcact	Protospacer
**.*  .*****.**.************** *

40. spacer 2.2|961148|33|CP033356|PILER-CR matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 8, identity: 0.758

gcgggaagcgcagcagaacgcccggtcgcagcg	CRISPR spacer
attgtccgcgcagcagatcccccggtcgcagcg	Protospacer
.. *   ********** * *************

41. spacer 2.23|961454|32|CP033356|CRISPRCasFinder,CRT matches to MN693323 (Marine virus AFVG_25M87, complete genome) position: , mismatch: 8, identity: 0.75

gcttttatgtctggtggatataacgcactgaa	CRISPR spacer
gctcttatggctggtggatataatggatcaac	Protospacer
***.***** *************.* *...* 

42. spacer 2.26|961638|32|CP033356|CRISPRCasFinder,CRT matches to MT108725 (Pseudomonas phage Epa5, complete genome) position: , mismatch: 8, identity: 0.75

ccgttgatcagaacggcaacgaacgcacgtac	CRISPR spacer
acgtcgatcggaacggcaacgaactgaccttg	Protospacer
 ***.****.**************  ** *  

43. spacer 2.28|961760|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

----ccatttttgatcatctcctccagcctgctgag	CRISPR spacer
ggtaaca----cgatcgtctcttccagcctgctgag	Protospacer
     **    .****.****.**************

44. spacer 2.28|961760|32|CP033356|CRISPRCasFinder,CRT matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 8, identity: 0.75

ccatttttgatcatctcctccagcctgctgag	CRISPR spacer
taatttttgttcatctcttccagccttatcat	Protospacer
. ******* *******.********  * * 

45. spacer 3.7|979061|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75

agcgcgtcaggaacgtttctggggtggcctga	CRISPR spacer
cgcgcgtcaggatcgttcctggggctgggcga	Protospacer
 *********** ****.******. *  .**

46. spacer 3.10|979244|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to MN908689 (Arthrobacter phage DrSierra, complete genome) position: , mismatch: 8, identity: 0.75

---ttcggagtccggatcatcattcaggataacga	CRISPR spacer
gagctc---gtccggatcagcattcaggacaaccc	Protospacer
   .**   ********** *********.***  

47. spacer 3.16|979610|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026096 (Bacillus asahii strain OM18 plasmid pOM18, complete sequence) position: , mismatch: 8, identity: 0.75

cgttaa--ctaaaacgaacaaaacagggaaatca	CRISPR spacer
--ttgattctaaaacgaaaaaaacaggtaaactg	Protospacer
  **.*  ********** ******** ***...

48. spacer 2.12|961759|33|CP033356|PILER-CR matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

----gccatttttgatcatctcctccagcctgctgag	CRISPR spacer
cggtaaca----cgatcgtctcttccagcctgctgag	Protospacer
    . **    .****.****.**************

49. spacer 2.12|961759|33|CP033356|PILER-CR matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 9, identity: 0.727

gccatttttgatcatctcctccagcctgctgag	CRISPR spacer
ttaatttttgttcatctcttccagccttatcat	Protospacer
 . ******* *******.********  * * 

50. spacer 2.18|961149|32|CP033356|CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.719

cgggaagcgcagcagaacgcccggtcgcagcg	CRISPR spacer
cgggaagcccagcagcacgcccgaacaggcgg	Protospacer
******** ****** *******. *. .  *

51. spacer 2.18|961149|32|CP033356|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719

cgggaagcgcagcagaacgcccggtcgcagcg	CRISPR spacer
cgggaagcccagcagcacgcccgaacaggcgg	Protospacer
******** ****** *******. *. .  *

52. spacer 2.19|961210|32|CP033356|CRISPRCasFinder,CRT matches to JN672684 (Enterobacteria phage F20, partial genome) position: , mismatch: 9, identity: 0.719

atcaccggcacgcgcgataacgggtctgatta	CRISPR spacer
aagcaggtgacgcgggataacgggtatgatta	Protospacer
*     *  ***** ********** ******

53. spacer 2.25|961577|32|CP033356|CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 9, identity: 0.719

cgtatcccgaaatcacgttcaagaaaaatccg	CRISPR spacer
tgcactgagaaatcaagttcaagaaaaaaccc	Protospacer
.*.*..  ******* ************ ** 

54. spacer 2.26|961638|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP038392 (Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-4, complete sequence) position: , mismatch: 9, identity: 0.719

ccgttgatcagaacggcaacgaacgcacgtac	CRISPR spacer
tcgttgatcagaacgggaaggaactggcccgc	Protospacer
.*************** ** ****  .* ..*

55. spacer 2.26|961638|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP027439 (Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccgttgatcagaacggcaacgaacgcacgtac	CRISPR spacer
tcgttgatcagaacgggaaggaactggcccgc	Protospacer
.*************** ** ****  .* ..*

56. spacer 2.26|961638|32|CP033356|CRISPRCasFinder,CRT matches to MT108731 (Pseudomonas phage Epa43, complete genome) position: , mismatch: 9, identity: 0.719

ccgttgatcagaacggcaacgaacgcacgtac	CRISPR spacer
acgtcgatcggaacggcaacgaactgaccctg	Protospacer
 ***.****.**************  ** .  

57. spacer 3.6|979000|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 9, identity: 0.719

ggtgttactgatggtggggcgctggatgaggc	CRISPR spacer
aggatgcgcgagggtcgggcgctggatgaggc	Protospacer
.* .*   .** *** ****************

58. spacer 3.11|979305|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aaatcgcgcggcgatcgactcaaggcggcgac-	CRISPR spacer
gtggcgcgcggcgatcgcctcgaggc-gcgctg	Protospacer
. . ************* ***.**** *** . 

59. spacer 2.25|961577|32|CP033356|CRISPRCasFinder,CRT matches to NC_028822 (Escherichia phage P483, complete genome) position: , mismatch: 10, identity: 0.688

cgtatcccgaaatcacgttcaagaaaaatccg	CRISPR spacer
ccatcatggaaatcacattcaagacaaatcca	Protospacer
*   . . ********.******* ******.

60. spacer 2.30|961882|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP046164 (Vibrio sp. THAF191c plasmid pTHAF191c_c, complete sequence) position: , mismatch: 10, identity: 0.688

gtcaaataaatatgagtgaagaagccaaagcc	CRISPR spacer
ccgtagccaatatcagtgaagatgccaaagct	Protospacer
 .  *.. ***** ******** ********.

61. spacer 2.30|961882|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP046067 (Vibrio sp. THAF191d plasmid pTHAF191d_c, complete sequence) position: , mismatch: 10, identity: 0.688

gtcaaataaatatgagtgaagaagccaaagcc	CRISPR spacer
ccgtagccaatatcagtgaagatgccaaagct	Protospacer
 .  *.. ***** ******** ********.

62. spacer 2.30|961882|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP009266 (Vibrio coralliilyticus strain OCN014 plasmid pOCN014, complete sequence) position: , mismatch: 10, identity: 0.688

gtcaaataaatatgagtgaagaagccaaagcc	CRISPR spacer
ccgtagccaatatcagtgaagatgccaaagct	Protospacer
 .  *.. ***** ******** ********.

63. spacer 2.30|961882|32|CP033356|CRISPRCasFinder,CRT matches to NZ_CP045357 (Vibrio sp. THAF64 plasmid pTHAF64_b, complete sequence) position: , mismatch: 10, identity: 0.688

gtcaaataaatatgagtgaagaagccaaagcc	CRISPR spacer
ccgtagccaatatcagtgaagatgccaaagct	Protospacer
 .  *.. ***** ******** ********.

64. spacer 2.30|961882|32|CP033356|CRISPRCasFinder,CRT matches to MN693596 (Marine virus AFVG_25M324, complete genome) position: , mismatch: 10, identity: 0.688

gtcaaataaatatgagtgaagaagccaaagcc	CRISPR spacer
taggagcaaaaatgagtgaagaagcaaaagag	Protospacer
   .*..*** ************** ****  

65. spacer 3.12|979366|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030922 (Escherichia coli strain KL53 plasmid pKL53-S, complete sequence) position: , mismatch: 11, identity: 0.656

aaaatcgtgagtgactatcgttctgttattgc	CRISPR spacer
ttgatcgtcagtgactatggttctgtctcaaa	Protospacer
  .***** ********* *******. . . 

66. spacer 3.12|979366|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042584 (Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence) position: , mismatch: 11, identity: 0.656

aaaatcgtgagtgactatcgttctgttattgc	CRISPR spacer
ttgatcgtcagtgactatggttctgtctcaaa	Protospacer
  .***** ********* *******. . . 

67. spacer 3.14|979488|32|CP033356|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051164 (Geobacillus subterraneus strain CPW16 plasmid pBsrF30, complete sequence) position: , mismatch: 11, identity: 0.656

tggccggggaaacaaggaaagtcctggttttt	CRISPR spacer
gatttagggaaacaaagaaagtcctgattaaa	Protospacer
 . ...*********.**********.**   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 647492 : 684133 46 Cronobacter_phage(71.05%) tRNA,capsid,portal,tail,terminase,head,holin,integrase attL 637361:637382|attR 686442:686463
DBSCAN-SWA_2 1180752 : 1242503 62 Cronobacter_phage(57.89%) tRNA,capsid,portal,tail,terminase,head,holin,integrase attL 1188729:1188744|attR 1216419:1216434
DBSCAN-SWA_3 1473793 : 1480641 7 Salmonella_virus(42.86%) transposase NA
DBSCAN-SWA_4 1712223 : 1721394 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_5 1800426 : 1810933 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_6 1921055 : 1932345 13 Burkholderia_phage(25.0%) integrase attL 1915309:1915324|attR 1929656:1929671
DBSCAN-SWA_7 2113096 : 2152415 31 Shigella_phage(28.57%) transposase,protease,integrase attL 2129533:2129549|attR 2144120:2144136
DBSCAN-SWA_8 2246584 : 2252396 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_9 2290343 : 2298947 9 Escherichia_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_10 2708122 : 2715585 8 Escherichia_phage(42.86%) transposase NA
DBSCAN-SWA_11 3543140 : 3586649 62 Escherichia_phage(40.82%) plate,terminase,lysis,integrase attL 3539674:3539719|attR 3582758:3582803
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage