Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033335 Streptococcus pyogenes strain TSPY208 chromosome, complete genome 2 crisprs DinG,csm6,cas3,DEDDh,csa3 2 4 7 1

Results visualization

1. CP033335
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033335_2 971152-971253 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033335_3 1247798-1247966 Orphan I-C
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033335_1 1.2|118311|21|CP033335|PILER-CR 118311-118331 21 CP033335.1 118362-118382 1 0.952
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 CP033335.1 989936-989959 2 0.917

1. spacer 1.2|118311|21|CP033335|PILER-CR matches to position: 118362-118382, mismatch: 1, identity: 0.952

tgcgcttcccccattaatgcc	CRISPR spacer
tgcgcttcctccattaatgcc	Protospacer
*********.***********

2. spacer 3.1|1247840|24|CP033335|PILER-CR matches to position: 989936-989959, mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448686 Streptococcus phage Javan157, complete genome 38639-38663 0 1.0
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448951 Streptococcus phage Javan470, complete genome 37164-37188 0 1.0
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448768 Streptococcus phage Javan47, complete genome 38205-38229 0 1.0
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448960 Streptococcus phage Javan492, complete genome 13696-13719 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448762 Streptococcus phage Javan447, complete genome 13823-13846 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 NC_004585 Streptococcus prophage 315.2, complete genome 16212-16235 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448965 Streptococcus phage Javan506, complete genome 15257-15280 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448966 Streptococcus phage Javan508, complete genome 16067-16090 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448970 Streptococcus phage Javan516, complete genome 17613-17636 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448959 Streptococcus phage Javan488, complete genome 15257-15280 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448945 Streptococcus phage Javan454, complete genome 15474-15497 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448772 Streptococcus phage Javan483, complete genome 16082-16105 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448962 Streptococcus phage Javan496, complete genome 6857-6880 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448949 Streptococcus phage Javan460, complete genome 15917-15940 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448793 Streptococcus phage Javan523, complete genome 14536-14559 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448676 Streptococcus phage Javan131, complete genome 19395-19418 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448954 Streptococcus phage Javan476, complete genome 13299-13322 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448957 Streptococcus phage Javan484, complete genome 17033-17056 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448673 Streptococcus phage Javan119, complete genome 15958-15981 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 JX409894 Streptococcus phage LYGO9, complete genome 32108-32131 1 0.958
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 JX409895 Streptococcus phage JX01, complete genome 926-949 1 0.958
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448852 Streptococcus phage Javan140, complete genome 37648-37672 1 0.96
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448858 Streptococcus phage Javan166, complete genome 43497-43521 1 0.96
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448690 Streptococcus phage Javan169, complete genome 40182-40206 1 0.96
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448694 Streptococcus phage Javan179, complete genome 38124-38148 1 0.96
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 JX409894 Streptococcus phage LYGO9, complete genome 32107-32141 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448960 Streptococcus phage Javan492, complete genome 13686-13720 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448762 Streptococcus phage Javan447, complete genome 13813-13847 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 NC_004585 Streptococcus prophage 315.2, complete genome 16202-16236 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448965 Streptococcus phage Javan506, complete genome 15247-15281 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 JX409895 Streptococcus phage JX01, complete genome 925-959 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448966 Streptococcus phage Javan508, complete genome 16057-16091 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448970 Streptococcus phage Javan516, complete genome 17603-17637 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448959 Streptococcus phage Javan488, complete genome 15247-15281 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448772 Streptococcus phage Javan483, complete genome 16072-16106 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448962 Streptococcus phage Javan496, complete genome 6847-6881 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448949 Streptococcus phage Javan460, complete genome 15907-15941 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448954 Streptococcus phage Javan476, complete genome 13289-13323 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448957 Streptococcus phage Javan484, complete genome 17023-17057 1 0.971
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448673 Streptococcus phage Javan119, complete genome 15948-15982 1 0.971
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448768 Streptococcus phage Javan47, complete genome 38195-38230 1 0.972
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448755 Streptococcus phage Javan423, complete genome 15144-15167 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448675 Streptococcus phage Javan129, complete genome 17126-17149 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448824 Streptococcus phage Javan637, complete genome 16093-16116 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448973 Streptococcus phage Javan522, complete genome 14916-14939 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448858 Streptococcus phage Javan166, complete genome 17346-17369 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK449010 Streptococcus phage Javan90, complete genome 13918-13941 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448798 Streptococcus phage Javan533, complete genome 14578-14601 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448775 Streptococcus phage Javan489, complete genome 14401-14424 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448681 Streptococcus phage Javan141, complete genome 12181-12204 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448794 Streptococcus phage Javan525, complete genome 12598-12621 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448955 Streptococcus phage Javan478, complete genome 15850-15873 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448795 Streptococcus phage Javan527, complete genome 20106-20129 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448791 Streptococcus phage Javan517, complete genome 12582-12605 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448756 Streptococcus phage Javan425, complete genome 15144-15167 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448953 Streptococcus phage Javan474, complete genome 17195-17218 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 NC_028700 Streptococcus phage T12, complete genome 14426-14449 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448790 Streptococcus phage Javan515, complete genome 14251-14274 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448944 Streptococcus phage Javan452, complete genome 14777-14800 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 NC_004587 Streptococcus prophage 315.4, complete genome 12677-12700 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448690 Streptococcus phage Javan169, complete genome 16024-16047 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 NC_003157 Streptococcus pyogenes strain NIH1 putative methionine sulfoxide reductase gene, complete cds; and integrated temperate phage PhiNIH1.1, complete genome 13947-13970 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448849 Streptococcus phage Javan128, complete genome 11531-11554 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448778 Streptococcus phage Javan493, complete genome 14458-14481 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448686 Streptococcus phage Javan157, complete genome 16104-16127 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448977 Streptococcus phage Javan530, complete genome 12582-12605 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK449002 Streptococcus phage Javan642, complete genome 16048-16071 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448850 Streptococcus phage Javan132, complete genome 16463-16486 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448783 Streptococcus phage Javan503, complete genome 13498-13521 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448967 Streptococcus phage Javan510, complete genome 14579-14602 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK449003 Streptococcus phage Javan648, complete genome 16048-16071 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448765 Streptococcus phage Javan459, complete genome 12597-12620 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448788 Streptococcus phage Javan511, complete genome 12582-12605 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448950 Streptococcus phage Javan464, complete genome 14472-14495 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448833 Streptococcus phage Javan87, complete genome 13918-13941 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448975 Streptococcus phage Javan526, complete genome 15276-15299 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448782 Streptococcus phage Javan501, complete genome 17562-17585 2 0.917
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 NC_004588 Streptococcus prophage 315.5, complete genome 14728-14751 2 0.917
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448675 Streptococcus phage Javan129, complete genome 41586-41610 2 0.92
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448862 Streptococcus phage Javan178, complete genome 35461-35485 2 0.92
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448679 Streptococcus phage Javan137, complete genome 35525-35549 2 0.92
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448793 Streptococcus phage Javan523, complete genome 14526-14560 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448676 Streptococcus phage Javan131, complete genome 19385-19419 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448675 Streptococcus phage Javan129, complete genome 17116-17150 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448824 Streptococcus phage Javan637, complete genome 16083-16117 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448973 Streptococcus phage Javan522, complete genome 14906-14940 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448858 Streptococcus phage Javan166, complete genome 17336-17370 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK449010 Streptococcus phage Javan90, complete genome 13908-13942 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448798 Streptococcus phage Javan533, complete genome 14568-14602 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448775 Streptococcus phage Javan489, complete genome 14391-14425 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448681 Streptococcus phage Javan141, complete genome 12171-12205 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448794 Streptococcus phage Javan525, complete genome 12588-12622 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448795 Streptococcus phage Javan527, complete genome 20096-20130 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448791 Streptococcus phage Javan517, complete genome 12572-12606 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448953 Streptococcus phage Javan474, complete genome 17185-17219 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 NC_028700 Streptococcus phage T12, complete genome 14416-14450 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448790 Streptococcus phage Javan515, complete genome 14241-14275 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448944 Streptococcus phage Javan452, complete genome 14767-14801 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 NC_004587 Streptococcus prophage 315.4, complete genome 12667-12701 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448690 Streptococcus phage Javan169, complete genome 16014-16048 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 NC_003157 Streptococcus pyogenes strain NIH1 putative methionine sulfoxide reductase gene, complete cds; and integrated temperate phage PhiNIH1.1, complete genome 13937-13971 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448849 Streptococcus phage Javan128, complete genome 11521-11555 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448778 Streptococcus phage Javan493, complete genome 14448-14482 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448686 Streptococcus phage Javan157, complete genome 16094-16128 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448977 Streptococcus phage Javan530, complete genome 12572-12606 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK449002 Streptococcus phage Javan642, complete genome 16038-16072 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448850 Streptococcus phage Javan132, complete genome 16453-16487 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448783 Streptococcus phage Javan503, complete genome 13488-13522 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448967 Streptococcus phage Javan510, complete genome 14569-14603 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK449003 Streptococcus phage Javan648, complete genome 16038-16072 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448765 Streptococcus phage Javan459, complete genome 12587-12621 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448788 Streptococcus phage Javan511, complete genome 12572-12606 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448950 Streptococcus phage Javan464, complete genome 14462-14496 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448833 Streptococcus phage Javan87, complete genome 13908-13942 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448975 Streptococcus phage Javan526, complete genome 15266-15300 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448782 Streptococcus phage Javan501, complete genome 17552-17586 2 0.943
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 NC_004588 Streptococcus prophage 315.5, complete genome 14718-14752 2 0.943
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448686 Streptococcus phage Javan157, complete genome 38629-38664 2 0.944
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448951 Streptococcus phage Javan470, complete genome 37154-37189 2 0.944
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448796 Streptococcus phage Javan53, complete genome 19092-19115 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448829 Streptococcus phage Javan7, complete genome 14200-14223 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448736 Streptococcus phage Javan35, complete genome 14668-14691 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448956 Streptococcus phage Javan48, complete genome 16263-16286 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448781 Streptococcus phage Javan5, complete genome 16690-16713 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MH853355 Streptococcus phage LF1, complete genome 5057-5080 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448938 Streptococcus phage Javan44, complete genome 14669-14692 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448859 Streptococcus phage Javan170, complete genome 16765-16788 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448911 Streptococcus phage Javan34, complete genome 14668-14691 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448837 Streptococcus phage Javan10, complete genome 12726-12749 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448742 Streptococcus phage Javan37, complete genome 14440-14463 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448854 Streptococcus phage Javan146, complete genome 16831-16854 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448694 Streptococcus phage Javan179, complete genome 15787-15810 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MH853358 Streptococcus phage LF4, complete genome 5057-5080 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448916 Streptococcus phage Javan36, complete genome 14668-14691 3 0.875
CP033335_3 3.1|1247840|24|CP033335|PILER-CR 1247840-1247863 24 MK448688 Streptococcus phage Javan161, complete genome 16718-16741 3 0.875
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448955 Streptococcus phage Javan478, complete genome 15840-15874 3 0.914
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448852 Streptococcus phage Javan140, complete genome 37638-37673 3 0.917
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448858 Streptococcus phage Javan166, complete genome 43487-43522 3 0.917
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448690 Streptococcus phage Javan169, complete genome 40172-40207 3 0.917
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448694 Streptococcus phage Javan179, complete genome 38114-38149 3 0.917
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448779 Streptococcus phage Javan497, complete genome 36904-36928 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448969 Streptococcus phage Javan514, complete genome 30757-30781 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448972 Streptococcus phage Javan520, complete genome 32692-32716 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448791 Streptococcus phage Javan517, complete genome 37481-37505 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448763 Streptococcus phage Javan451, complete genome 32536-32560 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448968 Streptococcus phage Javan512, complete genome 37012-37036 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 NC_004587 Streptococcus prophage 315.4, complete genome 37057-37081 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 NC_003157 Streptococcus pyogenes strain NIH1 putative methionine sulfoxide reductase gene, complete cds; and integrated temperate phage PhiNIH1.1, complete genome 38327-38351 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448774 Streptococcus phage Javan487, complete genome 30871-30895 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448773 Streptococcus phage Javan485, complete genome 33643-33667 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448977 Streptococcus phage Javan530, complete genome 36962-36986 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 NC_009819 Streptococcus phage P9, complete genome 37188-37212 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448797 Streptococcus phage Javan531, complete genome 37012-37036 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448788 Streptococcus phage Javan511, complete genome 36962-36986 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448954 Streptococcus phage Javan476, complete genome 37089-37113 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 MK448957 Streptococcus phage Javan484, complete genome 42483-42507 4 0.84
CP033335_3 3.2|1247906|25|CP033335|PILER-CR 1247906-1247930 25 NC_004589 Streptococcus prophage 315.6, complete genome 37109-37133 4 0.84
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448755 Streptococcus phage Javan423, complete genome 15134-15168 4 0.886
CP033335_3 3.3|1247833|35|CP033335|CRISPRCasFinder 1247833-1247867 35 MK448756 Streptococcus phage Javan425, complete genome 15134-15168 4 0.886
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448675 Streptococcus phage Javan129, complete genome 41576-41611 4 0.889
CP033335_3 3.4|1247899|36|CP033335|CRISPRCasFinder 1247899-1247934 36 MK448679 Streptococcus phage Javan137, complete genome 35515-35550 4 0.889

1. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 0, identity: 1.0

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaagcgagcggggc	Protospacer
*************************

2. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 0, identity: 1.0

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaagcgagcggggc	Protospacer
*************************

3. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaagcgagcggggc	Protospacer
*************************

4. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448960 (Streptococcus phage Javan492, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

5. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448762 (Streptococcus phage Javan447, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

6. spacer 3.1|1247840|24|CP033335|PILER-CR matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

7. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

8. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

9. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448970 (Streptococcus phage Javan516, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

10. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448959 (Streptococcus phage Javan488, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

11. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448945 (Streptococcus phage Javan454, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

12. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

13. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

14. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

15. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

16. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

17. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

18. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

19. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

20. spacer 3.1|1247840|24|CP033335|PILER-CR matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

21. spacer 3.1|1247840|24|CP033335|PILER-CR matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 1, identity: 0.958

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagttgg	Protospacer
**********.*************

22. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 1, identity: 0.96

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtgttaaagcgagcggggc	Protospacer
********.****************

23. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 1, identity: 0.96

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtgttaaagcgagcggggc	Protospacer
********.****************

24. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 1, identity: 0.96

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtgttaaagcgagcggggc	Protospacer
********.****************

25. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448694 (Streptococcus phage Javan179, complete genome) position: , mismatch: 1, identity: 0.96

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaagcgagcgggac	Protospacer
***********************.*

26. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

27. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448960 (Streptococcus phage Javan492, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

28. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448762 (Streptococcus phage Javan447, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

29. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

30. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

31. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

32. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

33. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448970 (Streptococcus phage Javan516, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

34. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448959 (Streptococcus phage Javan488, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

35. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

36. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

37. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

38. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

39. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

40. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 1, identity: 0.971

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaata	Protospacer
***********.***********************

41. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 1, identity: 0.972

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
gtcacgagtattaaagcgagcggggccacctacttg	Protospacer
***********************************.

42. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448755 (Streptococcus phage Javan423, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaaattgg	Protospacer
**********.********.****

43. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

44. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448824 (Streptococcus phage Javan637, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

45. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

46. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

47. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtaattaaagttgg	Protospacer
**********.**.**********

48. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448798 (Streptococcus phage Javan533, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

49. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

50. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448681 (Streptococcus phage Javan141, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

51. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448794 (Streptococcus phage Javan525, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

52. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

53. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

54. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448791 (Streptococcus phage Javan517, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

55. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448756 (Streptococcus phage Javan425, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaaattgg	Protospacer
**********.********.****

56. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448953 (Streptococcus phage Javan474, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

57. spacer 3.1|1247840|24|CP033335|PILER-CR matches to NC_028700 (Streptococcus phage T12, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

58. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

59. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

60. spacer 3.1|1247840|24|CP033335|PILER-CR matches to NC_004587 (Streptococcus prophage 315.4, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

61. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgaccgtagttaaagttgg	Protospacer
********.*.*************

62. spacer 3.1|1247840|24|CP033335|PILER-CR matches to NC_003157 (Streptococcus pyogenes strain NIH1 putative methionine sulfoxide reductase gene, complete cds; and integrated temperate phage PhiNIH1.1, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

63. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

64. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

65. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagctaaagttgg	Protospacer
**********.***.*********

66. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448977 (Streptococcus phage Javan530, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

67. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK449002 (Streptococcus phage Javan642, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

68. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

69. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448783 (Streptococcus phage Javan503, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

70. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448967 (Streptococcus phage Javan510, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

71. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK449003 (Streptococcus phage Javan648, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

72. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448765 (Streptococcus phage Javan459, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

73. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448788 (Streptococcus phage Javan511, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

74. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

75. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtaattaaagttgg	Protospacer
**********.**.**********

76. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

77. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

78. spacer 3.1|1247840|24|CP033335|PILER-CR matches to NC_004588 (Streptococcus prophage 315.5, complete genome) position: , mismatch: 2, identity: 0.917

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgattgtagttaaagttgg	Protospacer
*********..*************

79. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 2, identity: 0.92

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtgttaaaacgagcggggc	Protospacer
********.*****.**********

80. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448862 (Streptococcus phage Javan178, complete genome) position: , mismatch: 2, identity: 0.92

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaagcgtgcgggtc	Protospacer
***************** ***** *

81. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 2, identity: 0.92

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcgcgagtattaaaacgagcggggc	Protospacer
**.***********.**********

82. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaatg	Protospacer
***********.**********************.

83. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaagttggcgactaaatg	Protospacer
***********.**********************.

84. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

85. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448824 (Streptococcus phage Javan637, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

86. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

87. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

88. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtaattaaagttggcgactaaata	Protospacer
***********.**.********************

89. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448798 (Streptococcus phage Javan533, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

90. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

91. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448681 (Streptococcus phage Javan141, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

92. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448794 (Streptococcus phage Javan525, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

93. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

94. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448791 (Streptococcus phage Javan517, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

95. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448953 (Streptococcus phage Javan474, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

96. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to NC_028700 (Streptococcus phage T12, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

97. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

98. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

99. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to NC_004587 (Streptococcus prophage 315.4, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

100. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgaccgtagttaaagttggcgactaaata	Protospacer
*********.*.***********************

101. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to NC_003157 (Streptococcus pyogenes strain NIH1 putative methionine sulfoxide reductase gene, complete cds; and integrated temperate phage PhiNIH1.1, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

102. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

103. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

104. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagctaaagttggcgactaaata	Protospacer
***********.***.*******************

105. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448977 (Streptococcus phage Javan530, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

106. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK449002 (Streptococcus phage Javan642, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

107. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

108. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448783 (Streptococcus phage Javan503, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

109. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448967 (Streptococcus phage Javan510, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

110. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK449003 (Streptococcus phage Javan648, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

111. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448765 (Streptococcus phage Javan459, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

112. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448788 (Streptococcus phage Javan511, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

113. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

114. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtaattaaagttggcgactaaata	Protospacer
***********.**.********************

115. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

116. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

117. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to NC_004588 (Streptococcus prophage 315.5, complete genome) position: , mismatch: 2, identity: 0.943

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaata	Protospacer
**********..***********************

118. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 2, identity: 0.944

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
gtcacgagtattaaagcgagcggggccacctacctg	Protospacer
*********************************.*.

119. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 2, identity: 0.944

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
gtcacgagtattaaagcgagcggggccacctacctg	Protospacer
*********************************.*.

120. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

121. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

122. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

123. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

124. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

125. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

126. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

127. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

128. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

129. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

130. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

131. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

132. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448694 (Streptococcus phage Javan179, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatcgtagttaaagtcag	Protospacer
**********.**********..*

133. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

134. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

135. spacer 3.1|1247840|24|CP033335|PILER-CR matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 3, identity: 0.875

aagtttgatcatagttaaagttgg	CRISPR spacer
aagtttgatagtagttaaagttga	Protospacer
********* .************.

136. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 3, identity: 0.914

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgattgtagttaaagttggcgactaaatg	Protospacer
**********..**********************.

137. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 3, identity: 0.917

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
atcacgagtgttaaagcgagcggggccacctacttg	Protospacer
.********.*************************.

138. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 3, identity: 0.917

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
atcacgagtgttaaagcgagcggggccacctacttg	Protospacer
.********.*************************.

139. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 3, identity: 0.917

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
atcacgagtgttaaagcgagcggggccacctacttg	Protospacer
.********.*************************.

140. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448694 (Streptococcus phage Javan179, complete genome) position: , mismatch: 3, identity: 0.917

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
gtcacgagtattaaagcgagcgggaccacctacctg	Protospacer
************************.********.*.

141. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

142. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

143. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

144. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448791 (Streptococcus phage Javan517, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

145. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

146. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

147. spacer 3.2|1247906|25|CP033335|PILER-CR matches to NC_004587 (Streptococcus prophage 315.4, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

148. spacer 3.2|1247906|25|CP033335|PILER-CR matches to NC_003157 (Streptococcus pyogenes strain NIH1 putative methionine sulfoxide reductase gene, complete cds; and integrated temperate phage PhiNIH1.1, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

149. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

150. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

151. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448977 (Streptococcus phage Javan530, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

152. spacer 3.2|1247906|25|CP033335|PILER-CR matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

153. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

154. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448788 (Streptococcus phage Javan511, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

155. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

156. spacer 3.2|1247906|25|CP033335|PILER-CR matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

157. spacer 3.2|1247906|25|CP033335|PILER-CR matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 4, identity: 0.84

tcacgagtattaaagcgagcggggc	CRISPR spacer
tcacgagtattaaaacgagctggtg	Protospacer
**************.***** **  

158. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448755 (Streptococcus phage Javan423, complete genome) position: , mismatch: 4, identity: 0.886

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaaattggcgactaataa	Protospacer
***********.********.***********  *

159. spacer 3.3|1247833|35|CP033335|CRISPRCasFinder matches to MK448756 (Streptococcus phage Javan425, complete genome) position: , mismatch: 4, identity: 0.886

caagtttgatcatagttaaagttggcgactaaata	CRISPR spacer
caagtttgatcgtagttaaaattggcgactaataa	Protospacer
***********.********.***********  *

160. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 4, identity: 0.889

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
atcacgagtgttaaaacgagcggggccacctacttg	Protospacer
.********.*****.*******************.

161. spacer 3.4|1247899|36|CP033335|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 4, identity: 0.889

gtcacgagtattaaagcgagcggggccacctactta	CRISPR spacer
gtcgcgagtattaaaacgagcggggccacctacctg	Protospacer
***.***********.*****************.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40588 : 49016 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 607847 : 618450 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_3 722888 : 737667 16 Streptococcus_phage(80.0%) capsid,integrase,terminase attL 725613:725661|attR 743020:743068
DBSCAN-SWA_4 974709 : 990504 18 Temperate_phage(38.46%) terminase NA
DBSCAN-SWA_5 1065415 : 1156211 83 Streptococcus_phage(86.44%) tRNA,holin,terminase,portal,head,capsid,protease,tail NA
DBSCAN-SWA_6 1170423 : 1189604 22 Streptococcus_phage(52.94%) integrase attL 1173863:1173882|attR 1186989:1187008
DBSCAN-SWA_7 1500316 : 1512836 13 Temperate_phage(54.55%) holin NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP033335.1|QAX72893.1|981203_981392_-|Paratox 981203_981392_- 62 aa aa NA NA NA 974709-990504 yes