Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033225 Salmonella enterica subsp. enterica strain CFSA122 plasmid pCFSA122-2, complete sequence 0 crisprs NA 0 0 0 0
CP033224 Salmonella enterica subsp. enterica strain CFSA122 plasmid pCFSA122-1, complete sequence 0 crisprs NA 0 0 1 0
CP033226 Salmonella enterica subsp. enterica strain CFSA122 chromosome, complete genome 3 crisprs PD-DExK,RT,WYL,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas3,cas14j,DEDDh,DinG 2 40 12 0

Results visualization

1. CP033226
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033226_2 980086-981579 TypeI-E I-E
24 spacers
cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033226_3 997710-999022 TypeI-E I-E
21 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033226_4 999096-999673 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 CP033226.1 1829758-1829790 0 1.0
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 CP033226.1 1829758-1829789 0 1.0

1. spacer 3.1|997738|33|CP033226|PILER-CR matches to position: 1829758-1829790, mismatch: 0, identity: 1.0

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
tcccaccgcgctgattaacgacggactgttaca	Protospacer
*********************************

2. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to position: 1829758-1829789, mismatch: 0, identity: 1.0

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
cccaccgcgctgattaacgacggactgttaca	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033226_2 2.20|981278|32|CP033226|PILER-CR 981278-981309 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
CP033226_2 2.20|981278|32|CP033226|PILER-CR 981278-981309 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
CP033226_2 2.30|981275|32|CP033226|CRISPRCasFinder,CRT 981275-981306 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
CP033226_2 2.30|981275|32|CP033226|CRISPRCasFinder,CRT 981275-981306 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
CP033226_3 3.20|998898|33|CP033226|PILER-CR 998898-998930 33 CP051275 Salmonella phage SW-37, complete genome 24294-24326 1 0.97
CP033226_3 3.20|998898|33|CP033226|PILER-CR 998898-998930 33 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44003 1 0.97
CP033226_3 3.40|998899|32|CP033226|CRISPRCasFinder,CRT 998899-998930 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
CP033226_3 3.40|998899|32|CP033226|CRISPRCasFinder,CRT 998899-998930 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
CP033226_2 2.24|980908|32|CP033226|CRISPRCasFinder,CRT 980908-980939 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
CP033226_3 3.40|998899|32|CP033226|CRISPRCasFinder,CRT 998899-998930 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
CP033226_2 2.14|980908|35|CP033226|PILER-CR 980908-980942 35 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130780-130814 4 0.886
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 509804-509835 5 0.844
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 850282-850313 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 887728-887759 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 856045-856076 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 835457-835488 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 953948-953979 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 431895-431926 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 843687-843718 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 833486-833517 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 457962-457993 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1502459-1502490 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1188725-1188756 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1094940-1094971 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 574071-574102 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 758103-758134 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 92938-92969 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1622461-1622492 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 174090-174121 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 996227-996258 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 856529-856560 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1026857-1026888 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 801217-801248 6 0.812
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 887731-887762 6 0.812
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 509803-509835 6 0.818
CP033226_3 3.18|998776|33|CP033226|PILER-CR 998776-998808 33 MT774487 Salmonella phage MG40, complete genome 21745-21777 6 0.818
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336397-336428 6 0.812
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 254-285 6 0.812
CP033226_3 3.38|998777|32|CP033226|CRISPRCasFinder,CRT 998777-998808 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 360377-360408 7 0.781
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336396-336428 7 0.788
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MT758688 Mycobacterium phage CELFI, complete genome 74684-74716 7 0.788
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MH509446 Gordonia phage DelRio, complete genome 6228-6260 7 0.788
CP033226_3 3.18|998776|33|CP033226|PILER-CR 998776-998808 33 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39484 7 0.788
CP033226_3 3.18|998776|33|CP033226|PILER-CR 998776-998808 33 MH370364 Salmonella phage S107, complete genome 29958-29990 7 0.788
CP033226_3 3.18|998776|33|CP033226|PILER-CR 998776-998808 33 MH370382 Salmonella phage S135, complete genome 29958-29990 7 0.788
CP033226_3 3.18|998776|33|CP033226|PILER-CR 998776-998808 33 MH370383 Salmonella phage S137, complete genome 29958-29990 7 0.788
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 282797-282828 7 0.781
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 NZ_CP028350 Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence 226270-226301 7 0.781
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 345037-345068 7 0.781
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 185633-185664 7 0.781
CP033226_3 3.26|998044|32|CP033226|CRISPRCasFinder,CRT 998044-998075 32 MN693183 Marine virus AFVG_25M360, complete genome 30035-30066 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MH509446 Gordonia phage DelRio, complete genome 6223-6254 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MH509446 Gordonia phage DelRio, complete genome 6229-6260 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MT758688 Mycobacterium phage CELFI, complete genome 74684-74715 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_006363 Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence 85980-86011 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 39475-39506 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 10466-10497 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619956 7 0.781
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 117019-117050 7 0.781
CP033226_3 3.33|998472|32|CP033226|CRISPRCasFinder,CRT 998472-998503 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
CP033226_3 3.33|998472|32|CP033226|CRISPRCasFinder,CRT 998472-998503 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
CP033226_3 3.35|998594|32|CP033226|CRISPRCasFinder,CRT 998594-998625 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
CP033226_3 3.36|998655|32|CP033226|CRISPRCasFinder,CRT 998655-998686 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
CP033226_3 3.38|998777|32|CP033226|CRISPRCasFinder,CRT 998777-998808 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
CP033226_3 3.38|998777|32|CP033226|CRISPRCasFinder,CRT 998777-998808 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
CP033226_3 3.38|998777|32|CP033226|CRISPRCasFinder,CRT 998777-998808 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
CP033226_3 3.38|998777|32|CP033226|CRISPRCasFinder,CRT 998777-998808 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
CP033226_4 4.1|999125|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 999125-999156 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
CP033226_4 4.1|999125|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 999125-999156 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
CP033226_4 4.1|999125|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 999125-999156 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
CP033226_2 2.8|980542|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980542-980573 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
CP033226_2 2.9|980603|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980603-980634 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
CP033226_2 2.9|980603|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980603-980634 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 43093-43124 8 0.75
CP033226_2 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980786-980817 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 152052-152083 8 0.75
CP033226_2 2.17|981095|32|CP033226|PILER-CR 981095-981126 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
CP033226_2 2.17|981095|32|CP033226|PILER-CR 981095-981126 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
CP033226_2 2.27|981092|32|CP033226|CRISPRCasFinder,CRT 981092-981123 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
CP033226_2 2.27|981092|32|CP033226|CRISPRCasFinder,CRT 981092-981123 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 282797-282829 8 0.758
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 NZ_CP028350 Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence 226270-226302 8 0.758
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 345036-345068 8 0.758
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 185633-185665 8 0.758
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 509809-509841 8 0.758
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NC_006363 Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence 85980-86012 8 0.758
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 39475-39507 8 0.758
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 10465-10497 8 0.758
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619924-619956 8 0.758
CP033226_3 3.13|998471|33|CP033226|PILER-CR 998471-998503 33 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142293-142325 8 0.758
CP033226_3 3.13|998471|33|CP033226|PILER-CR 998471-998503 33 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29080 8 0.758
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 MK524494 Mycobacterium phage Rabbs, complete genome 19994-20025 8 0.75
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 KX641266 Mycobacterium phage Terror, complete genome 20003-20034 8 0.75
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 NC_031102 Mycobacterium phage Sneeze, complete genome 19993-20024 8 0.75
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 KX641265 Mycobacterium phage Taheera, complete genome 20003-20034 8 0.75
CP033226_3 3.21|997739|32|CP033226|CRISPRCasFinder,CRT 997739-997770 32 NC_014811 Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence 50736-50767 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336416 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 509810-509841 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 JQ807255 Environmental Halophage eHP-36, partial genome 3413-3444 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MH509446 Gordonia phage DelRio, complete genome 6235-6266 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619931-619962 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK359319 Gordonia phage Parada, complete genome 5938-5969 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK359319 Gordonia phage Parada, complete genome 5926-5957 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK376958 Gordonia phage Brylie, complete genome 5938-5969 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK376958 Gordonia phage Brylie, complete genome 5926-5957 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MH399781 Gordonia phage Nadeem, complete genome 5938-5969 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MH399781 Gordonia phage Nadeem, complete genome 5926-5957 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK967392 Gordonia phage GrandSlam, complete genome 5971-6002 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK967392 Gordonia phage GrandSlam, complete genome 5959-5990 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK279893 Gordonia phage WheatThin, complete genome 5938-5969 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK279893 Gordonia phage WheatThin, complete genome 5926-5957 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MT701595 Streptomyces phage Shaeky, complete genome 29602-29633 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_031247 Gordonia phage BetterKatz, complete genome 6191-6222 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_031247 Gordonia phage BetterKatz, complete genome 6179-6210 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK305885 Gordonia phage Mulch, complete genome 5938-5969 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MK305885 Gordonia phage Mulch, complete genome 5926-5957 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 68312-68343 8 0.75
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MG269973 TM7 phage DolZOral124_53_65, complete genome 38250-38281 8 0.75
CP033226_3 3.30|998289|32|CP033226|CRISPRCasFinder,CRT 998289-998320 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
CP033226_3 3.30|998289|32|CP033226|CRISPRCasFinder,CRT 998289-998320 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
CP033226_3 3.34|998533|32|CP033226|CRISPRCasFinder,CRT 998533-998564 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
CP033226_4 4.2|999186|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 999186-999217 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
CP033226_4 4.2|999186|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 999186-999217 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
CP033226_4 4.8|999552|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 999552-999583 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
CP033226_2 2.2|980176|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980176-980207 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
CP033226_2 2.2|980176|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980176-980207 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
CP033226_2 2.6|980420|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980420-980451 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
CP033226_2 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980725-980756 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
CP033226_2 2.15|980972|32|CP033226|PILER-CR 980972-981003 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
CP033226_2 2.25|980969|32|CP033226|CRISPRCasFinder,CRT 980969-981000 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 MK524494 Mycobacterium phage Rabbs, complete genome 19993-20025 9 0.727
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 KX641266 Mycobacterium phage Terror, complete genome 20002-20034 9 0.727
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 NC_031102 Mycobacterium phage Sneeze, complete genome 19992-20024 9 0.727
CP033226_3 3.1|997738|33|CP033226|PILER-CR 997738-997770 33 KX641265 Mycobacterium phage Taheera, complete genome 20002-20034 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MH509446 Gordonia phage DelRio, complete genome 6234-6266 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619930-619962 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MK359319 Gordonia phage Parada, complete genome 5937-5969 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MK376958 Gordonia phage Brylie, complete genome 5937-5969 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MH399781 Gordonia phage Nadeem, complete genome 5937-5969 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MK967392 Gordonia phage GrandSlam, complete genome 5970-6002 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MK279893 Gordonia phage WheatThin, complete genome 5937-5969 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MT701595 Streptomyces phage Shaeky, complete genome 29601-29633 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NC_031247 Gordonia phage BetterKatz, complete genome 6190-6222 9 0.727
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 MK305885 Gordonia phage Mulch, complete genome 5937-5969 9 0.727
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45644-45675 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47035-47066 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71637-71668 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121343 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MT077888 Escherichia coli plasmid p65, complete sequence 47129-47160 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46533-46564 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130788 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69620-69651 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195977-196008 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41265-41296 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45076-45107 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239710-239741 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45076-45107 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43326-43357 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47035-47066 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5926-5957 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240147-240178 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73216 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 JQ807227 Environmental Halophage eHP-6, partial genome 2886-2917 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619919-619950 9 0.719
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-279 9 0.719
CP033226_3 3.31|998350|32|CP033226|CRISPRCasFinder,CRT 998350-998381 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
CP033226_3 3.38|998777|32|CP033226|CRISPRCasFinder,CRT 998777-998808 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
CP033226_2 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980481-980512 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
CP033226_2 2.21|981339|32|CP033226|PILER-CR 981339-981370 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
CP033226_2 2.31|981336|32|CP033226|CRISPRCasFinder,CRT 981336-981367 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
CP033226_2 2.34|981519|32|CP033226|CRISPRCasFinder,CRT 981519-981550 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 452409-452441 10 0.697
CP033226_3 3.10|998288|33|CP033226|PILER-CR 998288-998320 33 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53287 10 0.697
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90223 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93475 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47441-47472 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181853 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164986 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46429-46460 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45081-45112 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41921 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98539 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47440-47471 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP015096 Pelagibaca abyssi strain JLT2014 plasmid pPABY8, complete sequence 24746-24777 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70907 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47996-48027 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60960 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106261 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61670 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125728 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45079-45110 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119619-119650 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136443-136474 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46428-46459 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182674 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46278-46309 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197026-197057 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166891 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46091-46122 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46820-46851 10 0.688
CP033226_3 3.29|998228|32|CP033226|CRISPRCasFinder,CRT 998228-998259 32 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 452410-452441 10 0.688
CP033226_3 3.30|998289|32|CP033226|CRISPRCasFinder,CRT 998289-998320 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
CP033226_3 3.31|998350|32|CP033226|CRISPRCasFinder,CRT 998350-998381 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
CP033226_3 3.31|998350|32|CP033226|CRISPRCasFinder,CRT 998350-998381 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
CP033226_3 3.31|998350|32|CP033226|CRISPRCasFinder,CRT 998350-998381 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
CP033226_3 3.31|998350|32|CP033226|CRISPRCasFinder,CRT 998350-998381 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
CP033226_3 3.31|998350|32|CP033226|CRISPRCasFinder,CRT 998350-998381 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
CP033226_3 3.40|998899|32|CP033226|CRISPRCasFinder,CRT 998899-998930 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
CP033226_4 4.9|999613|32|CP033226|CRISPRCasFinder,CRT 999613-999644 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
CP033226_4 4.9|999613|32|CP033226|CRISPRCasFinder,CRT 999613-999644 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
CP033226_2 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT 980237-980268 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656
CP033226_3 3.9|998227|33|CP033226|PILER-CR 998227-998259 33 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-280 11 0.667

1. spacer 2.20|981278|32|CP033226|PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

2. spacer 2.20|981278|32|CP033226|PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

3. spacer 2.30|981275|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

4. spacer 2.30|981275|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

5. spacer 3.20|998898|33|CP033226|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.97

gccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
gccacgttcggcgatgttggccccatcggtccg	Protospacer
********************************.

6. spacer 3.20|998898|33|CP033226|PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.97

gccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
gccacattcggcgatgttggccccatcggtcca	Protospacer
*****.***************************

7. spacer 3.40|998899|32|CP033226|CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacgttcggcgatgttggccccatcggtccg	Protospacer
*******************************.

8. spacer 3.40|998899|32|CP033226|CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacattcggcgatgttggccccatcggtcca	Protospacer
****.***************************

9. spacer 2.24|980908|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

aaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
aaacgaaagaggccatgcgattgtttatcggt	Protospacer
*************.*****.************

10. spacer 3.40|998899|32|CP033226|CRISPRCasFinder,CRT matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ctacgttcggtgatgttggccccataggtcca	Protospacer
*.********.************** ******

11. spacer 2.14|980908|35|CP033226|PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 4, identity: 0.886

tcgaaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
atgaaacgaaagaggccatgcgattgtttatcggt	Protospacer
 .**************.*****.************

12. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 5, identity: 0.844

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ccagacaaccgagaccgagaccgagacccaga	Protospacer
*   ** ********************* ***

13. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

14. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

15. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

16. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

17. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

18. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

19. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

20. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

21. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

22. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

23. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

24. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

25. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

26. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

27. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

28. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

29. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

30. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

31. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

32. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

33. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

34. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

35. spacer 3.9|998227|33|CP033226|PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 6, identity: 0.818

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cccagacaaccgagaccgagaccgagacccaga	Protospacer
 *   ** ********************* ***

36. spacer 3.18|998776|33|CP033226|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.818

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgg	Protospacer
* .  **********************  ****

37. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.812

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gaccgagaccgagaccgagaccgagaccgaga	Protospacer
 ..*.  *************************

38. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 6, identity: 0.812

cgtcactac-cgagaccgagaccgagaccgaga	CRISPR spacer
-gcccccacgcgagactgagaccgagactgaga	Protospacer
 *.* *.** ******.***********.****

39. spacer 3.38|998777|32|CP033226|CRISPRCasFinder,CRT matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgg	Protospacer
 .  **********************  ****

40. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

41. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcaccgccgatcctttcaccgccgcc	Protospacer
********* ********* ****. *.  **

42. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

43. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 7, identity: 0.781

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcttcggtgacgacattgccgaaggcgacgta	Protospacer
*.  ******** ** ************ .**

44. spacer 3.9|998227|33|CP033226|PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.788

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agaccgagaccgagaccgagaccgagaccgaga	Protospacer
. ..*.  *************************

45. spacer 3.9|998227|33|CP033226|PILER-CR matches to MT758688 (Mycobacterium phage CELFI, complete genome) position: , mismatch: 7, identity: 0.788

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gcaacgggaccgagaccgggaccgggaccgaga	Protospacer
**. *.  **********.*****.********

46. spacer 3.9|998227|33|CP033226|PILER-CR matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.788

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gcaccgagaccgcgaccgagaccgaaaccgaga	Protospacer
**..*.  **** ************.*******

47. spacer 3.18|998776|33|CP033226|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

48. spacer 3.18|998776|33|CP033226|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

49. spacer 3.18|998776|33|CP033226|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

50. spacer 3.18|998776|33|CP033226|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

51. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ggcaccgggctgattaacgccggactgtatcg	Protospacer
  ***** *********** ********  *.

52. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 7, identity: 0.781

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ggcaccgggctgattaacgccggactgtatcg	Protospacer
  ***** *********** ********  *.

53. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 7, identity: 0.781

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ggcaccgggctgattaacgccggactgtatcg	Protospacer
  ***** *********** ********  *.

54. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ggcaccgggctgattaacgccggactgtatcg	Protospacer
  ***** *********** ********  *.

55. spacer 3.26|998044|32|CP033226|CRISPRCasFinder,CRT matches to MN693183 (Marine virus AFVG_25M360, complete genome) position: , mismatch: 7, identity: 0.781

ccattattcaaccctccaggctc-gcgccggct	CRISPR spacer
ccattattcaaccctccaaactctgaatccgc-	Protospacer
******************..*** * ..* ** 

56. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagaccgcgaccgagaccgaaa	Protospacer
**  . .********** ************.*

57. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
caccgagaccgcgaccgagaccgaaaccgaga	Protospacer
*..*.  **** ************.*******

58. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MT758688 (Mycobacterium phage CELFI, complete genome) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
caacgggaccgagaccgggaccgggaccgaga	Protospacer
*. *.  **********.*****.********

59. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
catccgcaccgagaccgcgaccgagatcgagc	Protospacer
*.**  .********** ********.**** 

60. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
catccgcaccgagaccgcgaccgagatcgagc	Protospacer
*.**  .********** ********.**** 

61. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
catccgcaccgagaccgcgaccgagatcgagc	Protospacer
*.**  .********** ********.**** 

62. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgccgaggccgagaccgaggccgaggccgaga	Protospacer
**.*.  .***********.*****.******

63. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 7, identity: 0.781

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgccgccgccgagaccgaggccgaggccgagg	Protospacer
**.*.*..***********.*****.*****.

64. spacer 3.33|998472|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

65. spacer 3.33|998472|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

66. spacer 3.35|998594|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

acgccccgaatgtgtttgcctcgcccgctgcc	CRISPR spacer
gcgacctgaatgtgtttgcctcgcgccgtggc	Protospacer
.** **.***************** *  ** *

67. spacer 3.36|998655|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

acgccccgaatgtgtttgcctcgcccgctgcc	CRISPR spacer
gcgacctgaatgtgtttgcctcgcgccgtggc	Protospacer
.** **.***************** *  ** *

68. spacer 3.38|998777|32|CP033226|CRISPRCasFinder,CRT matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

69. spacer 3.38|998777|32|CP033226|CRISPRCasFinder,CRT matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

70. spacer 3.38|998777|32|CP033226|CRISPRCasFinder,CRT matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

71. spacer 3.38|998777|32|CP033226|CRISPRCasFinder,CRT matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

72. spacer 4.1|999125|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

73. spacer 4.1|999125|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

74. spacer 4.1|999125|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

75. spacer 2.8|980542|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75

cggaggatggaatatttccgaggctggcgatt	CRISPR spacer
tgggagatggaatacttccggggctggcaacc	Protospacer
.**..*********.*****.*******.*..

76. spacer 2.9|980603|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

77. spacer 2.9|980603|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

78. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac-	CRISPR spacer
atacgctggtctataccggcaa-ggatccgctg	Protospacer
  ******************** *.*. ** . 

79. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

80. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

81. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
ggacgctgttcaataccggcaacgtccggatc	Protospacer
 ******* ** ************  ** . *

82. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcgacggtgacgtccgtgacgaaggtgttcga	Protospacer
*.************ *** ******.*    *

83. spacer 2.12|980786|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
ttctggtggacgtccgtgccgaaggcgcaatg	Protospacer
**   *  ****** ************ ***.

84. spacer 2.17|981095|32|CP033226|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

85. spacer 2.17|981095|32|CP033226|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

86. spacer 2.27|981092|32|CP033226|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

87. spacer 2.27|981092|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

88. spacer 3.1|997738|33|CP033226|PILER-CR matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
cggcaccgggctgattaacgccggactgtatcg	Protospacer
.  ***** *********** ********  *.

89. spacer 3.1|997738|33|CP033226|PILER-CR matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 8, identity: 0.758

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
cggcaccgggctgattaacgccggactgtatcg	Protospacer
.  ***** *********** ********  *.

90. spacer 3.1|997738|33|CP033226|PILER-CR matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 8, identity: 0.758

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
cggcaccgggctgattaacgccggactgtatcg	Protospacer
.  ***** *********** ********  *.

91. spacer 3.1|997738|33|CP033226|PILER-CR matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
cggcaccgggctgattaacgccggactgtatcg	Protospacer
.  ***** *********** ********  *.

92. spacer 3.9|998227|33|CP033226|PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------caaccgagaccgagaccgagacccagacccagt	Protospacer
      * ********************* ***      

93. spacer 3.9|998227|33|CP033226|PILER-CR matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ccatccgcaccgagaccgcgaccgagatcgagc	Protospacer
 *.**  .********** ********.**** 

94. spacer 3.9|998227|33|CP033226|PILER-CR matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ccatccgcaccgagaccgcgaccgagatcgagc	Protospacer
 *.**  .********** ********.**** 

95. spacer 3.9|998227|33|CP033226|PILER-CR matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ccatccgcaccgagaccgcgaccgagatcgagc	Protospacer
 *.**  .********** ********.**** 

96. spacer 3.9|998227|33|CP033226|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.758

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
acgccgaggccgagaccgaggccgaggccgaga	Protospacer
.**.*.  .***********.*****.******

97. spacer 3.13|998471|33|CP033226|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

98. spacer 3.13|998471|33|CP033226|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 8, identity: 0.758

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

99. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 8, identity: 0.75

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
catatcgcgctggtcaacgacggactgttggg	Protospacer
* .*.*******.*.**************. .

100. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to KX641266 (Mycobacterium phage Terror, complete genome) position: , mismatch: 8, identity: 0.75

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
catatcgcgctggtcaacgacggactgttggg	Protospacer
* .*.*******.*.**************. .

101. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 8, identity: 0.75

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
catatcgcgctggtcaacgacggactgttggg	Protospacer
* .*.*******.*.**************. .

102. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to KX641265 (Mycobacterium phage Taheera, complete genome) position: , mismatch: 8, identity: 0.75

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
catatcgcgctggtcaacgacggactgttggg	Protospacer
* .*.*******.*.**************. .

103. spacer 3.21|997739|32|CP033226|CRISPRCasFinder,CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 8, identity: 0.75

cccaccgcgctgattaacgacggactgttaca	CRISPR spacer
gccaccgcgctgatcaacgccggagtctccct	Protospacer
 *************.**** **** * *. * 

104. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
aagcgtcgtcgagaccgagaccgagaccgaga	Protospacer
 . *.....***********************

105. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------aaccgagaccgagaccgagacccagacccagt	Protospacer
       ********************* ***      

106. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to JQ807255 (Environmental Halophage eHP-36, partial genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cactggaaccgagaccgagaccgagaccgatg	Protospacer
*....  *********************** .

107. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gaccgcgaccgagaccgaaaccgagacggagt	Protospacer
 ..*.* ***********.******** *** 

108. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ggccgagaccgaggccgaggccgagaccgagg	Protospacer
 *.*.  ******.*****.***********.

109. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK359319 (Gordonia phage Parada, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

110. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK359319 (Gordonia phage Parada, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

111. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK376958 (Gordonia phage Brylie, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

112. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK376958 (Gordonia phage Brylie, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

113. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MH399781 (Gordonia phage Nadeem, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

114. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MH399781 (Gordonia phage Nadeem, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

115. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

116. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

117. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK279893 (Gordonia phage WheatThin, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

118. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK279893 (Gordonia phage WheatThin, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

119. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgaggacaccgagaccgaggccgaggccgagg	Protospacer
**  . .************.*****.*****.

120. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_031247 (Gordonia phage BetterKatz, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

121. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_031247 (Gordonia phage BetterKatz, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgaaggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

122. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK305885 (Gordonia phage Mulch, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt	Protospacer
 ..* * ***********.******** *** 

123. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MK305885 (Gordonia phage Mulch, complete genome) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa	Protospacer
**  . .*********  ************.*

124. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ctacagcaccaagaccgagaccgagacggaat	Protospacer
*  ** .***.**************** **. 

125. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MG269973 (TM7 phage DolZOral124_53_65, complete genome) position: , mismatch: 8, identity: 0.75

-----cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
acaagcgt-----ccgaaaccgaaaccgagaccgagc	Protospacer
     ***     ****.*****.************ 

126. spacer 3.30|998289|32|CP033226|CRISPRCasFinder,CRT matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

ccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
acgcatcagcactggatcaagctggcgcaact	Protospacer
 ***    ************ ***.****** 

127. spacer 3.30|998289|32|CP033226|CRISPRCasFinder,CRT matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75

ccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
acgcatcagcactggatcaagctggcgcaact	Protospacer
 ***    ************ ***.****** 

128. spacer 3.34|998533|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gaggcgtac-----aggctgttagatgagaaattacc	CRISPR spacer
-----atactaataaggctgtttgatgcgaaattacc	Protospacer
     .***     ******** **** *********

129. spacer 4.2|999186|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

130. spacer 4.2|999186|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

131. spacer 4.8|999552|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  . 

132. spacer 2.2|980176|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

133. spacer 2.2|980176|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

134. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcagcgccgagcagttcagcaaactg	Protospacer
**************** * *****  . .*. 

135. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
gcggcatcagcgccgaccggttcaccgtcagg	Protospacer
 ***************.* *****. **    

136. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatgagcgccgatcagttcgacgccctg	Protospacer
******* ********** ****.  *. *. 

137. spacer 2.6|980420|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

aacaggaacaggaaaaaaaagatttgtccggt	CRISPR spacer
tacagtaacaggaaaaaaaggattaatgatgc	Protospacer
 **** *************.**** .*   *.

138. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaacggtcagcctgtccaggagga	Protospacer
****** *********** ****..**     

139. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

140. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

141. spacer 2.11|980725|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattt	Protospacer
****.********.********** * .   .

142. spacer 2.15|980972|32|CP033226|PILER-CR matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

143. spacer 2.25|980969|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

144. spacer 3.1|997738|33|CP033226|PILER-CR matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 9, identity: 0.727

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ccatatcgcgctggtcaacgacggactgttggg	Protospacer
.* .*.*******.*.**************. .

145. spacer 3.1|997738|33|CP033226|PILER-CR matches to KX641266 (Mycobacterium phage Terror, complete genome) position: , mismatch: 9, identity: 0.727

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ccatatcgcgctggtcaacgacggactgttggg	Protospacer
.* .*.*******.*.**************. .

146. spacer 3.1|997738|33|CP033226|PILER-CR matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 9, identity: 0.727

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ccatatcgcgctggtcaacgacggactgttggg	Protospacer
.* .*.*******.*.**************. .

147. spacer 3.1|997738|33|CP033226|PILER-CR matches to KX641265 (Mycobacterium phage Taheera, complete genome) position: , mismatch: 9, identity: 0.727

tcccaccgcgctgattaacgacggactgttaca	CRISPR spacer
ccatatcgcgctggtcaacgacggactgttggg	Protospacer
.* .*.*******.*.**************. .

148. spacer 3.9|998227|33|CP033226|PILER-CR matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agaccgcgaccgagaccgaaaccgagacggagt	Protospacer
. ..*.* ***********.******** *** 

149. spacer 3.9|998227|33|CP033226|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
aggccgagaccgaggccgaggccgagaccgagg	Protospacer
. *.*.  ******.*****.***********.

150. spacer 3.9|998227|33|CP033226|PILER-CR matches to MK359319 (Gordonia phage Parada, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

151. spacer 3.9|998227|33|CP033226|PILER-CR matches to MK376958 (Gordonia phage Brylie, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

152. spacer 3.9|998227|33|CP033226|PILER-CR matches to MH399781 (Gordonia phage Nadeem, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

153. spacer 3.9|998227|33|CP033226|PILER-CR matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

154. spacer 3.9|998227|33|CP033226|PILER-CR matches to MK279893 (Gordonia phage WheatThin, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

155. spacer 3.9|998227|33|CP033226|PILER-CR matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
ccgaggacaccgagaccgaggccgaggccgagg	Protospacer
 **  . .************.*****.*****.

156. spacer 3.9|998227|33|CP033226|PILER-CR matches to NC_031247 (Gordonia phage BetterKatz, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

157. spacer 3.9|998227|33|CP033226|PILER-CR matches to MK305885 (Gordonia phage Mulch, complete genome) position: , mismatch: 9, identity: 0.727

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
agacctcgaccgagaccgaaaccgagacggagt	Protospacer
. ..* * ***********.******** *** 

158. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

159. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

160. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

161. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

162. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

163. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

164. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

165. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

166. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

167. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

168. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

169. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

170. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

171. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

172. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

173. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

174. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

175. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat	Protospacer
        ********************** *      

176. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to JQ807227 (Environmental Halophage eHP-6, partial genome) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cactggaaccgggaccgagaccgagaccgatg	Protospacer
*....  ****.****************** .

177. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
caccgacgccgaggccgagaccgaggccgagg	Protospacer
*..*. ..*****.***********.*****.

178. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
acgcgagactgagaccgagactgagaccgagc	Protospacer
   *.  **.***********.********* 

179. spacer 3.31|998350|32|CP033226|CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

ttgcag----ggcgatattgttgttggtgaatggga	CRISPR spacer
----aacactgacgatattattgttggtgattgggg	Protospacer
    *.    *.*******.********** ****.

180. spacer 3.38|998777|32|CP033226|CRISPRCasFinder,CRT matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
tgagttcatccggcactaccggcgctggatgc	Protospacer
   ******* ************.**   ** 

181. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

182. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

183. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

184. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

185. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

186. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

187. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

188. spacer 2.7|980481|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

189. spacer 2.21|981339|32|CP033226|PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

190. spacer 2.31|981336|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

191. spacer 2.34|981519|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*  

192. spacer 3.9|998227|33|CP033226|PILER-CR matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

gcgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
gcgccacaaccgagaccgagaccgggctgcgcg	Protospacer
***.*** ****************.* .  . .

193. spacer 3.10|998288|33|CP033226|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.697

gccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
gaatctgacgcacttgatcaacctggcgtttga	Protospacer
*   ********** **********.**.   .

194. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

195. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

196. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

197. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

198. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

199. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

200. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

201. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

202. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

203. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

204. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP015096 (Pelagibaca abyssi strain JLT2014 plasmid pPABY8, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------gaccgaggccgagaccgaggacgagaccgagg	Protospacer
       ******.***********. *****      

205. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

206. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

207. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

208. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

209. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

210. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

211. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

212. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

213. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

214. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

215. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

216. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

217. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

218. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

219. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

220. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------atccgagaccgagaccgataccgataccgata	Protospacer
        **************** ***** *      

221. spacer 3.29|998228|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgtcactaccgagaccgagaccgagaccgaga	CRISPR spacer
cgccacaaccgagaccgagaccgggctgcgcg	Protospacer
**.*** ****************.* .  . .

222. spacer 3.30|998289|32|CP033226|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

ccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
aatctgacgcacttgatcaacctggcgtttga	Protospacer
   ********** **********.**.   .

223. spacer 3.31|998350|32|CP033226|CRISPRCasFinder,CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

224. spacer 3.31|998350|32|CP033226|CRISPRCasFinder,CRT matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

225. spacer 3.31|998350|32|CP033226|CRISPRCasFinder,CRT matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

226. spacer 3.31|998350|32|CP033226|CRISPRCasFinder,CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

227. spacer 3.31|998350|32|CP033226|CRISPRCasFinder,CRT matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

228. spacer 3.40|998899|32|CP033226|CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
actcgttcggcgatgtggcccccatccaggtg	Protospacer
 * ************* * ******* .  ..

229. spacer 4.9|999613|32|CP033226|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

230. spacer 4.9|999613|32|CP033226|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

231. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

232. spacer 2.3|980237|32|CP033226|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

233. spacer 3.9|998227|33|CP033226|PILER-CR matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 11, identity: 0.667

gcgtcactaccgagaccgagaccgagaccgaga------	CRISPR spacer
------cacgcgagactgagaccgagactgagaccgagc	Protospacer
      *   ******.***********.****      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 662731 : 707854 53 Cronobacter_phage(66.67%) tRNA,integrase,capsid,tail,head,terminase,portal,holin attL 662882:662897|attR 695732:695747
DBSCAN-SWA_2 1160314 : 1196118 34 Escherichia_phage(33.33%) integrase,transposase attL 1147738:1147751|attR 1196748:1196761
DBSCAN-SWA_3 1274331 : 1349729 94 Salmonella_phage(43.33%) tRNA,integrase,capsid,protease,transposase,tail,terminase,lysis,head,portal,holin attL 1266412:1266428|attR 1355576:1355592
DBSCAN-SWA_4 1721182 : 1733473 10 Salmonella_phage(40.0%) tail,holin NA
DBSCAN-SWA_5 1805525 : 1814696 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_6 1883004 : 1893510 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 1979504 : 2030191 72 Salmonella_phage(80.0%) integrase,capsid,protease,tail,head,terminase,plate,portal,holin attL 1974082:1974096|attR 1990212:1990226
DBSCAN-SWA_8 2134235 : 2141044 12 Salmonella_phage(33.33%) integrase,tail attL 2136445:2136467|attR 2146160:2146182
DBSCAN-SWA_9 2928127 : 3019044 95 Salmonella_phage(59.57%) tRNA,protease,tail,terminase,lysis,holin NA
DBSCAN-SWA_10 3069107 : 3077839 10 Enterobacteria_phage(14.29%) protease,transposase NA
DBSCAN-SWA_11 3686152 : 3732023 68 Salmonella_phage(56.72%) integrase,coat,protease,tail,terminase,lysis,portal attL 3677854:3677870|attR 3741237:3741253
DBSCAN-SWA_12 4571134 : 4615652 46 Burkholderia_phage(42.86%) tRNA,tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033224
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62860 : 153805 85 Escherichia_phage(32.0%) integrase,transposase attL 79458:79474|attR 100041:100057
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage