Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034391 Escherichia coli strain RS571 plasmid punnamed3 0 crisprs NA 0 0 0 0
CP034390 Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence 0 crisprs NA 0 0 2 0
CP034389 Escherichia coli strain RS571 chromosome, complete genome 5 crisprs RT,csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG 2 18 13 0
CP034392 Escherichia coli strain RS571 plasmid punnamed4 0 crisprs NA 0 0 0 0

Results visualization

1. CP034390
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61126 : 111583 52 Escherichia_phage(37.5%) transposase NA
DBSCAN-SWA_2 128799 : 160680 30 Escherichia_phage(46.15%) integrase,transposase attL 123124:123154|attR 163105:163135
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034389
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034389_1 1115278-1116590 Unclear I-E
21 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034389_2 1142136-1142226 TypeI-E I-E
1 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034389_3 2348570-2348693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034389_5 3169594-3169741 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034389_7 4154464-4154605 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034389_1 1.15|1116162|33|CP034389|PILER-CR 1116162-1116194 33 CP034389.1 1095446-1095478 1 0.97
CP034389_1 1.36|1116163|32|CP034389|CRISPRCasFinder,CRT 1116163-1116194 32 CP034389.1 1095446-1095477 1 0.969

1. spacer 1.15|1116162|33|CP034389|PILER-CR matches to position: 1095446-1095478, mismatch: 1, identity: 0.97

attccggctacttttgttgctccctgctcatcc	CRISPR spacer
attccagctacttttgttgctccctgctcatcc	Protospacer
*****.***************************

2. spacer 1.36|1116163|32|CP034389|CRISPRCasFinder,CRT matches to position: 1095446-1095477, mismatch: 1, identity: 0.969

ttccggctacttttgttgctccctgctcatcc	CRISPR spacer
ttccagctacttttgttgctccctgctcatcc	Protospacer
****.***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034389_4 4.1|3036542|40|CP034389|CRISPRCasFinder 3036542-3036581 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP034389_6 6.1|3616051|24|CP034389|PILER-CR 3616051-3616074 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 0 1.0
CP034389_6 6.1|3616051|24|CP034389|PILER-CR 3616051-3616074 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 0 1.0
CP034389_6 6.2|3616098|25|CP034389|PILER-CR 3616098-3616122 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
CP034389_6 6.2|3616098|25|CP034389|PILER-CR 3616098-3616122 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
CP034389_6 6.1|3616051|24|CP034389|PILER-CR 3616051-3616074 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 1 0.958
CP034389_6 6.2|3616098|25|CP034389|PILER-CR 3616098-3616122 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
CP034389_3 3.1|2348613|38|CP034389|CRISPRCasFinder 2348613-2348650 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP034389_6 6.2|3616098|25|CP034389|PILER-CR 3616098-3616122 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
CP034389_1 1.25|1115490|32|CP034389|CRISPRCasFinder,CRT 1115490-1115521 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 373536-373567 7 0.781
CP034389_2 2.1|1142166|31|CP034389|CRISPRCasFinder 1142166-1142196 31 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 17850-17880 7 0.774
CP034389_2 2.1|1142166|31|CP034389|CRISPRCasFinder 1142166-1142196 31 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 17628-17658 7 0.774
CP034389_2 2.1|1142166|31|CP034389|CRISPRCasFinder 1142166-1142196 31 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 17890-17920 7 0.774
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 405764-405795 8 0.75
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 354033-354064 8 0.75
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NZ_CP053712 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence 91487-91518 8 0.75
CP034389_1 1.30|1115795|32|CP034389|CRISPRCasFinder,CRT 1115795-1115826 32 NC_013085 Synechococcus phage S-RSM4, complete genome 75536-75567 8 0.75
CP034389_1 1.30|1115795|32|CP034389|CRISPRCasFinder,CRT 1115795-1115826 32 FM207411 Synechococcus phage S-RSM4 complete genome 75536-75567 8 0.75
CP034389_1 1.34|1116040|33|CP034389|CRISPRCasFinder,CRT 1116040-1116072 33 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 413541-413573 8 0.758
CP034389_1 1.39|1116346|32|CP034389|CRISPRCasFinder,CRT 1116346-1116377 32 MN855615 Siphoviridae sp. isolate 320, complete genome 7076-7107 8 0.75
CP034389_1 1.39|1116346|32|CP034389|CRISPRCasFinder,CRT 1116346-1116377 32 NC_034248 Rhizobium phage RHEph10, complete genome 31444-31475 8 0.75
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
CP034389_1 1.13|1116039|34|CP034389|PILER-CR 1116039-1116072 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 413540-413573 9 0.735
CP034389_1 1.18|1116345|33|CP034389|PILER-CR 1116345-1116377 33 MN855615 Siphoviridae sp. isolate 320, complete genome 7075-7107 9 0.727
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 47585-47616 9 0.719
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 JX469829 Uncultured bacterium plasmid pB1, complete sequence 23183-23214 9 0.719
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 393203-393234 9 0.719
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 3158-3189 9 0.719
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 569059-569090 9 0.719
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NZ_MN366361 Bacterium plasmid pALTS33, complete sequence 54575-54606 9 0.719
CP034389_1 1.31|1115856|32|CP034389|CRISPRCasFinder,CRT 1115856-1115887 32 MW084976 Bacillus phage Kirov, complete genome 56770-56801 9 0.719
CP034389_1 1.37|1116224|32|CP034389|CRISPRCasFinder,CRT 1116224-1116255 32 NZ_CP016721 Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence 30466-30497 9 0.719
CP034389_1 1.37|1116224|32|CP034389|CRISPRCasFinder,CRT 1116224-1116255 32 NZ_CP016727 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence 30464-30495 9 0.719
CP034389_1 1.41|1116468|32|CP034389|CRISPRCasFinder,CRT 1116468-1116499 32 MK448690 Streptococcus phage Javan169, complete genome 9831-9862 9 0.719
CP034389_1 1.41|1116468|32|CP034389|CRISPRCasFinder,CRT 1116468-1116499 32 MK448854 Streptococcus phage Javan146, complete genome 11811-11842 9 0.719
CP034389_5 5.1|3169622|32|CP034389|CRISPRCasFinder 3169622-3169653 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
CP034389_5 5.1|3169622|32|CP034389|CRISPRCasFinder 3169622-3169653 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
CP034389_5 5.1|3169622|32|CP034389|CRISPRCasFinder 3169622-3169653 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
CP034389_5 5.3|3169630|32|CP034389|PILER-CR 3169630-3169661 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
CP034389_5 5.3|3169630|32|CP034389|PILER-CR 3169630-3169661 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
CP034389_5 5.3|3169630|32|CP034389|PILER-CR 3169630-3169661 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
CP034389_1 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT 1115734-1115765 32 NC_004929 Ruegeria sp. PR1b plasmid pSD20, complete sequence 67373-67404 10 0.688
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
CP034389_7 7.1|4154516|38|CP034389|CRISPRCasFinder 4154516-4154553 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737

1. spacer 4.1|3036542|40|CP034389|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 6.1|3616051|24|CP034389|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

3. spacer 6.1|3616051|24|CP034389|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

4. spacer 6.2|3616098|25|CP034389|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

5. spacer 6.2|3616098|25|CP034389|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

6. spacer 6.1|3616051|24|CP034389|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958

cgcctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.***********************

7. spacer 6.2|3616098|25|CP034389|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

8. spacer 3.1|2348613|38|CP034389|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

9. spacer 6.2|3616098|25|CP034389|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

10. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

11. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

12. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

13. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

14. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

15. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

16. spacer 1.25|1115490|32|CP034389|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.781

aatggcgctgccgatcgacaaatgggacctgg-	CRISPR spacer
gatggcgatgccgatggacaaat-gcacatgct	Protospacer
.****** ******* ******* * ** **  

17. spacer 2.1|1142166|31|CP034389|CRISPRCasFinder matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.774

caaacgtcaggcggaagtgttccggtcatat	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttac	Protospacer
 **.  ****** ************** **.

18. spacer 2.1|1142166|31|CP034389|CRISPRCasFinder matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.774

caaacgtcaggcggaagtgttccggtcatat	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttac	Protospacer
 **.  ****** ************** **.

19. spacer 2.1|1142166|31|CP034389|CRISPRCasFinder matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.774

caaacgtcaggcggaagtgttccggtcatat	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttac	Protospacer
 **.  ****** ************** **.

20. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

21. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

22. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

23. spacer 1.30|1115795|32|CP034389|CRISPRCasFinder,CRT matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 8, identity: 0.75

-----tccttaattacaacgacaccactggaaaaatt	CRISPR spacer
gtagctcc-----tacaacgacagcattggaaaaatc	Protospacer
     ***     ********** **.*********.

24. spacer 1.30|1115795|32|CP034389|CRISPRCasFinder,CRT matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 8, identity: 0.75

-----tccttaattacaacgacaccactggaaaaatt	CRISPR spacer
gtagctcc-----tacaacgacagcattggaaaaatc	Protospacer
     ***     ********** **.*********.

25. spacer 1.34|1116040|33|CP034389|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.758

cgggagccagtgctaacgatatcgcggccgcgc	CRISPR spacer
ggcgcggcagcgcgaacgatatcgcggccgccg	Protospacer
 * * * ***.** *****************  

26. spacer 1.39|1116346|32|CP034389|CRISPRCasFinder,CRT matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 8, identity: 0.75

gccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
ccactgcccatcaaagcaccagcaagcgcata	Protospacer
 *  .*. ****** *** *************

27. spacer 1.39|1116346|32|CP034389|CRISPRCasFinder,CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 8, identity: 0.75

gccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
accgcggccatcaacgcagcagcataaggaga	Protospacer
.*****  **************** . * * *

28. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

29. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

30. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

31. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

32. spacer 1.13|1116039|34|CP034389|PILER-CR matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.735

gcgggagccagtgctaacgatatcgcggccgcgc	CRISPR spacer
cggcgcggcagcgcgaacgatatcgcggccgccg	Protospacer
  * * * ***.** *****************  

33. spacer 1.18|1116345|33|CP034389|PILER-CR matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 9, identity: 0.727

ggccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
accactgcccatcaaagcaccagcaagcgcata	Protospacer
. *  .*. ****** *** *************

34. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 9, identity: 0.719

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*  

35. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 9, identity: 0.719

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*  

36. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
gccgggcagcgcccggcgcgcctcagccatca	Protospacer
 **.* ******************  . *.* 

37. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 9, identity: 0.719

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*  

38. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
cggagcccgcgcccggcgcgccgcttcacatg	Protospacer
*  **** ************** ***.*  . 

39. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 9, identity: 0.719

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*  

40. spacer 1.31|1115856|32|CP034389|CRISPRCasFinder,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.719

ttcgccaggtgttttcttttcccggtcagtca	CRISPR spacer
aattccaagtgttttcttttcccagtctataa	Protospacer
  . ***.***************.*** .* *

41. spacer 1.37|1116224|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP016721 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence) position: , mismatch: 9, identity: 0.719

aatatttacttggatgcgtcggacattgaatc	CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag	Protospacer
  *  * *****.****** **********  

42. spacer 1.37|1116224|32|CP034389|CRISPRCasFinder,CRT matches to NZ_CP016727 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence) position: , mismatch: 9, identity: 0.719

aatatttacttggatgcgtcggacattgaatc	CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag	Protospacer
  *  * *****.****** **********  

43. spacer 1.41|1116468|32|CP034389|CRISPRCasFinder,CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 9, identity: 0.719

tcaacgaaaacgcagagcgaggaacggatatt	CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc	Protospacer
  .*  ****** ********.******* *.

44. spacer 1.41|1116468|32|CP034389|CRISPRCasFinder,CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 9, identity: 0.719

tcaacgaaaacgcagagcgaggaacggatatt	CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc	Protospacer
  .*  ****** ********.******* *.

45. spacer 5.1|3169622|32|CP034389|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

46. spacer 5.1|3169622|32|CP034389|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

47. spacer 5.1|3169622|32|CP034389|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

48. spacer 5.3|3169630|32|CP034389|PILER-CR matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

49. spacer 5.3|3169630|32|CP034389|PILER-CR matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

50. spacer 5.3|3169630|32|CP034389|PILER-CR matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

51. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

52. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

53. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

54. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

55. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

56. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

57. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

58. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

59. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

60. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

61. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

62. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

63. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

64. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

65. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

66. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

67. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**  

68. spacer 1.29|1115734|32|CP034389|CRISPRCasFinder,CRT matches to NC_004929 (Ruegeria sp. PR1b plasmid pSD20, complete sequence) position: , mismatch: 10, identity: 0.688

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgcctgcgcccggcgcgcctgccagaggg	Protospacer
*** *** *************** .. .*   

69. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

70. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

71. spacer 7.1|4154516|38|CP034389|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 802612 : 867762 56 Escherichia_phage(30.77%) protease,transposase NA
DBSCAN-SWA_2 1375993 : 1410484 38 Escherichia_phage(48.57%) integrase,tail,terminase attL 1358895:1358910|attR 1397411:1397426
DBSCAN-SWA_3 1414619 : 1421375 9 Escherichia_phage(87.5%) holin NA
DBSCAN-SWA_4 1814216 : 1823658 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 1835568 : 1901410 76 Escherichia_phage(42.55%) portal,plate,holin,tRNA,tail,integrase,terminase,head,capsid,lysis attL 1862715:1862742|attR 1896337:1896364
DBSCAN-SWA_6 1947761 : 1955279 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_7 2430312 : 2528298 107 Enterobacteria_phage(35.59%) portal,transposase,tail,integrase,protease,terminase,lysis attL 2425602:2425618|attR 2459050:2459066
DBSCAN-SWA_8 3154632 : 3244040 93 Salmonella_phage(61.4%) portal,plate,tRNA,tail,protease,integrase,terminase,head,capsid,lysis attL 3209736:3209762|attR 3244115:3244141
DBSCAN-SWA_9 3538268 : 3623493 89 Enterobacteria_phage(52.46%) transposase,tail,protease,integrase,terminase,head,capsid,lysis attL 3572532:3572578|attR 3623507:3623553
DBSCAN-SWA_10 3888740 : 3935764 50 Enterobacteria_phage(20.0%) integrase,transposase,plate attL 3888636:3888655|attR 3901849:3901868
DBSCAN-SWA_11 4283141 : 4335227 58 Stx2-converting_phage(40.0%) transposase,holin NA
DBSCAN-SWA_12 4485827 : 4544498 54 Stx2-converting_phage(28.57%) integrase,transposase attL 4504460:4504473|attR 4545456:4545469
DBSCAN-SWA_13 4650114 : 4695532 46 Burkholderia_phage(30.0%) tail,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage