Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035268 Weissella cibaria strain SRCM103448 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP035269 Weissella cibaria strain SRCM103448 plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 0 0
CP035267 Weissella cibaria strain SRCM103448 chromosome, complete genome 1 crisprs csa3,DEDDh,cas14j,DinG,csn2,cas2,cas1,cas9,cas3 0 6 4 0
CP035270 Weissella cibaria strain SRCM103448 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP035267
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035267_2 1370251-1370682 TypeII NA
6 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035267_2 2.1|1370287|30|CP035267|CRISPRCasFinder 1370287-1370316 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2133308-2133337 6 0.8
CP035267_2 2.13|1370288|30|CP035267|PILER-CR 1370288-1370317 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2133308-2133337 6 0.8
CP035267_2 2.1|1370287|30|CP035267|CRISPRCasFinder 1370287-1370316 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1410076-1410105 7 0.767
CP035267_2 2.4|1370485|30|CP035267|CRISPRCasFinder 1370485-1370514 30 NZ_CP018938 Bacteroides fragilis strain Q1F2 plasmid Q1F2-p1, complete sequence 14069-14098 7 0.767
CP035267_2 2.13|1370288|30|CP035267|PILER-CR 1370288-1370317 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1410076-1410105 7 0.767
CP035267_2 2.16|1370486|30|CP035267|PILER-CR 1370486-1370515 30 NZ_CP018938 Bacteroides fragilis strain Q1F2 plasmid Q1F2-p1, complete sequence 14069-14098 7 0.767
CP035267_2 2.1|1370287|30|CP035267|CRISPRCasFinder 1370287-1370316 30 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 77451-77480 8 0.733
CP035267_2 2.1|1370287|30|CP035267|CRISPRCasFinder 1370287-1370316 30 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 294961-294990 8 0.733
CP035267_2 2.6|1370617|30|CP035267|CRISPRCasFinder 1370617-1370646 30 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 593575-593604 8 0.733
CP035267_2 2.13|1370288|30|CP035267|PILER-CR 1370288-1370317 30 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 77451-77480 8 0.733
CP035267_2 2.13|1370288|30|CP035267|PILER-CR 1370288-1370317 30 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 294961-294990 8 0.733
CP035267_2 2.18|1370618|30|CP035267|PILER-CR 1370618-1370647 30 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 593575-593604 8 0.733

1. spacer 2.1|1370287|30|CP035267|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.8

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
cataatcattgcaattgcctgcgccgtcgt	Protospacer
  *.*************** .******* *

2. spacer 2.13|1370288|30|CP035267|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.8

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
cataatcattgcaattgcctgcgccgtcgt	Protospacer
  *.*************** .******* *

3. spacer 2.1|1370287|30|CP035267|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
gatcttcagtgcatttgccaacgccgtcgg	Protospacer
* *  *** **** **************  

4. spacer 2.4|1370485|30|CP035267|CRISPRCasFinder matches to NZ_CP018938 (Bacteroides fragilis strain Q1F2 plasmid Q1F2-p1, complete sequence) position: , mismatch: 7, identity: 0.767

atgccattaaacatgcccttcaaaaactcg	CRISPR spacer
tcgtaattaaacatgcccttcacaaacttc	Protospacer
 .*. ***************** *****. 

5. spacer 2.13|1370288|30|CP035267|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
gatcttcagtgcatttgccaacgccgtcgg	Protospacer
* *  *** **** **************  

6. spacer 2.16|1370486|30|CP035267|PILER-CR matches to NZ_CP018938 (Bacteroides fragilis strain Q1F2 plasmid Q1F2-p1, complete sequence) position: , mismatch: 7, identity: 0.767

atgccattaaacatgcccttcaaaaactcg	CRISPR spacer
tcgtaattaaacatgcccttcacaaacttc	Protospacer
 .*. ***************** *****. 

7. spacer 2.1|1370287|30|CP035267|CRISPRCasFinder matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 8, identity: 0.733

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
cgaagtcattgcaatcgccaacggcgtcat	Protospacer
   ..**********.******* **** *

8. spacer 2.1|1370287|30|CP035267|CRISPRCasFinder matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
cgaagtcattgcaatcgccaacggcgtcat	Protospacer
   ..**********.******* **** *

9. spacer 2.6|1370617|30|CP035267|CRISPRCasFinder matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tggcttagcgccaatcggccacacagtgac	CRISPR spacer
cgaagtagcgccaatcggccagaaagtgca	Protospacer
.*.  **************** * ****  

10. spacer 2.13|1370288|30|CP035267|PILER-CR matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 8, identity: 0.733

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
cgaagtcattgcaatcgccaacggcgtcat	Protospacer
   ..**********.******* **** *

11. spacer 2.13|1370288|30|CP035267|PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gttgatcattgcaattgccaacgccgtctt	CRISPR spacer
cgaagtcattgcaatcgccaacggcgtcat	Protospacer
   ..**********.******* **** *

12. spacer 2.18|1370618|30|CP035267|PILER-CR matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tggcttagcgccaatcggccacacagtgac	CRISPR spacer
cgaagtagcgccaatcggccagaaagtgca	Protospacer
.*.  **************** * ****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 424899 : 477475 45 Staphylococcus_phage(25.0%) protease,transposase,tRNA NA
DBSCAN-SWA_2 812537 : 828398 16 Bacillus_phage(40.0%) protease,transposase NA
DBSCAN-SWA_3 843558 : 876419 42 Enterococcus_phage(33.33%) portal,head,integrase,tail,capsid,terminase attL 843528:843552|attR 878840:878864
DBSCAN-SWA_4 1663960 : 1672605 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage