Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035177 Lactobacillus plantarum strain SRCM103426 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP035174 Lactobacillus plantarum strain SRCM103426 chromosome, complete genome 1 crisprs csa3,DinG,cas3,DEDDh 1 1 8 2
CP035175 Lactobacillus plantarum strain SRCM103426 plasmid unnamed1 0 crisprs NA 0 0 1 0
CP035176 Lactobacillus plantarum strain SRCM103426 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP035178 Lactobacillus plantarum strain SRCM103426 plasmid unnamed4 0 crisprs NA 0 0 0 0

Results visualization

1. CP035174
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035174_1 360255-360716 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP035174_1 1.2|360321|18|CP035174|CRT 360321-360338 18 CP035174.1 360237-360254 2 0.889

1. spacer 1.2|360321|18|CP035174|CRT matches to position: 360237-360254, mismatch: 2, identity: 0.889

gcggccaagaaacataag	CRISPR spacer
gccgctaagaaacataag	Protospacer
** **.************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035174_1 1.1|360273|30|CP035174|CRT 360273-360302 30 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 31047-31076 7 0.767
CP035174_1 1.1|360273|30|CP035174|CRT 360273-360302 30 NC_042345 Phage Salvo, complete genome 4721-4750 8 0.733

1. spacer 1.1|360273|30|CP035174|CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 7, identity: 0.767

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
cacaagaataaagccgccaagaagctccgg	Protospacer
******** ***** ********.* . .*

2. spacer 1.1|360273|30|CP035174|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 8, identity: 0.733

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
ccggggaagtaagcggacaagaaacatact	Protospacer
*  ..**** ****** ***********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 37665 : 54775 22 Lactobacillus_phage(30.0%) tail,portal,capsid,head,terminase,integrase attL 34236:34249|attR 44364:44377
DBSCAN-SWA_2 324145 : 368915 36 Staphylococcus_phage(28.57%) protease,bacteriocin,transposase NA
DBSCAN-SWA_3 1018477 : 1025544 7 Escherichia_phage(50.0%) integrase,transposase attL 1022931:1022944|attR 1032279:1032292
DBSCAN-SWA_4 1179412 : 1251191 72 Lactobacillus_phage(89.13%) tail,portal,transposase,holin,capsid,protease,tRNA,head,terminase,integrase attL 1181303:1181318|attR 1200639:1200654
DBSCAN-SWA_5 1277297 : 1291114 11 Lactobacillus_phage(72.73%) transposase NA
DBSCAN-SWA_6 1296819 : 1305512 10 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_7 2131546 : 2179593 58 Lactobacillus_phage(53.12%) tail,portal,holin,capsid,head,terminase NA
DBSCAN-SWA_8 2376822 : 2385336 9 Synechococcus_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP035174.1|QAS28819.1|363801_364065_+|hypothetical-protein 363801_364065_+ 87 aa aa NA NA NA 324145-368915 yes
CP035174.1|QAS28820.1|364166_364445_+|hypothetical-protein 364166_364445_+ 92 aa aa NA NA NA 324145-368915 yes
2. CP035175
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21312 : 75636 53 Streptococcus_phage(27.27%) protease,transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage