Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035171 Lactobacillus plantarum strain SRCM103418 plasmid unnamed3 1 crisprs csa3 0 1 0 0
CP035169 Lactobacillus plantarum strain SRCM103418 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP035172 Lactobacillus plantarum strain SRCM103418 plasmid unnamed4 0 crisprs NA 0 0 0 0
CP035173 Lactobacillus plantarum strain SRCM103418 plasmid unnamed5 0 crisprs NA 0 0 0 0
CP035168 Lactobacillus plantarum strain SRCM103418 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,DinG 0 0 6 0
CP035170 Lactobacillus plantarum strain SRCM103418 plasmid unnamed2 0 crisprs NA 0 0 0 0

Results visualization

1. CP035168
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035168_1 528692-528777 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 37667 : 54843 22 Lactobacillus_phage(27.27%) capsid,terminase,tail,integrase,head,portal attL 37461:37474|attR 48228:48241
DBSCAN-SWA_2 857671 : 866185 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1068735 : 1109545 51 Lactobacillus_phage(73.33%) capsid,terminase,holin,tail,integrase,portal attL 1067671:1067685|attR 1091223:1091237
DBSCAN-SWA_4 1374874 : 1486520 108 Lactobacillus_phage(61.54%) capsid,terminase,holin,integrase,protease,tail,transposase,head,tRNA,portal attL 1392418:1392435|attR 1461011:1461028
DBSCAN-SWA_5 1970546 : 1979063 8 Lactobacillus_phage(85.71%) NA NA
DBSCAN-SWA_6 2764853 : 2875768 101 Lactobacillus_phage(26.67%) transposase,protease,tRNA,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP035171
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035171_1 8103-8204 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035171_1 1.1|8127|54|CP035171|CRISPRCasFinder 8127-8180 54 NZ_CP035171 Lactobacillus plantarum strain SRCM103418 plasmid unnamed3 8127-8180 0 1.0
CP035171_1 1.1|8127|54|CP035171|CRISPRCasFinder 8127-8180 54 NZ_CP025589 Lactobacillus plantarum strain KC3 plasmid unnamed3, complete sequence 21850-21903 3 0.944

1. spacer 1.1|8127|54|CP035171|CRISPRCasFinder matches to NZ_CP035171 (Lactobacillus plantarum strain SRCM103418 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gattagccattacagaatagcagtatagcttaccatatgagagctatcgctcaa	CRISPR spacer
gattagccattacagaatagcagtatagcttaccatatgagagctatcgctcaa	Protospacer
******************************************************

2. spacer 1.1|8127|54|CP035171|CRISPRCasFinder matches to NZ_CP025589 (Lactobacillus plantarum strain KC3 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.944

gattagccattacagaatagcagtatagcttaccatatgagagctatcgctcaa-	CRISPR spacer
gattagccattagagaatagcagtatagcttaccatatgggagcta-cgctcaaa	Protospacer
************ **************************.****** ******* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage