Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 0 crisprs NA 0 0 1 0
CP035117 Lactobacillus plantarum strain SRCM103295 plasmid unnamed4 0 crisprs NA 0 0 0 0
CP035114 Lactobacillus plantarum strain SRCM103295 plasmid unnamed1 0 crisprs NA 0 0 1 0
CP035113 Lactobacillus plantarum strain SRCM103295 chromosome, complete genome 2 crisprs csa3,DinG,cas3,DEDDh 2 10 5 0
CP035118 Lactobacillus plantarum strain SRCM103295 plasmid unnamed5 0 crisprs NA 0 0 0 0
CP035116 Lactobacillus plantarum strain SRCM103295 plasmid unnamed3 0 crisprs NA 0 0 2 0

Results visualization

1. CP035116
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7878 : 63804 53 Lactobacillus_phage(25.0%) holin,transposase NA
DBSCAN-SWA_2 74749 : 135355 50 unidentified_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP035113
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035113_1 347778-348275 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035113_2 1084172-1088205 Orphan NA
45 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP035113_1 1.1|347796|18|CP035113|CRT 347796-347813 18 CP035113.1 2856471-2856488 2 0.889
CP035113_1 1.12|348204|18|CP035113|CRT 348204-348221 18 CP035113.1 1236855-1236872 2 0.889

1. spacer 1.1|347796|18|CP035113|CRT matches to position: 2856471-2856488, mismatch: 2, identity: 0.889

gccgctaagaaacataag	CRISPR spacer
gccgctaaggaacatcag	Protospacer
*********.***** **

2. spacer 1.12|348204|18|CP035113|CRT matches to position: 1236855-1236872, mismatch: 2, identity: 0.889

tcttccaagaagcatggt	CRISPR spacer
tcttccaagaacaatggt	Protospacer
***********  *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21244-21265 1 0.955
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15865-15886 1 0.955
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9802-9823 1 0.955
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9946-9967 1 0.955
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1753-1792 2 0.95
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152041-152068 2 0.929
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21082-21103 2 0.909
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15469-15490 2 0.909
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15577-15598 2 0.909
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15703-15724 2 0.909
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9640-9661 2 0.909
CP035113_2 2.28|1086622|22|CP035113|CRT 1086622-1086643 22 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2077-2098 2 0.909
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19970-19997 2 0.929
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15595-15628 3 0.912
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15721-15754 3 0.912
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1507-1546 3 0.925
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3379-3418 3 0.925
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3691-3730 3 0.925
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151897-151936 3 0.925
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1075-1114 3 0.925
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154096-154123 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154132-154159 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1183-1210 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1561-1588 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2131-2158 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1255-1282 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1489-1516 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3097-3124 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3361-3388 3 0.893
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152023-152050 3 0.893
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157426-157453 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151879-151906 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153154-153181 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153208-153235 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154738-154765 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154936-154963 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155134-155161 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155368-155395 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155488-155515 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156268-156295 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156604-156631 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1615-1642 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1735-1762 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3547-3574 4 0.857
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154468-154495 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153826-153853 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156100-156127 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156574-156601 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 28-55 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1543-1570 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1849-1876 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2425-2452 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2689-2716 5 0.821
CP035113_2 2.12|1085206|28|CP035113|CRT 1085206-1085233 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2767-2794 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16556-16583 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17234-17261 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18038-18065 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18980-19007 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19520-19547 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151549-151576 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151585-151612 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154060-154087 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156808-156835 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156976-157003 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151861-151888 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151987-152014 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153190-153217 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154720-154747 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154918-154945 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155116-155143 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155350-155377 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155866-155893 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155920-155947 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2221-2248 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1831-1858 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2593-2620 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2875-2902 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21142-21169 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21340-21367 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15943-15970 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9700-9727 5 0.821
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9844-9871 5 0.821
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18908-18941 6 0.824
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156844-156883 6 0.85
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153952-153979 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154774-154801 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155170-155197 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155224-155251 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155404-155431 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157282-157309 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157318-157345 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157606-157633 6 0.786
CP035113_2 2.31|1086820|28|CP035113|CRT 1086820-1086847 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1345-1372 6 0.786
CP035113_1 1.2|347832|30|CP035113|CRT 347832-347861 30 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 31047-31076 7 0.767
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18398-18431 7 0.794
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19118-19151 7 0.794
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21442-21475 7 0.794
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154504-154543 7 0.825
CP035113_2 2.26|1086472|46|CP035113|CRT 1086472-1086517 46 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156010-156055 7 0.848
CP035113_1 1.2|347832|30|CP035113|CRT 347832-347861 30 NC_042345 Phage Salvo, complete genome 4721-4750 8 0.733
CP035113_2 2.8|1084936|46|CP035113|CRT 1084936-1084981 46 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153064-153109 8 0.826
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18188-18221 8 0.765
CP035113_2 2.10|1085080|34|CP035113|CRT 1085080-1085113 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19670-19703 8 0.765
CP035113_2 2.11|1085140|40|CP035113|CRT 1085140-1085179 40 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155746-155785 8 0.8
CP035113_2 2.26|1086472|46|CP035113|CRT 1086472-1086517 46 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155710-155755 8 0.826
CP035113_2 2.8|1084936|46|CP035113|CRT 1084936-1084981 46 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156358-156403 9 0.804
CP035113_2 2.8|1084936|46|CP035113|CRT 1084936-1084981 46 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154258-154303 10 0.783
CP035113_2 2.8|1084936|46|CP035113|CRT 1084936-1084981 46 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2767-2812 10 0.783
CP035113_2 2.26|1086472|46|CP035113|CRT 1086472-1086517 46 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3223-3268 10 0.783
CP035113_2 2.16|1085476|76|CP035113|CRT 1085476-1085551 76 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3013-3088 21 0.724
CP035113_2 2.18|1085668|76|CP035113|CRT 1085668-1085743 76 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156292-156367 21 0.724
CP035113_2 2.18|1085668|76|CP035113|CRT 1085668-1085743 76 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3013-3088 24 0.684

1. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.955

cgattctgactcagacagtgat	CRISPR spacer
cgattcggactcagacagtgat	Protospacer
****** ***************

2. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgattctgactcagacagtgat	CRISPR spacer
cgattcggactcagacagtgat	Protospacer
****** ***************

3. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.955

cgattctgactcagacagtgat	CRISPR spacer
cgattcggactcagacagtgat	Protospacer
****** ***************

4. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.955

cgattctgactcagacagtgat	CRISPR spacer
cgattcggactcagacagtgat	Protospacer
****** ***************

5. spacer 2.11|1085140|40|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.95

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
cgacagtgattcggactctgacagcgattcggactccgac	Protospacer
************ ***** *********************

6. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.929

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactctgacagcgattcggatagcgac	Protospacer
******.*****.***************

7. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.909

cgattctgactcagacagtgat	CRISPR spacer
tgattcagactcagacagtgat	Protospacer
.***** ***************

8. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgattctgactcagacagtgat	CRISPR spacer
tgattcagactcagacagtgat	Protospacer
.***** ***************

9. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgattctgactcagacagtgat	CRISPR spacer
tgattcagactcagacagtgat	Protospacer
.***** ***************

10. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgattctgactcagacagtgat	CRISPR spacer
tgattcagactcagacagtgat	Protospacer
.***** ***************

11. spacer 2.28|1086622|22|CP035113|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.909

cgattctgactcagacagtgat	CRISPR spacer
tgattcagactcagacagtgat	Protospacer
.***** ***************

12. spacer 2.28|1086622|22|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.909

cgattctgactcagacagtgat	CRISPR spacer
cgattctgactctgacagtgac	Protospacer
************ ********.

13. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

agatagcgacagcgactcagattccgac	CRISPR spacer
agatagcgacagcgactctgattcagac	Protospacer
****************** ***** ***

14. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agactcagatagcgactccgattcagacagtgat	Protospacer
 ***** *********** ***************

15. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agactcagatagcgactccgattcagacagtgat	Protospacer
 ***** *********** ***************

16. spacer 2.11|1085140|40|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.925

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
ggacagcgactctgactcggacagcgattcggactccgac	Protospacer
 *****.**.******************************

17. spacer 2.11|1085140|40|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.925

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
ggacagtgattccgactctgacagcgattcggactccgac	Protospacer
 ***********.***** *********************

18. spacer 2.11|1085140|40|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.925

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
ggacagtgattccgactctgacagcgattcggactccgac	Protospacer
 ***********.***** *********************

19. spacer 2.11|1085140|40|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.925

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
tgacagtgactctgactcggacagtgattcggactccgac	Protospacer
.********.**************.***************

20. spacer 2.11|1085140|40|CP035113|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.925

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
tgacagcgactctgactcggacagcgattcggactccgac	Protospacer
.*****.**.******************************

21. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggatagtgac	Protospacer
 ***********.***********.***

22. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggatagtgac	Protospacer
 ***********.***********.***

23. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
tgattccgacagtgattcggacagcgac	Protospacer
 **.*****************.******

24. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagtgattcggattccgac	Protospacer
 *********************  ****

25. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagtgactcggacagcgac	Protospacer
 **************.*****.******

26. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattcggattcggac	Protospacer
**********************   ***

27. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattcggattcggac	Protospacer
**********************   ***

28. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattcggattcggac	Protospacer
**********************   ***

29. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattcggattcggac	Protospacer
**********************   ***

30. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

agatagcgacagcgactcagattccgac	CRISPR spacer
ggatagcgacagcgactcggattcggac	Protospacer
.*****************.***** ***

31. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattcggactcggac	Protospacer
*********************.   ***

32. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattcggac	Protospacer
****************** ***   ***

33. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgactcggattctgac	Protospacer
***************.******  .***

34. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagcgattcggattcggac	Protospacer
************.*********   ***

35. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattcggac	Protospacer
****************** ***   ***

36. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattcggac	Protospacer
****************** ***   ***

37. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattcggac	Protospacer
****************** ***   ***

38. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattcggac	Protospacer
****************** ***   ***

39. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattctgac	Protospacer
****************** ***  .***

40. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattctgac	Protospacer
****************** ***  .***

41. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgattccgattcagac	Protospacer
****************** ***   ***

42. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggattccgacagtgattcggattctgac	Protospacer
***.******************  .***

43. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggactccgacagcgattcggatgctgac	Protospacer
************.*********. .***

44. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggattccgacagtgattcggattctgac	Protospacer
***.******************  .***

45. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagtgattcggactctgac	Protospacer
 ********************.  .***

46. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

47. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

48. spacer 2.12|1085206|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

49. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
tgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

50. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
ggattccgacagtgattcggactcggac	Protospacer
***.*****************.   ***

51. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

52. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
tgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

53. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
tgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

54. spacer 2.12|1085206|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ggactccgacagtgattcggatagcgac	CRISPR spacer
cgactccgacagcgattcggattctgac	Protospacer
 ***********.*********  .***

55. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agatagcgacagcgattcagacagcgat	Protospacer
***************.*****.  ***.

56. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agatagcgacagcgattcagacagcgat	Protospacer
***************.*****.  ***.

57. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agatagcgacagcgattcagacagcgat	Protospacer
***************.*****.  ***.

58. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agatagcgacagcgattcagacagcgat	Protospacer
***************.*****.  ***.

59. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agatagcgacagcgattcagacagcgat	Protospacer
***************.*****.  ***.

60. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactccgacagcgactcggattccgac	Protospacer
 **.  ************.*********

61. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactccgacagcgactcggattccgac	Protospacer
 **.  ************.*********

62. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactccgacagcgactcggattccgac	Protospacer
 **.  ************.*********

63. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggactccgacagcgactcggattccgac	Protospacer
.**.  ************.*********

64. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggactccgacagcgactcggattccgac	Protospacer
.**.  ************.*********

65. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

66. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

67. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggattcggacagcgactcggattccgac	Protospacer
.***   ***********.*********

68. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

69. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

70. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

71. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

72. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgattcggacagcgactcggattccgac	Protospacer
 ***   ***********.*********

73. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggattcggacagcgactcggattccgac	Protospacer
.***   ***********.*********

74. spacer 2.31|1086820|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactccgacagcgactcagactccgac	Protospacer
 **.  ***************.******

75. spacer 2.31|1086820|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggattctgacagcgactccgattccgac	Protospacer
.***  .*********** *********

76. spacer 2.31|1086820|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggattctgacagcgactcagactccgac	Protospacer
.***  .**************.******

77. spacer 2.31|1086820|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
ggatgctgacagcgactcggattccgac	Protospacer
.***. .***********.*********

78. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agactcagacagcgactcagattcagac	Protospacer
***.   ***************** ***

79. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agactcagacagcgactcagattcagac	Protospacer
***.   ***************** ***

80. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agactcagacagcgactcagattcagac	Protospacer
***.   ***************** ***

81. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agactcagacagcgactcagattcagac	Protospacer
***.   ***************** ***

82. spacer 2.31|1086820|28|CP035113|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

agatagcgacagcgactcagattccgac	CRISPR spacer
agactcagacagcgactcagattcagac	Protospacer
***.   ***************** ***

83. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agacagcgatagcgactctgattcagacagcgat	Protospacer
 ***  .*********** ***********.***

84. spacer 2.11|1085140|40|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.85

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
tgactccgattcggactctgacagcgattcggactccgac	Protospacer
.***  .***** ***** *********************

85. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
ggactctgacagcgactcggattccgac	Protospacer
.**.  .***********.*********

86. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactctgacagcgactcggattccgac	Protospacer
 **.  .***********.*********

87. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactctgacagcgactcggattccgac	Protospacer
 **.  .***********.*********

88. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactctgacagcgactcggattccgac	Protospacer
 **.  .***********.*********

89. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactctgacagcgactcggattccgac	Protospacer
 **.  .***********.*********

90. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
ggactcggacagcgactccgattccgac	Protospacer
.**.   *********** *********

91. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
ggactctgacagcgactccgattccgac	Protospacer
.**.  .*********** *********

92. spacer 2.31|1086820|28|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
cgactctgacagcgactccgattccgac	Protospacer
 **.  .*********** *********

93. spacer 2.31|1086820|28|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

agatagcgacagcgactcagattccgac	CRISPR spacer
tgactctgacagcgactccgattccgac	Protospacer
 **.  .*********** *********

94. spacer 1.2|347832|30|CP035113|CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 7, identity: 0.767

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
cacaagaataaagccgccaagaagctccgg	Protospacer
******** ***** ********.* . .*

95. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agatagcgatagcgactctgattcagacagcgat	Protospacer
 **.  .*********** ***********.***

96. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agatagcgatagcgactctgattcagacagcgat	Protospacer
 **.  .*********** ***********.***

97. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.794

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
tacatcagatagcgactcagattcagacagcgac	Protospacer
..  ** ***********************.**.

98. spacer 2.11|1085140|40|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.825

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
tgacagtgattccgactctgacagcgattcggatagtgac	Protospacer
.***********.***** **************.  .***

99. spacer 2.26|1086472|46|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.848

tgatagtgacagtgactccgactcggacagcgattcagactcagac	CRISPR spacer
ggactccgacagtgactccgattcggacagcgattccgactcagac	Protospacer
 **.  .**************.************** *********

100. spacer 1.2|347832|30|CP035113|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 8, identity: 0.733

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
ccggggaagtaagcggacaagaaacatact	Protospacer
*  ..**** ****** ***********  

101. spacer 2.8|1084936|46|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.826

agatagcgacagtgactccgactcggacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgactccgattcggacagtgattcggattcggac	Protospacer
.**.  ***************.******************   ***

102. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agatagcgatagcgactcagactcagacagcgac	Protospacer
 **.  .**************.********.**.

103. spacer 2.10|1085080|34|CP035113|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

cgactctgatagcgactcagattcagacagtgat	CRISPR spacer
agatagcgatagcgactcagactcagacagcgac	Protospacer
 **.  .**************.********.**.

104. spacer 2.11|1085140|40|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.8

cgacagtgattctgactcggacagcgattcggactccgac	CRISPR spacer
tgacgccgacagtgactctgacagcgattcggactccgac	Protospacer
.***. .**.  ****** *********************

105. spacer 2.26|1086472|46|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.826

tgatagtgacagtgactccgactcggacagcgattcagactcagac	CRISPR spacer
ggactccgacagtgactccgactccgacagcgattcagactcggat	Protospacer
 **.  .***************** *****************.**.

106. spacer 2.8|1084936|46|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.804

agatagcgacagtgactccgactcggacagtgattcggatagcgac	CRISPR spacer
ggactccgacagtgactccgattcggacagtgactcggattcggac	Protospacer
.**.  ***************.***********.******   ***

107. spacer 2.8|1084936|46|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.783

agatagcgacagtgactccgactcggacagtgattcggatagcgac	CRISPR spacer
cgactccgacagtgactccgactctgacagcgattcggactctgac	Protospacer
 **.  ****************** *****.********.  .***

108. spacer 2.8|1084936|46|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 10, identity: 0.783

agatagcgacagtgactccgactcggacagtgattcggatagcgac	CRISPR spacer
cgactctgacagtgactccgactccgacagcgattcggattctgac	Protospacer
 **.  .***************** *****.*********  .***

109. spacer 2.26|1086472|46|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 10, identity: 0.783

tgatagtgacagtgactccgactcggacagcgattcagactcagac	CRISPR spacer
cgactccgacagtgactccgattcggacagcgattccgacagcgac	Protospacer
.**.  .**************.************** ***   ***

110. spacer 2.16|1085476|76|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 21, identity: 0.724

ggacagcgacagtgactcagattcggacagtgattcggactcggacagcgattcagactc	CRISPR spacer
cgacagcgacagtgactcggattcggacagtgattcggactcggacagcgattcggatgc	Protospacer
 *****************.***********************************.**. *

111. spacer 2.18|1085668|76|CP035113|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 21, identity: 0.724

ggacagcgacagtgactccgattcggacagtgattcggactcggacagcgattccgactc	CRISPR spacer
ggattcggacagtgactcggattcggacagtgattcggactcggacagcgattccgactc	Protospacer
***.   *********** *****************************************

112. spacer 2.18|1085668|76|CP035113|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 24, identity: 0.684

ggacagcgacagtgactccgattcggacagtgattcggactcggacagcgatt------c	CRISPR spacer
cgacagcgacagtgactcggattcggacagtgattcggactcggacagcgattcggatgc	Protospacer
 ***************** **********************************      *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 515513 : 606468 112 Lactobacillus_phage(27.27%) protease,head,capsid,portal,tail,holin,tRNA,integrase,terminase attL 512389:512406|attR 569984:570001
DBSCAN-SWA_2 1180004 : 1189849 9 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_3 1696083 : 1783069 92 Lactobacillus_phage(78.57%) protease,lysis,capsid,holin,tail,portal,transposase,tRNA,integrase,terminase attL 1721602:1721619|attR 1789831:1789848
DBSCAN-SWA_4 2075189 : 2082522 8 Lactobacillus_phage(40.0%) head,capsid,portal,tail,terminase NA
DBSCAN-SWA_5 2769540 : 2777792 7 Streptococcus_phage(16.67%) bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP035114
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11575 : 65008 45 Lactobacillus_phage(40.0%) protease,transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP035115
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 787 : 62543 57 Staphylococcus_phage(20.0%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage