Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035005 Staphylococcus aureus strain PCFH-226 chromosome, complete genome 9 crisprs NA 4 1 0 0
CP035006 Staphylococcus aureus strain PCFH-226 plasmid pP541, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP035005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_1 165915-166127 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_2 495260-495342 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_3 1375637-1375717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_4 1380123-1380202 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_5 1589836-1589944 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_6 2542168-2542301 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_7 2566765-2566859 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_8 2611112-2611190 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035005_9 2742846-2742931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP035005_9 9.1|2742876|26|CP035005|CRISPRCasFinder 2742876-2742901 26 CP035005.1 624276-624301 0 1.0
CP035005_4 4.1|1380147|32|CP035005|CRISPRCasFinder 1380147-1380178 32 CP035005.1 1439564-1439595 1 0.969
CP035005_4 4.1|1380147|32|CP035005|CRISPRCasFinder 1380147-1380178 32 CP035005.1 2345196-2345227 1 0.969
CP035005_4 4.1|1380147|32|CP035005|CRISPRCasFinder 1380147-1380178 32 CP035005.1 2462170-2462201 1 0.969
CP035005_4 4.1|1380147|32|CP035005|CRISPRCasFinder 1380147-1380178 32 CP035005.1 2655978-2656009 1 0.969
CP035005_9 9.1|2742876|26|CP035005|CRISPRCasFinder 2742876-2742901 26 CP035005.1 1380035-1380060 1 0.962
CP035005_3 3.1|1375662|31|CP035005|CRISPRCasFinder 1375662-1375692 31 CP035005.1 1431874-1431904 2 0.935
CP035005_4 4.1|1380147|32|CP035005|CRISPRCasFinder 1380147-1380178 32 CP035005.1 1417343-1417374 2 0.938
CP035005_4 4.1|1380147|32|CP035005|CRISPRCasFinder 1380147-1380178 32 CP035005.1 2345252-2345283 2 0.938
CP035005_8 8.1|2611135|33|CP035005|CRISPRCasFinder 2611135-2611167 33 CP035005.1 1998695-1998727 2 0.939
CP035005_9 9.1|2742876|26|CP035005|CRISPRCasFinder 2742876-2742901 26 CP035005.1 154990-155015 2 0.923
CP035005_9 9.1|2742876|26|CP035005|CRISPRCasFinder 2742876-2742901 26 CP035005.1 889204-889229 2 0.923
CP035005_9 9.1|2742876|26|CP035005|CRISPRCasFinder 2742876-2742901 26 CP035005.1 1330955-1330980 2 0.923
CP035005_9 9.1|2742876|26|CP035005|CRISPRCasFinder 2742876-2742901 26 CP035005.1 1375890-1375915 2 0.923

1. spacer 9.1|2742876|26|CP035005|CRISPRCasFinder matches to position: 624276-624301, mismatch: 0, identity: 1.0

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
**************************

2. spacer 4.1|1380147|32|CP035005|CRISPRCasFinder matches to position: 1439564-1439595, mismatch: 1, identity: 0.969

cggggccccaacacagagaaattggattccca	CRISPR spacer
cggggccccaacaaagagaaattggattccca	Protospacer
************* ******************

3. spacer 4.1|1380147|32|CP035005|CRISPRCasFinder matches to position: 2345196-2345227, mismatch: 1, identity: 0.969

cggggccccaacacagagaaattggattccca	CRISPR spacer
cggggccccaacaaagagaaattggattccca	Protospacer
************* ******************

4. spacer 4.1|1380147|32|CP035005|CRISPRCasFinder matches to position: 2462170-2462201, mismatch: 1, identity: 0.969

cggggccccaacacagagaaattggattccca	CRISPR spacer
cggggccccaacaaagagaaattggattccca	Protospacer
************* ******************

5. spacer 4.1|1380147|32|CP035005|CRISPRCasFinder matches to position: 2655978-2656009, mismatch: 1, identity: 0.969

cggggccccaacacagagaaattggattccca	CRISPR spacer
cggggccccaacaaagagaaattggattccca	Protospacer
************* ******************

6. spacer 9.1|2742876|26|CP035005|CRISPRCasFinder matches to position: 1380035-1380060, mismatch: 1, identity: 0.962

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgtcagcttctatgttggggccccg	Protospacer
***.**********************

7. spacer 3.1|1375662|31|CP035005|CRISPRCasFinder matches to position: 1431874-1431904, mismatch: 2, identity: 0.935

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

8. spacer 4.1|1380147|32|CP035005|CRISPRCasFinder matches to position: 1417343-1417374, mismatch: 2, identity: 0.938

cggggccccaacacagagaaattggattccca	CRISPR spacer
cggggccccaacatagagaaattggatttcca	Protospacer
*************.**************.***

9. spacer 4.1|1380147|32|CP035005|CRISPRCasFinder matches to position: 2345252-2345283, mismatch: 2, identity: 0.938

cggggccccaacacagagaaattggattccca	CRISPR spacer
cggggccccaacaaagagaaattggattctca	Protospacer
************* ***************.**

10. spacer 8.1|2611135|33|CP035005|CRISPRCasFinder matches to position: 1998695-1998727, mismatch: 2, identity: 0.939

cagtagctggcggaaagtcagcttacaataatg	CRISPR spacer
cagaagctggcgaaaagtcagcttacaataatg	Protospacer
*** ********.********************

11. spacer 9.1|2742876|26|CP035005|CRISPRCasFinder matches to position: 154990-155015, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttttgtgttggggccccg	Protospacer
**********.*.*************

12. spacer 9.1|2742876|26|CP035005|CRISPRCasFinder matches to position: 889204-889229, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagtttctgtgttggggccccg	Protospacer
*******.****.*************

13. spacer 9.1|2742876|26|CP035005|CRISPRCasFinder matches to position: 1330955-1330980, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccaccagcttctgtgttggggccccg	Protospacer
**.*********.*************

14. spacer 9.1|2742876|26|CP035005|CRISPRCasFinder matches to position: 1375890-1375915, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgcctgctactatgttggggccccg	Protospacer
***** *** ****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035005_1 1.2|166047|34|CP035005|CRISPRCasFinder 166047-166080 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
CP035005_1 1.2|166047|34|CP035005|CRISPRCasFinder 166047-166080 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 1.2|166047|34|CP035005|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

2. spacer 1.2|166047|34|CP035005|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage