Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025834 Akkermansia muciniphila strain AMDK-19 chromosome, complete genome 2 crisprs csa3,DinG,cas3,cas2,cas1,cas4,cas5,cas8c,cas7 0 27 0 0

Results visualization

1. CP025834
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025834_1 2059783-2061436 Orphan NA
25 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025834_2 2549552-2553200 TypeI NA
54 spacers
cas2,cas1,cas4,cas3,cas5,cas8c,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025834_2 2.4|2549788|33|CP025834|CRT,CRISPRCasFinder 2549788-2549820 33 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 141785-141817 6 0.818
CP025834_2 2.57|2549792|33|CP025834|PILER-CR 2549792-2549824 33 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 141785-141817 6 0.818
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NZ_CP040996 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed4 11747-11780 7 0.794
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 NC_019555 Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence 53753-53786 7 0.794
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 HQ918180 Klebsiella phage KP27, complete genome 55541-55574 8 0.765
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NZ_CP030069 Klebsiella pneumoniae strain IA565 plasmid pDA11912.4, complete sequence 40069-40102 8 0.765
CP025834_1 1.14|2060657|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060657-2060690 34 KU886268 Freshwater phage uvFW-CGR-AMD-COM-C203, complete genome 22747-22780 8 0.765
CP025834_2 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder 2550055-2550087 33 NZ_CP028286 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence 7390-7422 8 0.758
CP025834_2 2.25|2551195|34|CP025834|CRT,CRISPRCasFinder 2551195-2551228 34 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 161425-161458 8 0.765
CP025834_2 2.30|2551529|34|CP025834|CRT,CRISPRCasFinder 2551529-2551562 34 NC_015969 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence 9577-9610 8 0.765
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 MN850582 Escherichia phage ityhuna, complete genome 44296-44329 8 0.765
CP025834_2 2.50|2552867|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552867-2552900 34 NZ_KX785327 Streptococcus suis strain 3366 plasmid unnamed2, complete sequence 1404-1437 8 0.765
CP025834_2 2.50|2552867|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552867-2552900 34 NZ_KX785329 Streptococcus suis strain 3370 plasmid unnamed1, complete sequence 1405-1438 8 0.765
CP025834_2 2.61|2550067|33|CP025834|PILER-CR 2550067-2550099 33 NZ_CP028286 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence 7390-7422 8 0.758
CP025834_2 2.78|2551241|34|CP025834|PILER-CR 2551241-2551274 34 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 161425-161458 8 0.765
CP025834_2 2.83|2551585|34|CP025834|PILER-CR 2551585-2551618 34 NC_015969 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence 9577-9610 8 0.765
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 84767-84800 9 0.735
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NC_021529 Vibrio phage nt-1, complete genome 17138-17171 9 0.735
CP025834_1 1.10|2060398|33|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060398-2060430 33 MG945599 UNVERIFIED: Microviridae sp. isolate 4382-1711, complete genome 4523-4555 9 0.727
CP025834_1 1.16|2060787|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060787-2060820 34 NC_014305 Erwinia billingiae Eb661 plasmid pEB170, complete sequence 14596-14629 9 0.735
CP025834_2 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder 2550055-2550087 33 AJ131519 Lactobacillus bacteriophage phi adh complete genome 21349-21381 9 0.727
CP025834_2 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder 2550055-2550087 33 NC_000896 Lactobacillus prophage phiadh, complete genome 21349-21381 9 0.727
CP025834_2 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder 2550055-2550087 33 MK448686 Streptococcus phage Javan157, complete genome 21611-21643 9 0.727
CP025834_2 2.15|2550525|34|CP025834|CRT,CRISPRCasFinder 2550525-2550558 34 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 524162-524195 9 0.735
CP025834_2 2.16|2550592|33|CP025834|CRT,CRISPRCasFinder 2550592-2550624 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1424221-1424253 9 0.727
CP025834_2 2.16|2550592|33|CP025834|CRT,CRISPRCasFinder 2550592-2550624 33 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 186494-186526 9 0.727
CP025834_2 2.52|2553001|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2553001-2553034 34 KU847400 UNVERIFIED: Bacillus phage Crookii, complete genome 134149-134182 9 0.735
CP025834_2 2.61|2550067|33|CP025834|PILER-CR 2550067-2550099 33 AJ131519 Lactobacillus bacteriophage phi adh complete genome 21349-21381 9 0.727
CP025834_2 2.61|2550067|33|CP025834|PILER-CR 2550067-2550099 33 NC_000896 Lactobacillus prophage phiadh, complete genome 21349-21381 9 0.727
CP025834_2 2.61|2550067|33|CP025834|PILER-CR 2550067-2550099 33 MK448686 Streptococcus phage Javan157, complete genome 21611-21643 9 0.727
CP025834_2 2.68|2550551|34|CP025834|PILER-CR 2550551-2550584 34 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 524162-524195 9 0.735
CP025834_2 2.69|2550620|33|CP025834|PILER-CR 2550620-2550652 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1424221-1424253 9 0.727
CP025834_2 2.69|2550620|33|CP025834|PILER-CR 2550620-2550652 33 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 186494-186526 9 0.727
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NZ_CP029732 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed4, complete sequence 62848-62881 10 0.706
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 KY653117 Staphylococcus phage IME1323_01, complete genome 27050-27083 10 0.706
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 MN856080 Bacteriophage sp. isolate 174, complete genome 6363-6396 10 0.706
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 KY705281 Streptococcus phage P7955, complete genome 22094-22127 10 0.706
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 KY705280 Streptococcus phage P7954, complete genome 22430-22463 10 0.706
CP025834_1 1.9|2060333|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060333-2060366 34 NC_048847 Alteromonas phage vB_AmeM_PT11-V22, complete genome 25745-25778 10 0.706
CP025834_2 2.9|2550121|34|CP025834|CRT,CRISPRCasFinder 2550121-2550154 34 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 88232-88265 10 0.706
CP025834_2 2.9|2550121|34|CP025834|CRT,CRISPRCasFinder 2550121-2550154 34 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 90504-90537 10 0.706
CP025834_2 2.9|2550121|34|CP025834|CRT,CRISPRCasFinder 2550121-2550154 34 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 83586-83619 10 0.706
CP025834_2 2.18|2550726|34|CP025834|CRT,CRISPRCasFinder 2550726-2550759 34 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 284758-284791 10 0.706
CP025834_2 2.31|2551596|34|CP025834|CRT,CRISPRCasFinder 2551596-2551629 34 KY926699 Lactococcus phage PLgY-30, complete genome 17146-17179 10 0.706
CP025834_2 2.31|2551596|34|CP025834|CRT,CRISPRCasFinder 2551596-2551629 34 KY888143 Lactococcus phage PLgW-1, complete genome 17968-18001 10 0.706
CP025834_2 2.31|2551596|34|CP025834|CRT,CRISPRCasFinder 2551596-2551629 34 KY926698 Lactococcus phage PLgY-16, complete genome 17204-17237 10 0.706
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 NC_016570 Escherichia phage vB_EcoM_CBA120, complete genome 126165-126198 10 0.706
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 JN593240 Escherichia virus CBA120, complete genome 126165-126198 10 0.706
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 MG383452 Escherichia phage FEC14, complete genome 9563-9596 10 0.706
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 KY630163 Salmonella phage S8, complete genome 109325-109358 10 0.706
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 KY787213 Salmonella phage BSP101, complete genome 55422-55455 10 0.706
CP025834_2 2.62|2550135|34|CP025834|PILER-CR 2550135-2550168 34 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 88232-88265 10 0.706
CP025834_2 2.62|2550135|34|CP025834|PILER-CR 2550135-2550168 34 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 90504-90537 10 0.706
CP025834_2 2.62|2550135|34|CP025834|PILER-CR 2550135-2550168 34 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 83586-83619 10 0.706
CP025834_2 2.71|2550758|34|CP025834|PILER-CR 2550758-2550791 34 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 284758-284791 10 0.706
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 363015-363048 11 0.676
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 MT939487 Erwinia phage pEa_SNUABM_47, complete genome 222952-222985 11 0.676
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 MT939486 Erwinia phage pEa_SNUABM_12, complete genome 223692-223725 11 0.676
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 NC_041917 Serratia phage BF, complete genome 223665-223698 11 0.676
CP025834_1 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060138-2060171 34 MT939488 Erwinia phage pEa_SNUABM_50, complete genome 222823-222856 11 0.676
CP025834_1 1.8|2060268|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060268-2060301 34 NZ_CP020910 Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence 297163-297196 11 0.676
CP025834_1 1.8|2060268|34|CP025834|PILER-CR,CRISPRCasFinder,CRT 2060268-2060301 34 NZ_CP021031 Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence 252057-252090 11 0.676
CP025834_2 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder 2551663-2551696 34 MN175388 Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence 32912-32945 11 0.676
CP025834_2 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder 2551663-2551696 34 NZ_CP048111 Klebsiella michiganensis strain BD177 plasmid unnamed3 156461-156494 11 0.676
CP025834_2 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder 2551663-2551696 34 NZ_MF190369 Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence 15933-15966 11 0.676
CP025834_2 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder 2551663-2551696 34 NZ_CP021538 Escherichia coli strain AR_0119 plasmid unitig_4, complete sequence 3606-3639 11 0.676
CP025834_2 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder 2551663-2551696 34 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 6087-6120 11 0.676
CP025834_2 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder 2551663-2551696 34 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 128003-128036 11 0.676
CP025834_2 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR 2552733-2552766 34 MK496698 Capybara microvirus Cap1_SP_87, complete genome 1879-1912 11 0.676

1. spacer 2.4|2549788|33|CP025834|CRT,CRISPRCasFinder matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 6, identity: 0.818

aataggcaaccgggcggcctgcctcgctctcta	CRISPR spacer
cataggccaccgggcggccggcctcgcacacca	Protospacer
 ****** *********** ******* * *.*

2. spacer 2.57|2549792|33|CP025834|PILER-CR matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 6, identity: 0.818

aataggcaaccgggcggcctgcctcgctctcta	CRISPR spacer
cataggccaccgggcggccggcctcgcacacca	Protospacer
 ****** *********** ******* * *.*

3. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040996 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed4) position: , mismatch: 7, identity: 0.794

catcttgt-tgttcataatgttttcctttctttta	CRISPR spacer
-atttactgtattcataatgctttcctttttttta	Protospacer
 **.*  * *.*********.********.*****

4. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to NC_019555 (Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence) position: , mismatch: 7, identity: 0.794

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
ctgacaacttcaacaagaaagggaacatcatgaa	Protospacer
**.* * * .************.*****.*****

5. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to HQ918180 (Klebsiella phage KP27, complete genome) position: , mismatch: 8, identity: 0.765

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
tttattgatgttcatgatgttttcctttctctgt	Protospacer
. * *** *******.**************.*  

6. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030069 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.4, complete sequence) position: , mismatch: 8, identity: 0.765

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
aatgtatttcttcataatgttttccttttttatt	Protospacer
 ** *  ** ******************.** * 

7. spacer 1.14|2060657|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to KU886268 (Freshwater phage uvFW-CGR-AMD-COM-C203, complete genome) position: , mismatch: 8, identity: 0.765

aaagccaaaagaagccaaaagaagccaaaagaag	CRISPR spacer
catcgaaaaagaagccaaaggaagccaaatgaaa	Protospacer
 *    *************.********* ***.

8. spacer 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
aagaaatataacaatggataatcagttctacgg	Protospacer
******** *******.*******. ** *   

9. spacer 2.25|2551195|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.765

aacaatgaacaatcaaatcaaattgcaagaaggt	CRISPR spacer
ctaaatgaaaaatcgaatcaaattgcaagatact	Protospacer
   ****** ****.*************** . *

10. spacer 2.30|2551529|34|CP025834|CRT,CRISPRCasFinder matches to NC_015969 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence) position: , mismatch: 8, identity: 0.765

gattccgttgctggtggaggggtcaggccgtccg	CRISPR spacer
caagcccgcgctggcggaggggtcaggccgtgcg	Protospacer
 *  **  .*****.**************** **

11. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 8, identity: 0.765

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
cgaaacgaaccaacaaaaaaggaaaaattatgtc	Protospacer
* ***   ********.******** ******  

12. spacer 2.50|2552867|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX785327 (Streptococcus suis strain 3366 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ataataaaatcagttaaactaaaaccaccaacaa	CRISPR spacer
ataaaaaaatcatttaaactaaaaacgaaagaaa	Protospacer
**** ******* *********** *.  *. **

13. spacer 2.50|2552867|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX785329 (Streptococcus suis strain 3370 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ataataaaatcagttaaactaaaaccaccaacaa	CRISPR spacer
ataaaaaaatcatttaaactaaaaacgaaagaaa	Protospacer
**** ******* *********** *.  *. **

14. spacer 2.61|2550067|33|CP025834|PILER-CR matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
aagaaatataacaatggataatcagttctacgg	Protospacer
******** *******.*******. ** *   

15. spacer 2.78|2551241|34|CP025834|PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.765

aacaatgaacaatcaaatcaaattgcaagaaggt	CRISPR spacer
ctaaatgaaaaatcgaatcaaattgcaagatact	Protospacer
   ****** ****.*************** . *

16. spacer 2.83|2551585|34|CP025834|PILER-CR matches to NC_015969 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence) position: , mismatch: 8, identity: 0.765

gattccgttgctggtggaggggtcaggccgtccg	CRISPR spacer
caagcccgcgctggcggaggggtcaggccgtgcg	Protospacer
 *  **  .*****.**************** **

17. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 9, identity: 0.735

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
tccatatgtgatcatattgttttcctttctttta	Protospacer
. . *   ** ***** *****************

18. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 9, identity: 0.735

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
gtcgttgatgttcataatgttttcctttggtgtt	Protospacer
  . *** ********************  * * 

19. spacer 1.10|2060398|33|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to MG945599 (UNVERIFIED: Microviridae sp. isolate 4382-1711, complete genome) position: , mismatch: 9, identity: 0.727

aaggccaaaagaagccaaaagaatccaaaggaa	CRISPR spacer
aaaaacaaaagaagtcaaaacaatccaaaaagc	Protospacer
**.. *********.***** ********... 

20. spacer 1.16|2060787|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NC_014305 (Erwinia billingiae Eb661 plasmid pEB170, complete sequence) position: , mismatch: 9, identity: 0.735

----ctactaaacctatcggaattgtgattgaaggcat	CRISPR spacer
tgcgctgc----attatcggtattgtgattgcaggcat	Protospacer
    **.*     .****** ********** ******

21. spacer 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder matches to AJ131519 (Lactobacillus bacteriophage phi adh complete genome) position: , mismatch: 9, identity: 0.727

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata	Protospacer
  .  * ****** ************** *** 

22. spacer 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder matches to NC_000896 (Lactobacillus prophage phiadh, complete genome) position: , mismatch: 9, identity: 0.727

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata	Protospacer
  .  * ****** ************** *** 

23. spacer 2.8|2550055|33|CP025834|CRT,CRISPRCasFinder matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 9, identity: 0.727

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
acaggagaaaacaatgaataaacgaatcaaaaa	Protospacer
* ...* ************** *.*******  

24. spacer 2.15|2550525|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tgcggcccgcaaggccttcaacattgcggatgat	CRISPR spacer
tgcggccagcaatgccttcaacatgattgccgag	Protospacer
******* **** *********** .. * .** 

25. spacer 2.16|2550592|33|CP025834|CRT,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727

ctctcacatgggcggtctacgaaaacggtgccg	CRISPR spacer
cgatgcaccgggcggtcgacgaatacggtgccg	Protospacer
*  *    .******** ***** *********

26. spacer 2.16|2550592|33|CP025834|CRT,CRISPRCasFinder matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.727

ctctcacatgggcggtctacgaaaacggtgccg	CRISPR spacer
tgctgtggcgggcggtcgacgaacacggtgccg	Protospacer
. **   ..******** ***** *********

27. spacer 2.52|2553001|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to KU847400 (UNVERIFIED: Bacillus phage Crookii, complete genome) position: , mismatch: 9, identity: 0.735

atccctaccattttagtagggattccttgttcca	CRISPR spacer
atccctaccattttagtaggaattaactttatgg	Protospacer
********************.***  .* * . .

28. spacer 2.61|2550067|33|CP025834|PILER-CR matches to AJ131519 (Lactobacillus bacteriophage phi adh complete genome) position: , mismatch: 9, identity: 0.727

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata	Protospacer
  .  * ****** ************** *** 

29. spacer 2.61|2550067|33|CP025834|PILER-CR matches to NC_000896 (Lactobacillus prophage phiadh, complete genome) position: , mismatch: 9, identity: 0.727

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata	Protospacer
  .  * ****** ************** *** 

30. spacer 2.61|2550067|33|CP025834|PILER-CR matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 9, identity: 0.727

aagaaataaaacaatgaataatcaaatcaaatt	CRISPR spacer
acaggagaaaacaatgaataaacgaatcaaaaa	Protospacer
* ...* ************** *.*******  

31. spacer 2.68|2550551|34|CP025834|PILER-CR matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tgcggcccgcaaggccttcaacattgcggatgat	CRISPR spacer
tgcggccagcaatgccttcaacatgattgccgag	Protospacer
******* **** *********** .. * .** 

32. spacer 2.69|2550620|33|CP025834|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727

ctctcacatgggcggtctacgaaaacggtgccg	CRISPR spacer
cgatgcaccgggcggtcgacgaatacggtgccg	Protospacer
*  *    .******** ***** *********

33. spacer 2.69|2550620|33|CP025834|PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.727

ctctcacatgggcggtctacgaaaacggtgccg	CRISPR spacer
tgctgtggcgggcggtcgacgaacacggtgccg	Protospacer
. **   ..******** ***** *********

34. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029732 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
ggtgttgtttttcataatgctttccttttagtag	Protospacer
 .* ***** *********.********.  * .

35. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to KY653117 (Staphylococcus phage IME1323_01, complete genome) position: , mismatch: 10, identity: 0.706

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
aatcttgttgttcttaattttttccatagtgcct	Protospacer
 ************ **** ****** *  * .. 

36. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to MN856080 (Bacteriophage sp. isolate 174, complete genome) position: , mismatch: 10, identity: 0.706

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
tctataactgtccatattgttttcctttctttct	Protospacer
. * * ..***.**** ***************. 

37. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to KY705281 (Streptococcus phage P7955, complete genome) position: , mismatch: 10, identity: 0.706

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
gtactcaaatttcataaatttttcctttctttta	Protospacer
   **..   *******  ***************

38. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to KY705280 (Streptococcus phage P7954, complete genome) position: , mismatch: 10, identity: 0.706

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
gtactcaaatttcataaatttttcctttctttta	Protospacer
   **..   *******  ***************

39. spacer 1.9|2060333|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NC_048847 (Alteromonas phage vB_AmeM_PT11-V22, complete genome) position: , mismatch: 10, identity: 0.706

tgcgtcatcatctacgttaaaggccttgcgggcc	CRISPR spacer
agggtcatcatctacgataaaggctttcatagtt	Protospacer
 * ************* *******.**   .*..

40. spacer 2.9|2550121|34|CP025834|CRT,CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 10, identity: 0.706

atatgcggcccgccgcgcgttcaacgttgaagct	CRISPR spacer
gctatttgcccgccgcgcgtttaacgttgaaggc	Protospacer
..   . **************.********** .

41. spacer 2.9|2550121|34|CP025834|CRT,CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 10, identity: 0.706

atatgcggcccgccgcgcgttcaacgttgaagct	CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc	Protospacer
 . * . *********** **.********** .

42. spacer 2.9|2550121|34|CP025834|CRT,CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 10, identity: 0.706

atatgcggcccgccgcgcgttcaacgttgaagct	CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc	Protospacer
 . * . *********** **.********** .

43. spacer 2.18|2550726|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gaacccgcatgatgacgcccccgccctgtcacgg	CRISPR spacer
cgagccgcaggacgacgcccccgccctgcggacg	Protospacer
 .* ***** **.***************. .  *

44. spacer 2.31|2551596|34|CP025834|CRT,CRISPRCasFinder matches to KY926699 (Lactococcus phage PLgY-30, complete genome) position: , mismatch: 10, identity: 0.706

taaactaaaaccactaaagaaaggaaacaattat	CRISPR spacer
ccaaccaaaaccacaaaagaaaggaaaagacatg	Protospacer
. ***.******** ************ .*.   

45. spacer 2.31|2551596|34|CP025834|CRT,CRISPRCasFinder matches to KY888143 (Lactococcus phage PLgW-1, complete genome) position: , mismatch: 10, identity: 0.706

taaactaaaaccactaaagaaaggaaacaattat	CRISPR spacer
ccaaccaaaaccacaaaagaaaggaaaagacatg	Protospacer
. ***.******** ************ .*.   

46. spacer 2.31|2551596|34|CP025834|CRT,CRISPRCasFinder matches to KY926698 (Lactococcus phage PLgY-16, complete genome) position: , mismatch: 10, identity: 0.706

taaactaaaaccactaaagaaaggaaacaattat	CRISPR spacer
ccaaccaaaaccacaaaagaaaggaaaagacatg	Protospacer
. ***.******** ************ .*.   

47. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to NC_016570 (Escherichia phage vB_EcoM_CBA120, complete genome) position: , mismatch: 10, identity: 0.706

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat	Protospacer
 ..* *********** *.**********. .* 

48. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to JN593240 (Escherichia virus CBA120, complete genome) position: , mismatch: 10, identity: 0.706

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat	Protospacer
 ..* *********** *.**********. .* 

49. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to MG383452 (Escherichia phage FEC14, complete genome) position: , mismatch: 10, identity: 0.706

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat	Protospacer
 ..* *********** *.**********. .* 

50. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to KY630163 (Salmonella phage S8, complete genome) position: , mismatch: 10, identity: 0.706

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat	Protospacer
 ..* *********** *.**********. .* 

51. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to KY787213 (Salmonella phage BSP101, complete genome) position: , mismatch: 10, identity: 0.706

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat	Protospacer
 ..* *********** *.**********. .* 

52. spacer 2.62|2550135|34|CP025834|PILER-CR matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 10, identity: 0.706

atatgcggcccgccgcgcgttcaacgttgaagct	CRISPR spacer
gctatttgcccgccgcgcgtttaacgttgaaggc	Protospacer
..   . **************.********** .

53. spacer 2.62|2550135|34|CP025834|PILER-CR matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 10, identity: 0.706

atatgcggcccgccgcgcgttcaacgttgaagct	CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc	Protospacer
 . * . *********** **.********** .

54. spacer 2.62|2550135|34|CP025834|PILER-CR matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 10, identity: 0.706

atatgcggcccgccgcgcgttcaacgttgaagct	CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc	Protospacer
 . * . *********** **.********** .

55. spacer 2.71|2550758|34|CP025834|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gaacccgcatgatgacgcccccgccctgtcacgg	CRISPR spacer
cgagccgcaggacgacgcccccgccctgcggacg	Protospacer
 .* ***** **.***************. .  *

56. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 11, identity: 0.676

catcttgttgttcataatgttttcct-------ttctttta	CRISPR spacer
gatcttgttgttcattatcttttcccgagcagat-------	Protospacer
 ************** ** ******.       *       

57. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to MT939487 (Erwinia phage pEa_SNUABM_47, complete genome) position: , mismatch: 11, identity: 0.676

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt	Protospacer
. . ************ .**********..  * 

58. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to MT939486 (Erwinia phage pEa_SNUABM_12, complete genome) position: , mismatch: 11, identity: 0.676

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt	Protospacer
. . ************ .**********..  * 

59. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NC_041917 (Serratia phage BF, complete genome) position: , mismatch: 11, identity: 0.676

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt	Protospacer
. . ************ .**********..  * 

60. spacer 1.6|2060138|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to MT939488 (Erwinia phage pEa_SNUABM_50, complete genome) position: , mismatch: 11, identity: 0.676

catcttgttgttcataatgttttcctttctttta	CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt	Protospacer
. . ************ .**********..  * 

61. spacer 1.8|2060268|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 11, identity: 0.676

aacgtaagcgaaaaggcccgccccctcgtaaaag	CRISPR spacer
gacggaatcgaaaaggcccgccccccgcagtgcg	Protospacer
.*** ** *****************.   . . *

62. spacer 1.8|2060268|34|CP025834|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 11, identity: 0.676

aacgtaagcgaaaaggcccgccccctcgtaaaag	CRISPR spacer
gacggaatcgaaaaggcccgccccccgcagtgcg	Protospacer
.*** ** *****************.   . . *

63. spacer 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder matches to MN175388 (Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence) position: , mismatch: 11, identity: 0.676

tttagtggttttgttattcagcatcagggatatt	CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca	Protospacer
  . ******** ********** ****..*.. 

64. spacer 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP048111 (Klebsiella michiganensis strain BD177 plasmid unnamed3) position: , mismatch: 11, identity: 0.676

tttagtggttttgttattcagcatcagggatatt	CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca	Protospacer
  . ******** ********** ****..*.. 

65. spacer 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder matches to NZ_MF190369 (Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence) position: , mismatch: 11, identity: 0.676

tttagtggttttgttattcagcatcagggatatt	CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca	Protospacer
  . ******** ********** ****..*.. 

66. spacer 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP021538 (Escherichia coli strain AR_0119 plasmid unitig_4, complete sequence) position: , mismatch: 11, identity: 0.676

tttagtggttttgttattcagcatcagggatatt	CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca	Protospacer
  . ******** ********** ****..*.. 

67. spacer 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 11, identity: 0.676

tttagtggttttgttattcagcatcagggatatt	CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca	Protospacer
  . ******** ********** ****..*.. 

68. spacer 2.32|2551663|34|CP025834|CRT,CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 11, identity: 0.676

tttagtggttttgttattcagcatcagggatatt	CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca	Protospacer
  . ******** ********** ****..*.. 

69. spacer 2.48|2552733|34|CP025834|CRT,CRISPRCasFinder,PILER-CR matches to MK496698 (Capybara microvirus Cap1_SP_87, complete genome) position: , mismatch: 11, identity: 0.676

ctaaaaccaccaacaagaaaggaaacattatgaa	CRISPR spacer
ggcaaaccaccaacaagagaggatacaccacttt	Protospacer
   ***************.**** ***..*.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage