Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034833 Salmonella sp. SSDFZ69 plasmid pTB602, complete sequence 0 crisprs NA 0 0 0 0
CP034832 Salmonella sp. SSDFZ69 plasmid pTB601, complete sequence 0 crisprs NA 0 0 1 0
CP034831 Salmonella sp. SSDFZ69 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DEDDh,DinG 0 33 5 0

Results visualization

1. CP034832
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31601 : 126654 97 Escherichia_phage(43.48%) integrase,transposase attL 57808:57867|attR 71017:71837
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034831
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034831_1 959926-961664 TypeI-E I-E
28 spacers
cas3,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034831_2 978246-979799 TypeI-E I-E
25 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP021942 Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence 40371-40402 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP012429 Klebsiella pneumoniae strain KP5 plasmid pSg1-3, complete sequence 17702-17733 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP017988 Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence 39944-39975 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP023421 Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence 1101-1132 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018715 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence 36257-36288 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018721 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-5, complete sequence 35882-35913 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018703 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-5, complete sequence 27581-27612 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP033624 Klebsiella pneumoniae strain 4743 plasmid unnamed6 28635-28666 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP036330 Klebsiella pneumoniae strain BA28434 plasmid punnamed_1_VBA28434 21551-21582 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP041953 Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence 23889-23920 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP015504 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 4, complete sequence 31659-31690 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP021957 Klebsiella pneumoniae strain AR_0107 plasmid unitig_3j2_linear_pilon, complete sequence 31049-31080 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP009276 Klebsiella variicola strain DX120E plasmid pKV2, complete sequence 29639-29670 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP026760 Klebsiella aerogenes strain AR_0062 plasmid unnamed4 36074-36105 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP028794 Klebsiella pneumoniae strain WCHKP040035 plasmid p1_040035, complete sequence 41934-41965 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP028992 Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence 34746-34777 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 CP052194 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-2, complete sequence 21888-21919 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP024837 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence 37264-37295 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP031806 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence 44374-44405 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP009878 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852, complete sequence 28669-28700 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP031794 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed2, complete sequence 29824-29855 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP024841 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_3, complete sequence 32091-32122 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP008844 Klebsiella michiganensis strain M1 plasmid pKOXM1C, complete sequence 24827-24858 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP036444 Klebsiella pneumoniae strain ABFPV plasmid tig00001255_pilon, complete sequence 6503-6534 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP024433 Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence 33980-34011 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP050366 Klebsiella pneumoniae strain 47733 plasmid p47733L, complete sequence 30768-30799 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_LR025094 Klebsiella pneumoniae isolate KP9201 plasmid 4, complete sequence 28878-28909 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP045018 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-3, complete sequence 40872-40903 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP011631 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-54, complete sequence 4735-4766 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018314 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-6, complete sequence 37911-37942 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP032191 Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence 37675-37706 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP021949 Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence 35891-35922 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018688 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence 40389-40420 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 CP052354 Klebsiella pneumoniae strain D16KP0146 plasmid unnamed 23032-23063 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_LR025090 Klebsiella pneumoniae isolate KP980 plasmid 4, complete sequence 22840-22871 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 CP052395 Klebsiella pneumoniae strain C17KP0040 plasmid unnamed 23037-23068 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP021760 Klebsiella pneumoniae strain AR_0138 plasmid tig00000003, complete sequence 47057-47088 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 CP052339 Klebsiella pneumoniae strain D17KP0018 plasmid unnamed 24175-24206 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018697 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence 42327-42358 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP018709 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence 33989-34020 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP014747 Klebsiella aerogenes strain FDAARGOS_139 plasmid unnamed 47359-47390 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 MT090961 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_54kb, complete sequence 30034-30065 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 CP038007 Klebsiella phage 020009, complete genome 24501-24532 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP021942 Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence 40371-40402 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP012429 Klebsiella pneumoniae strain KP5 plasmid pSg1-3, complete sequence 17702-17733 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP017988 Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence 39944-39975 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP023421 Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence 1101-1132 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018715 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence 36257-36288 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018721 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-5, complete sequence 35882-35913 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018703 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-5, complete sequence 27581-27612 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP033624 Klebsiella pneumoniae strain 4743 plasmid unnamed6 28635-28666 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP036330 Klebsiella pneumoniae strain BA28434 plasmid punnamed_1_VBA28434 21551-21582 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP041953 Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence 23889-23920 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP015504 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 4, complete sequence 31659-31690 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP021957 Klebsiella pneumoniae strain AR_0107 plasmid unitig_3j2_linear_pilon, complete sequence 31049-31080 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP009276 Klebsiella variicola strain DX120E plasmid pKV2, complete sequence 29639-29670 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP026760 Klebsiella aerogenes strain AR_0062 plasmid unnamed4 36074-36105 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP028794 Klebsiella pneumoniae strain WCHKP040035 plasmid p1_040035, complete sequence 41934-41965 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP028992 Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence 34746-34777 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 CP052194 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-2, complete sequence 21888-21919 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP024837 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence 37264-37295 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP031806 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence 44374-44405 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP009878 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852, complete sequence 28669-28700 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP031794 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed2, complete sequence 29824-29855 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP024841 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_3, complete sequence 32091-32122 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP008844 Klebsiella michiganensis strain M1 plasmid pKOXM1C, complete sequence 24827-24858 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP036444 Klebsiella pneumoniae strain ABFPV plasmid tig00001255_pilon, complete sequence 6503-6534 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP024433 Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence 33980-34011 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP050366 Klebsiella pneumoniae strain 47733 plasmid p47733L, complete sequence 30768-30799 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_LR025094 Klebsiella pneumoniae isolate KP9201 plasmid 4, complete sequence 28878-28909 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP045018 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-3, complete sequence 40872-40903 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP011631 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-54, complete sequence 4735-4766 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018314 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-6, complete sequence 37911-37942 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP032191 Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence 37675-37706 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP021949 Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence 35891-35922 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018688 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence 40389-40420 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 CP052354 Klebsiella pneumoniae strain D16KP0146 plasmid unnamed 23032-23063 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_LR025090 Klebsiella pneumoniae isolate KP980 plasmid 4, complete sequence 22840-22871 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 CP052395 Klebsiella pneumoniae strain C17KP0040 plasmid unnamed 23037-23068 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP021760 Klebsiella pneumoniae strain AR_0138 plasmid tig00000003, complete sequence 47057-47088 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 CP052339 Klebsiella pneumoniae strain D17KP0018 plasmid unnamed 24175-24206 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018697 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence 42327-42358 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP018709 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence 33989-34020 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP014747 Klebsiella aerogenes strain FDAARGOS_139 plasmid unnamed 47359-47390 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 MT090961 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_54kb, complete sequence 30034-30065 3 0.906
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 CP038007 Klebsiella phage 020009, complete genome 24501-24532 3 0.906
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_AP023151 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03S, complete sequence 42476-42507 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 26846-26877 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP026270 Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence 28531-28562 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP027046 Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence 30767-30798 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP034057 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed4, complete sequence 17226-17257 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 1026-1057 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 48139-48170 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 105006-105037 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP034049 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed4, complete sequence 12349-12380 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NZ_CP032224 Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence 32140-32171 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 KY271402 Klebsiella phage 48ST307, complete genome 23493-23524 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NC_005857 Klebsiella phage phiKO2, complete genome 2053-2084 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 AY374448 Bacteriophage phiKO2, complete genome 2053-2084 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 NC_009235 Burkholderia phage phi644-2 chromosome, complete genome 2060-2091 4 0.875
CP034831_1 1.11|960566|32|CP034831|PILER-CR 960566-960597 32 CP000625 Burkholderia phage phi644-2, complete genome 2060-2091 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_AP023151 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03S, complete sequence 42476-42507 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 26846-26877 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP026270 Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence 28531-28562 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP027046 Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence 30767-30798 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP034057 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed4, complete sequence 17226-17257 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 1026-1057 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 48139-48170 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 105006-105037 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP034049 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed4, complete sequence 12349-12380 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NZ_CP032224 Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence 32140-32171 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 KY271402 Klebsiella phage 48ST307, complete genome 23493-23524 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NC_005857 Klebsiella phage phiKO2, complete genome 2053-2084 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 AY374448 Bacteriophage phiKO2, complete genome 2053-2084 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 NC_009235 Burkholderia phage phi644-2 chromosome, complete genome 2060-2091 4 0.875
CP034831_1 1.19|960565|32|CP034831|CRISPRCasFinder,CRT 960565-960596 32 CP000625 Burkholderia phage phi644-2, complete genome 2060-2091 4 0.875
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MK542015 Escherichia phage ZCEC5, complete genome 28472-28503 4 0.875
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MN856022 Bacteriophage sp. isolate 138, complete genome 14137-14168 4 0.875
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MT682064 Klebsiella virus KpV2811, complete genome 24796-24827 5 0.844
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MK327140 Klebsiella phage YX3973, complete genome 42756-42787 5 0.844
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MK468591 Mycobacterium phage Arissanae, complete genome 46680-46711 5 0.844
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MN106244 Klebsiella phage Soft, complete genome 13317-13348 5 0.844
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 GU196278 Escherichia phage K1H, complete genome 25318-25349 5 0.844
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 NC_027993 Escherichia phage K1G, complete genome 26932-26963 5 0.844
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 NC_048732 Klebsiella phage Seifer, complete genome 45048-45079 5 0.844
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 49429-49460 6 0.812
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 49429-49460 6 0.812
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 GU196279 Escherichia phage K1ind1, complete genome 26177-26208 6 0.812
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MN369764 Mycobacterium phage Rahalelujah, complete genome 46315-46346 6 0.812
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MN234167 Mycobacterium phage Vanisoa, complete genome 47002-47033 6 0.812
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 95505-95536 6 0.812
CP034831_2 2.27|979684|29|CP034831|PILER-CR 979684-979712 29 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 69198-69226 6 0.793
CP034831_1 1.14|960749|32|CP034831|PILER-CR 960749-960780 32 KC821624 Cellulophaga phage phi14:2, complete genome 72424-72455 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 583732-583763 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 571738-571769 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 611822-611853 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 598128-598159 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 332677-332708 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 585638-585669 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 583732-583763 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 598128-598159 7 0.781
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 570889-570920 7 0.781
CP034831_1 1.18|960504|32|CP034831|CRISPRCasFinder,CRT 960504-960535 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 247513-247544 7 0.781
CP034831_1 1.22|960748|32|CP034831|CRISPRCasFinder,CRT 960748-960779 32 KC821624 Cellulophaga phage phi14:2, complete genome 72424-72455 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 583732-583763 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 571738-571769 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 611822-611853 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 598128-598159 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 332677-332708 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 585638-585669 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 583732-583763 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 598128-598159 7 0.781
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 570889-570920 7 0.781
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MF415411 Klebsiella phage KPN U2874, complete genome 50176-50207 7 0.781
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MF476924 Klebsiella phage YMC15/11/N53_KPN_BP, complete genome 50176-50207 7 0.781
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MF415413 Klebsiella phage KPN N54, complete genome 50176-50207 7 0.781
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MF415410 Klebsiella phage KPN N137, complete genome 50176-50207 7 0.781
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 MG835858 Klebsiella phage KPN N98, complete genome 50290-50321 7 0.781
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 NZ_CP021084 Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence 271054-271085 7 0.781
CP034831_1 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961238-961269 32 MN693771 Marine virus AFVG_250M633, complete genome 57996-58027 7 0.781
CP034831_2 2.1|978275|32|CP034831|CRISPRCasFinder,CRT 978275-978306 32 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 155676-155707 7 0.781
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 59505-59536 7 0.781
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 MH744423 Mycobacterium phage Saguaro, complete genome 22189-22220 7 0.781
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 78664-78695 7 0.781
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_CP050314 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_1, complete sequence 143113-143144 7 0.781
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 78664-78695 7 0.781
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 78664-78695 7 0.781
CP034831_1 1.3|960077|32|CP034831|PILER-CR,CRISPRCasFinder,CRT 960077-960108 32 NZ_CP038501 Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence 28606-28637 8 0.75
CP034831_1 1.7|960321|32|CP034831|PILER-CR,CRISPRCasFinder,CRT 960321-960352 32 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 72869-72900 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 427358-427389 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1301925-1301956 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1276364-1276395 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 419352-419383 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1369473-1369504 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 9849-9880 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 422363-422394 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 416862-416893 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 877463-877494 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1083906-1083937 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 444437-444468 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 772749-772780 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 674207-674238 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 992649-992680 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 303717-303748 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1205655-1205686 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 591829-591860 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 568284-568315 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 437562-437593 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1433216-1433247 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1206216-1206247 8 0.75
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1301932-1301963 8 0.75
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 492297-492328 8 0.75
CP034831_1 1.18|960504|32|CP034831|CRISPRCasFinder,CRT 960504-960535 32 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 110996-111027 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 427358-427389 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1301925-1301956 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1276364-1276395 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 419352-419383 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1369473-1369504 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 9849-9880 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 422363-422394 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 416862-416893 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 877463-877494 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1083906-1083937 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 444437-444468 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 772749-772780 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 674207-674238 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 992649-992680 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 303717-303748 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1205655-1205686 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 591829-591860 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 568284-568315 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 437562-437593 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1433216-1433247 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1206216-1206247 8 0.75
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1301932-1301963 8 0.75
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 492297-492328 8 0.75
CP034831_1 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961177-961208 32 NZ_HG938357 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141b, complete sequence 119462-119493 8 0.75
CP034831_1 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961238-961269 32 MG711460 Faecalibacterium phage FP_Mushu, complete genome 15370-15401 8 0.75
CP034831_2 2.1|978275|32|CP034831|CRISPRCasFinder,CRT 978275-978306 32 NZ_AP015033 Pseudomonas putida strain KF715 plasmid pKF715D, complete sequence 21099-21130 8 0.75
CP034831_2 2.1|978275|32|CP034831|CRISPRCasFinder,CRT 978275-978306 32 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 390439-390470 8 0.75
CP034831_2 2.1|978275|32|CP034831|CRISPRCasFinder,CRT 978275-978306 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 742764-742795 8 0.75
CP034831_2 2.1|978275|32|CP034831|CRISPRCasFinder,CRT 978275-978306 32 NZ_CP016851 Pseudomonas sp. TMW 2.1634 plasmid pL21634-2, complete sequence 44708-44739 8 0.75
CP034831_2 2.4|978458|32|CP034831|CRISPRCasFinder,CRT 978458-978489 32 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 33185-33216 8 0.75
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 895405-895436 8 0.75
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 447008-447039 8 0.75
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1839513-1839544 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 294396-294427 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 125791-125822 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_KJ776585 Clostridium botulinum strain DB2 plasmid pDB2, complete sequence 330-361 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_CP019901 Raoultella planticola strain GODA plasmid unnamed2 23941-23972 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_KJ776583 Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence 330-361 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 330-361 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_KJ776579 Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence 330-361 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 313-344 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 34424-34455 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 CP023136 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid 8054-8085 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 CP052179 Klebsiella pneumoniae strain F16KP0045 plasmid unnamed 8095-8126 8 0.75
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_CP026187 Enterobacteriaceae bacterium ENNIH2 plasmid unnamed, complete sequence 23937-23968 8 0.75
CP034831_2 2.13|979007|32|CP034831|CRISPRCasFinder,CRT 979007-979038 32 NZ_CP049245 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence 161343-161374 8 0.75
CP034831_2 2.13|979007|32|CP034831|CRISPRCasFinder,CRT 979007-979038 32 NZ_CP015741 Shinella sp. HZN7 plasmid pShin-05, complete sequence 68057-68088 8 0.75
CP034831_2 2.21|979495|32|CP034831|CRISPRCasFinder,CRT 979495-979526 32 MN026741 Salmonella phage Th1, complete genome 9616-9647 8 0.75
CP034831_2 2.24|979678|32|CP034831|CRISPRCasFinder,CRT 979678-979709 32 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 69195-69226 8 0.75
CP034831_1 1.10|960504|33|CP034831|PILER-CR 960504-960536 33 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 110995-111027 9 0.727
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 222041-222072 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 114196-114227 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 641366-641397 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 113319-113350 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 373594-373625 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 112229-112260 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 164622-164653 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 103879-103910 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 172001-172032 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 291694-291725 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 216440-216471 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 858311-858342 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 556199-556230 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NC_008388 Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence 2550-2581 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 222041-222072 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 114196-114227 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 641366-641397 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 113319-113350 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 373594-373625 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 112229-112260 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 164622-164653 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 103879-103910 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 172001-172032 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 291694-291725 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 216440-216471 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 858311-858342 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 556199-556230 9 0.719
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NC_008388 Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence 2550-2581 9 0.719
CP034831_1 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961238-961269 32 MK493321 Cyanophage S-RIM4 isolate RW_11_0999, complete genome 148420-148451 9 0.719
CP034831_2 2.3|978397|32|CP034831|CRISPRCasFinder,CRT 978397-978428 32 KY984068 Erwinia phage vB_EamM_Y3, complete genome 254639-254670 9 0.719
CP034831_2 2.3|978397|32|CP034831|CRISPRCasFinder,CRT 978397-978428 32 NC_021976 Acetobacter pasteurianus 386B plasmid Apa386Bp1, complete sequence 27026-27057 9 0.719
CP034831_2 2.3|978397|32|CP034831|CRISPRCasFinder,CRT 978397-978428 32 NZ_AP014882 Acetobacter pasteurianus NBRC 101655 plasmid plasmid1 DNA, complete genome 138011-138042 9 0.719
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 249936-249967 9 0.719
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 137680-137711 9 0.719
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 433707-433738 9 0.719
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 4722-4753 9 0.719
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 80295-80326 9 0.719
CP034831_2 2.8|978702|32|CP034831|CRISPRCasFinder,CRT 978702-978733 32 MN855673 Bacteriophage sp. isolate 200, complete genome 4451-4482 9 0.719
CP034831_2 2.9|978763|32|CP034831|CRISPRCasFinder,CRT 978763-978794 32 NZ_CP021461 Lactobacillus brevis strain ZLB004 plasmid p5, complete sequence 3476-3507 9 0.719
CP034831_2 2.9|978763|32|CP034831|CRISPRCasFinder,CRT 978763-978794 32 NZ_CP035169 Lactobacillus plantarum strain SRCM103418 plasmid unnamed1 3519-3550 9 0.719
CP034831_2 2.9|978763|32|CP034831|CRISPRCasFinder,CRT 978763-978794 32 NZ_CP035169 Lactobacillus plantarum strain SRCM103418 plasmid unnamed1 60508-60539 9 0.719
CP034831_2 2.9|978763|32|CP034831|CRISPRCasFinder,CRT 978763-978794 32 NZ_CP047122 Lactobacillus hilgardii strain FLUB plasmid unnamed1 28415-28446 9 0.719
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 191485-191516 9 0.719
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_015918 Borreliella bissettii DN127 plasmid lp28-7, complete sequence 1441-1472 9 0.719
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 191485-191516 9 0.719
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 191485-191516 9 0.719
CP034831_2 2.10|978824|32|CP034831|CRISPRCasFinder,CRT 978824-978855 32 NZ_CP043029 Pseudobutyrivibrio xylanivorans strain MA3014 plasmid pNP95, complete sequence 82004-82035 9 0.719
CP034831_2 2.17|979251|32|CP034831|CRISPRCasFinder,CRT 979251-979282 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 253137-253168 9 0.719
CP034831_2 2.20|979434|32|CP034831|CRISPRCasFinder,CRT 979434-979465 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 680887-680918 9 0.719
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 213753-213784 10 0.688
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 213753-213784 10 0.688
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 212194-212225 10 0.688
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 216441-216472 10 0.688
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 210559-210590 10 0.688
CP034831_1 1.12|960627|32|CP034831|PILER-CR 960627-960658 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 213753-213784 10 0.688
CP034831_1 1.14|960749|32|CP034831|PILER-CR 960749-960780 32 NZ_CP029731 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence 6635-6666 10 0.688
CP034831_1 1.15|960810|32|CP034831|PILER-CR 960810-960841 32 CP054911 Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence 147309-147340 10 0.688
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 213753-213784 10 0.688
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 213753-213784 10 0.688
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 212194-212225 10 0.688
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 216441-216472 10 0.688
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 210559-210590 10 0.688
CP034831_1 1.20|960626|32|CP034831|CRISPRCasFinder,CRT 960626-960657 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 213753-213784 10 0.688
CP034831_1 1.22|960748|32|CP034831|CRISPRCasFinder,CRT 960748-960779 32 NZ_CP029731 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence 6635-6666 10 0.688
CP034831_1 1.23|960809|32|CP034831|CRISPRCasFinder,CRT 960809-960840 32 CP054911 Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence 147309-147340 10 0.688
CP034831_1 1.27|961055|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961055-961086 32 MH617588 Microviridae sp. isolate ctec913, complete genome 725-756 10 0.688
CP034831_1 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961238-961269 32 MT774404 CrAssphage cr114_1, complete genome 87913-87944 10 0.688
CP034831_1 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961421-961452 32 MK482690 Escherichia phage vB_EcoM_LMP34, partial genome 9521-9552 10 0.688
CP034831_1 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961421-961452 32 MK482689 Escherichia phage vB_EcoM_LMP33, complete genome 68795-68826 10 0.688
CP034831_1 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961421-961452 32 MK482688 Escherichia phage vB_EcoM_LMP25, complete genome 84709-84740 10 0.688
CP034831_1 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR 961421-961452 32 KT184316 Enterobacteria phage XTG1, complete genome 83623-83654 10 0.688
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP016500 Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence 181410-181441 10 0.688
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1147674-1147705 10 0.688
CP034831_2 2.11|978885|32|CP034831|CRISPRCasFinder,CRT 978885-978916 32 NZ_CP009059 Borreliella afzelii K78 plasmid lp54, complete sequence 54438-54469 10 0.688
CP034831_2 2.11|978885|32|CP034831|CRISPRCasFinder,CRT 978885-978916 32 NZ_CP009214 Borreliella afzelii Tom3107 plasmid lp54, complete sequence 2818-2849 10 0.688
CP034831_2 2.11|978885|32|CP034831|CRISPRCasFinder,CRT 978885-978916 32 NC_017241 Borreliella afzelii PKo plasmid lp54, complete sequence 55282-55313 10 0.688
CP034831_2 2.12|978946|32|CP034831|CRISPRCasFinder,CRT 978946-978977 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 76397-76428 10 0.688
CP034831_2 2.18|979312|32|CP034831|CRISPRCasFinder,CRT 979312-979343 32 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 60653-60684 10 0.688
CP034831_1 1.6|960260|32|CP034831|PILER-CR,CRISPRCasFinder,CRT 960260-960291 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 188289-188320 11 0.656
CP034831_1 1.6|960260|32|CP034831|PILER-CR,CRISPRCasFinder,CRT 960260-960291 32 NC_011732 Gloeothece citriformis PCC 7424 plasmid pP742404, complete sequence 10709-10740 11 0.656
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 550680-550711 11 0.656
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 158720-158751 11 0.656
CP034831_2 2.7|978641|32|CP034831|CRISPRCasFinder,CRT 978641-978672 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1262388-1262419 11 0.656

1. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP021942 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

2. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP012429 (Klebsiella pneumoniae strain KP5 plasmid pSg1-3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

3. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP017988 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

4. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP023421 (Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

5. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018715 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

6. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018721 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

7. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018703 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

8. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP033624 (Klebsiella pneumoniae strain 4743 plasmid unnamed6) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

9. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP036330 (Klebsiella pneumoniae strain BA28434 plasmid punnamed_1_VBA28434) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

10. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP041953 (Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

11. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP015504 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

12. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP021957 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_3j2_linear_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

13. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP009276 (Klebsiella variicola strain DX120E plasmid pKV2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

14. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP026760 (Klebsiella aerogenes strain AR_0062 plasmid unnamed4) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

15. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP028794 (Klebsiella pneumoniae strain WCHKP040035 plasmid p1_040035, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

16. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP028992 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

17. spacer 1.11|960566|32|CP034831|PILER-CR matches to CP052194 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

18. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP024837 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

19. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP031806 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

20. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP009878 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

21. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP031794 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

22. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP024841 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

23. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP008844 (Klebsiella michiganensis strain M1 plasmid pKOXM1C, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

24. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP036444 (Klebsiella pneumoniae strain ABFPV plasmid tig00001255_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

25. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP024433 (Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

26. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP050366 (Klebsiella pneumoniae strain 47733 plasmid p47733L, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

27. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_LR025094 (Klebsiella pneumoniae isolate KP9201 plasmid 4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

28. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP045018 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

29. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP011631 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-54, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

30. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018314 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-6, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

31. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP032191 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

32. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP021949 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

33. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018688 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

34. spacer 1.11|960566|32|CP034831|PILER-CR matches to CP052354 (Klebsiella pneumoniae strain D16KP0146 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

35. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_LR025090 (Klebsiella pneumoniae isolate KP980 plasmid 4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

36. spacer 1.11|960566|32|CP034831|PILER-CR matches to CP052395 (Klebsiella pneumoniae strain C17KP0040 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

37. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP021760 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000003, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

38. spacer 1.11|960566|32|CP034831|PILER-CR matches to CP052339 (Klebsiella pneumoniae strain D17KP0018 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

39. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018697 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

40. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP018709 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

41. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP014747 (Klebsiella aerogenes strain FDAARGOS_139 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

42. spacer 1.11|960566|32|CP034831|PILER-CR matches to MT090961 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_54kb, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

43. spacer 1.11|960566|32|CP034831|PILER-CR matches to CP038007 (Klebsiella phage 020009, complete genome) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

44. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021942 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

45. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP012429 (Klebsiella pneumoniae strain KP5 plasmid pSg1-3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

46. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP017988 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

47. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP023421 (Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

48. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018715 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

49. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018721 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

50. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018703 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

51. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP033624 (Klebsiella pneumoniae strain 4743 plasmid unnamed6) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

52. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP036330 (Klebsiella pneumoniae strain BA28434 plasmid punnamed_1_VBA28434) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

53. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP041953 (Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

54. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP015504 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

55. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021957 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_3j2_linear_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

56. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP009276 (Klebsiella variicola strain DX120E plasmid pKV2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

57. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP026760 (Klebsiella aerogenes strain AR_0062 plasmid unnamed4) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

58. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP028794 (Klebsiella pneumoniae strain WCHKP040035 plasmid p1_040035, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

59. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP028992 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

60. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to CP052194 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

61. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP024837 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

62. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP031806 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

63. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP009878 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

64. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP031794 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

65. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP024841 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

66. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP008844 (Klebsiella michiganensis strain M1 plasmid pKOXM1C, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

67. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP036444 (Klebsiella pneumoniae strain ABFPV plasmid tig00001255_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

68. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP024433 (Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

69. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP050366 (Klebsiella pneumoniae strain 47733 plasmid p47733L, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

70. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_LR025094 (Klebsiella pneumoniae isolate KP9201 plasmid 4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

71. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP045018 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-3, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

72. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP011631 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-54, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

73. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018314 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-6, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

74. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP032191 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

75. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021949 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

76. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018688 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

77. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to CP052354 (Klebsiella pneumoniae strain D16KP0146 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

78. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_LR025090 (Klebsiella pneumoniae isolate KP980 plasmid 4, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

79. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to CP052395 (Klebsiella pneumoniae strain C17KP0040 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

80. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021760 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000003, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

81. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to CP052339 (Klebsiella pneumoniae strain D17KP0018 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

82. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018697 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

83. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP018709 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

84. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP014747 (Klebsiella aerogenes strain FDAARGOS_139 plasmid unnamed) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

85. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to MT090961 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_54kb, complete sequence) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

86. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to CP038007 (Klebsiella phage 020009, complete genome) position: , mismatch: 3, identity: 0.906

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaggt	Protospacer
 .********* ********************

87. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_AP023151 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03S, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

88. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

89. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP026270 (Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttactgatacaccaggt	Protospacer
 .********* *****.**************

90. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP027046 (Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

91. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP034057 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaagt	Protospacer
 .********* *****************.**

92. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

93. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

94. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

95. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP034049 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaagt	Protospacer
 .********* *****************.**

96. spacer 1.11|960566|32|CP034831|PILER-CR matches to NZ_CP032224 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

97. spacer 1.11|960566|32|CP034831|PILER-CR matches to KY271402 (Klebsiella phage 48ST307, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

98. spacer 1.11|960566|32|CP034831|PILER-CR matches to NC_005857 (Klebsiella phage phiKO2, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttactgatacaccaggt	Protospacer
 .********* *****.**************

99. spacer 1.11|960566|32|CP034831|PILER-CR matches to AY374448 (Bacteriophage phiKO2, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttactgatacaccaggt	Protospacer
 .********* *****.**************

100. spacer 1.11|960566|32|CP034831|PILER-CR matches to NC_009235 (Burkholderia phage phi644-2 chromosome, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
ttcttgccgatcacgttgctgatacaccacgt	Protospacer
* .** *********************** **

101. spacer 1.11|960566|32|CP034831|PILER-CR matches to CP000625 (Burkholderia phage phi644-2, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
ttcttgccgatcacgttgctgatacaccacgt	Protospacer
* .** *********************** **

102. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_AP023151 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03S, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

103. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

104. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP026270 (Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttactgatacaccaggt	Protospacer
 .********* *****.**************

105. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP027046 (Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

106. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP034057 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaagt	Protospacer
 .********* *****************.**

107. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

108. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

109. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

110. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP034049 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttgctgatacaccaagt	Protospacer
 .********* *****************.**

111. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP032224 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

112. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to KY271402 (Klebsiella phage 48ST307, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacattgctgatacaccaggt	Protospacer
 .********* **.*****************

113. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NC_005857 (Klebsiella phage phiKO2, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttactgatacaccaggt	Protospacer
 .********* *****.**************

114. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to AY374448 (Bacteriophage phiKO2, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
aatttcccgataacgttactgatacaccaggt	Protospacer
 .********* *****.**************

115. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to NC_009235 (Burkholderia phage phi644-2 chromosome, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
ttcttgccgatcacgttgctgatacaccacgt	Protospacer
* .** *********************** **

116. spacer 1.19|960565|32|CP034831|CRISPRCasFinder,CRT matches to CP000625 (Burkholderia phage phi644-2, complete genome) position: , mismatch: 4, identity: 0.875

tgtttcccgatcacgttgctgatacaccaggt	CRISPR spacer
ttcttgccgatcacgttgctgatacaccacgt	Protospacer
* .** *********************** **

117. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK542015 (Escherichia phage ZCEC5, complete genome) position: , mismatch: 4, identity: 0.875

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agtcgttctcttttgtgcggagcgccgacgct	Protospacer
* **  *************************.

118. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MN856022 (Bacteriophage sp. isolate 138, complete genome) position: , mismatch: 4, identity: 0.875

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agtctgtctcttttgtgcggggcaccgacgct	Protospacer
* ******************.**.*******.

119. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MT682064 (Klebsiella virus KpV2811, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agcctgtctcttttgtgcggggcaccgacgct	Protospacer
* .*****************.**.*******.

120. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK327140 (Klebsiella phage YX3973, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agcctgtctcttttgtgcggggcaccgacgct	Protospacer
* .*****************.**.*******.

121. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK468591 (Mycobacterium phage Arissanae, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
actcgctctcgtttgtgcggagcgccgacgct	Protospacer
*.**  **** ********************.

122. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MN106244 (Klebsiella phage Soft, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agtcgatctcttttgtgcggggcgccgacgct	Protospacer
* ** .**************.**********.

123. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to GU196278 (Escherichia phage K1H, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agtcgttctcttttgtgcggtgcgccgacgct	Protospacer
* **  ************** **********.

124. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to NC_027993 (Escherichia phage K1G, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agtcgttctcttttgtgcggtgcgccgacgct	Protospacer
* **  ************** **********.

125. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to NC_048732 (Klebsiella phage Seifer, complete genome) position: , mismatch: 5, identity: 0.844

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agtcgatctcttttgtgcggggcgccgacgct	Protospacer
* ** .**************.**********.

126. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.812

cgtaaaaatcgggctgatgggcgccagccaca-	CRISPR spacer
cttaaaaatcaggctgatggccgcc-gcaacct	Protospacer
* ********.********* **** ** **  

127. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.812

cgtaaaaatcgggctgatgggcgccagccaca-	CRISPR spacer
cttaaaaatcaggctgatggccgcc-gcaacct	Protospacer
* ********.********* **** ** **  

128. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to GU196279 (Escherichia phage K1ind1, complete genome) position: , mismatch: 6, identity: 0.812

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
agccgctctcttttgtgcggtgcgccgacgct	Protospacer
* .*  ************** **********.

129. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 6, identity: 0.812

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
actcgctctcgcttgtgcggagcgccgacgct	Protospacer
*.**  **** .*******************.

130. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MN234167 (Mycobacterium phage Vanisoa, complete genome) position: , mismatch: 6, identity: 0.812

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
actcgctctcgcttgtgcggagcgccgacgct	Protospacer
*.**  **** .*******************.

131. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 6, identity: 0.812

tcactgatattaaataaatactatattttaca	CRISPR spacer
ttttttatataaaataaaaactatattttaca	Protospacer
*. .* **** ******* *************

132. spacer 2.27|979684|29|CP034831|PILER-CR matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 6, identity: 0.793

gggttaattgggcaaattgaatcaggaac	CRISPR spacer
gaatgaattgggcaaattgaatccagaat	Protospacer
*..* ****************** .***.

133. spacer 1.14|960749|32|CP034831|PILER-CR matches to KC821624 (Cellulophaga phage phi14:2, complete genome) position: , mismatch: 7, identity: 0.781

cgtagctatactgataattcatcag-cacagac	CRISPR spacer
gctagctatacttataatacatcagttacagg-	Protospacer
  ********** ***** ****** .****. 

134. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

135. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

136. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

137. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

138. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

139. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

140. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

141. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

142. spacer 1.15|960810|32|CP034831|PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

143. spacer 1.18|960504|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

---gagatttacgcgctcgttgagctgctgcacgt	CRISPR spacer
tccgtgat---cgcgcacgttgagctgctgaacga	Protospacer
   * ***   ***** ************* *** 

144. spacer 1.22|960748|32|CP034831|CRISPRCasFinder,CRT matches to KC821624 (Cellulophaga phage phi14:2, complete genome) position: , mismatch: 7, identity: 0.781

cgtagctatactgataattcatcag-cacagac	CRISPR spacer
gctagctatacttataatacatcagttacagg-	Protospacer
  ********** ***** ****** .****. 

145. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

146. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

147. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

148. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

149. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

150. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

151. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

152. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

153. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.781

-ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
cggcgc-gttcagcaaagcagcggcttcaggag	Protospacer
 ***.*  ***** ********* *******. 

154. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MF415411 (Klebsiella phage KPN U2874, complete genome) position: , mismatch: 7, identity: 0.781

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
aggcgatctcttttatgcggggcgccgacgct	Protospacer
*  * .********.*****.**********.

155. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MF476924 (Klebsiella phage YMC15/11/N53_KPN_BP, complete genome) position: , mismatch: 7, identity: 0.781

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
aggcgatctcttttatgcggggcgccgacgct	Protospacer
*  * .********.*****.**********.

156. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MF415413 (Klebsiella phage KPN N54, complete genome) position: , mismatch: 7, identity: 0.781

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
aggcgatctcttttatgcggggcgccgacgct	Protospacer
*  * .********.*****.**********.

157. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MF415410 (Klebsiella phage KPN N137, complete genome) position: , mismatch: 7, identity: 0.781

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
aggcgatctcttttatgcggggcgccgacgct	Protospacer
*  * .********.*****.**********.

158. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MG835858 (Klebsiella phage KPN N98, complete genome) position: , mismatch: 7, identity: 0.781

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
aggcgatctcttttatgcggggcgccgacgct	Protospacer
*  * .********.*****.**********.

159. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 7, identity: 0.781

-attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
ggggctg-ctcttttgtgcgcggcgccgacggc	Protospacer
 .  *** ************ .********* *

160. spacer 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MN693771 (Marine virus AFVG_250M633, complete genome) position: , mismatch: 7, identity: 0.781

cgttg--ttaacggcagccttatctgctttacca	CRISPR spacer
--ttgacttaacggcagccttgtctgatttgcgg	Protospacer
  ***  **************.**** ***.* .

161. spacer 2.1|978275|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 7, identity: 0.781

----gcaacgtcgtcattgatgaagccgcgttccac	CRISPR spacer
tgcggcag----gtcgttgatgaagccgcgatccac	Protospacer
    ***.    ***.************** *****

162. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
cgactgcccggaccgggccggcgcaatggttt	Protospacer
.****** ***********.****. .*.***

163. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 7, identity: 0.781

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
ggagcgcgtggaccgggccagcacgtcggtct	Protospacer
 ** .***.*************.*****.*.*

164. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 7, identity: 0.781

tcactgatattaaataaatactatattttaca	CRISPR spacer
tagctattattatataaataatatattttaaa	Protospacer
* .**. ***** ******* ********* *

165. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP050314 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_1, complete sequence) position: , mismatch: 7, identity: 0.781

-tcactgatattaaataaatactatattttaca	CRISPR spacer
atagcctat-ttaagtaaagactatattttaca	Protospacer
 * .*. ** ****.**** *************

166. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 7, identity: 0.781

tcactgatattaaataaatactatattttaca	CRISPR spacer
tagctattattatataaataatatattttaaa	Protospacer
* .**. ***** ******* ********* *

167. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 7, identity: 0.781

tcactgatattaaataaatactatattttaca	CRISPR spacer
tagctattattatataaataatatattttaaa	Protospacer
* .**. ***** ******* ********* *

168. spacer 1.3|960077|32|CP034831|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038501 (Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

atgggatcgtgactcactggcatcttatggac	CRISPR spacer
aaagtttattgaatcactcgcatcttatggac	Protospacer
* .*  *  *** ***** *************

169. spacer 1.7|960321|32|CP034831|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

agattgtgagacagcttgatcctggtgctcgt	CRISPR spacer
cgattgggacacagcttgatcctgtcgagcgc	Protospacer
 ***** ** ************** .*  **.

170. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

171. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

172. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

173. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

174. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

175. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

176. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

177. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

178. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

179. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

180. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatttacgggctgatgggcgccggccgca	Protospacer
**  *    ****************.***.**

181. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

182. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

183. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

184. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

185. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

186. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

187. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

188. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

189. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

190. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

191. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

192. spacer 1.15|960810|32|CP034831|PILER-CR matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
ggcctcattcaggaaagccgccccttcaggtg	Protospacer
*** .. *********** ** ********  

193. spacer 1.18|960504|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75

gagatttacgcgctcgttgagctgctgcacgt---	CRISPR spacer
cccattggcgcgctcgttgagctgctg---gtgca	Protospacer
   *** .*******************   **   

194. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

195. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

196. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

197. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

198. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

199. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

200. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

201. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

202. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

203. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

204. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatttacgggctgatgggcgccggccgca	Protospacer
**  *    ****************.***.**

205. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

206. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

207. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

208. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

209. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

210. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

211. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

212. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

213. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

214. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

215. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cggcatcgccgggctgatgggcgccggccgca	Protospacer
**  *  ..****************.***.**

216. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
ggcctcattcaggaaagccgccccttcaggtg	Protospacer
*** .. *********** ** ********  

217. spacer 1.29|961177|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938357 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141b, complete sequence) position: , mismatch: 8, identity: 0.75

attctgtctcttttgtgcggagcgccgacgcc	CRISPR spacer
cataagactcttgtgtgcggagctccgacggc	Protospacer
  *  * ***** ********** ****** *

218. spacer 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MG711460 (Faecalibacterium phage FP_Mushu, complete genome) position: , mismatch: 8, identity: 0.75

cgttgttaacggcagccttatctgctttacca	CRISPR spacer
ggctgggcacggcggcctgatctgctttaccc	Protospacer
 *.**   *****.**** ************ 

219. spacer 2.1|978275|32|CP034831|CRISPRCasFinder,CRT matches to NZ_AP015033 (Pseudomonas putida strain KF715 plasmid pKF715D, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgtcgtcattgatgaagccg----cgttccac	CRISPR spacer
acaaccccgtcattgatgaagccggccaggtt----	Protospacer
.**** .*****************     ***    

220. spacer 2.1|978275|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgtcgtcattgatgaagccgcgttccac	CRISPR spacer
taatcggtgtcattgatgaaatcgcgttccag	Protospacer
  * ** .************..********* 

221. spacer 2.1|978275|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgtcgtcattgatgaagccgcgttccac	CRISPR spacer
tcaaggtcgtcattgttgaagccgatgacgac	Protospacer
 *** ********** ********    * **

222. spacer 2.1|978275|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP016851 (Pseudomonas sp. TMW 2.1634 plasmid pL21634-2, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgtcgtcattgatgaagccg----cgttccac	CRISPR spacer
acaaccccgtcattgatgaagccggccaggtt----	Protospacer
.**** .*****************     ***    

223. spacer 2.4|978458|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

agaaaaaccttgataaaacctttcctaaaacg	CRISPR spacer
ctgaaacccttgataaaacctttcctttaaaa	Protospacer
  .*** *******************  ** .

224. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tgactg--cgcggaccgggccagcgcgtcgattt	CRISPR spacer
--gccggacgcggaccggcccagcgcgtcgaagc	Protospacer
  .*.*  ********** ************  .

225. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tgactg--cgcggaccgggccagcgcgtcgattt	CRISPR spacer
--gccggacgcggaccggcccagcgcgtcgaagc	Protospacer
  .*.*  ********** ************  .

226. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
ggtgcgcatggcccgggccagcgcgccgattt	Protospacer
 *  .**..** *************.******

227. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.75

tcactgatattaaataaatactatattttaca	CRISPR spacer
acaattttattaaataattaatatattttaac	Protospacer
 ** *  ********** ** *********  

228. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 8, identity: 0.75

tcactgatattaaataaatactatattttaca	CRISPR spacer
atatttcaattaaataaattatatattttaca	Protospacer
 .*.*   ***********  ***********

229. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_KJ776585 (Clostridium botulinum strain DB2 plasmid pDB2, complete sequence) position: , mismatch: 8, identity: 0.75

tcactga---tattaaataaatactatattttaca	CRISPR spacer
---ctggatttattaaataaacacgatattttagt	Protospacer
   ***.   ***********.** ********  

230. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP019901 (Raoultella planticola strain GODA plasmid unnamed2) position: , mismatch: 8, identity: 0.75

tcactgatattaaataaatactatattttaca	CRISPR spacer
acgccattattaaatagataatatattttaaa	Protospacer
 *.*.. *********.*** ********* *

231. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_KJ776583 (Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence) position: , mismatch: 8, identity: 0.75

tcactga---tattaaataaatactatattttaca	CRISPR spacer
---ctggatttattaaataaacacgatattttagt	Protospacer
   ***.   ***********.** ********  

232. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 8, identity: 0.75

tcactga---tattaaataaatactatattttaca	CRISPR spacer
---ctggatttattaaataaacacgatattttagt	Protospacer
   ***.   ***********.** ********  

233. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_KJ776579 (Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence) position: , mismatch: 8, identity: 0.75

tcactga---tattaaataaatactatattttaca	CRISPR spacer
---ctggatttattaaataaacacgatattttagt	Protospacer
   ***.   ***********.** ********  

234. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 8, identity: 0.75

tcactga---tattaaataaatactatattttaca	CRISPR spacer
---ctggatttattaaataaacacgatattttagt	Protospacer
   ***.   ***********.** ********  

235. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 8, identity: 0.75

tcactga---tattaaataaatactatattttaca	CRISPR spacer
---ctggatttattaaataaacacgatattttagt	Protospacer
   ***.   ***********.** ********  

236. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to CP023136 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid) position: , mismatch: 8, identity: 0.75

tcactgatattaaataaatactatattttaca	CRISPR spacer
acgccattatttaataaataatatattttaaa	Protospacer
 *.*.. **** ******** ********* *

237. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to CP052179 (Klebsiella pneumoniae strain F16KP0045 plasmid unnamed) position: , mismatch: 8, identity: 0.75

tcactgatattaaataaatactatattttaca	CRISPR spacer
acgccattattaaatagataatatattttaaa	Protospacer
 *.*.. *********.*** ********* *

238. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP026187 (Enterobacteriaceae bacterium ENNIH2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcactgatattaaataaatactatattttaca	CRISPR spacer
acgccattattaaatagataatatattttaaa	Protospacer
 *.*.. *********.*** ********* *

239. spacer 2.13|979007|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP049245 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

tccccccggaggctgtaccaaaaatcgtagaa	CRISPR spacer
ctgccccggatgctgtcccaaaaatcgaaaac	Protospacer
.. ******* ***** ********** *.* 

240. spacer 2.13|979007|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 8, identity: 0.75

tccccccggaggctgtaccaaaaatcgtagaa	CRISPR spacer
ctgccccggatgctgcaccaaaaatcgaaaac	Protospacer
.. ******* ****.*********** *.* 

241. spacer 2.21|979495|32|CP034831|CRISPRCasFinder,CRT matches to MN026741 (Salmonella phage Th1, complete genome) position: , mismatch: 8, identity: 0.75

ttaagaggagattatttgtggctaaaaattac	CRISPR spacer
ttttcaggagattatatgtgcctaaaaactta	Protospacer
**   ********** **** *******.*  

242. spacer 2.24|979678|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttggggttaattgggcaaattgaatcaggaac	CRISPR spacer
tcagaatgaattgggcaaattgaatccagaat	Protospacer
*..*..* ****************** .***.

243. spacer 1.10|960504|33|CP034831|PILER-CR matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 9, identity: 0.727

tgagatttacgcgctcgttgagctgctgcacgt---	CRISPR spacer
gcccattggcgcgctcgttgagctgctg---gtgca	Protospacer
    *** .*******************   **   

244. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

245. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgaccg	Protospacer
* ********.********* ****.    *.

246. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

247. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgaccg	Protospacer
* ********.********* ****.    *.

248. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

249. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgaccg	Protospacer
* ********.********* ****.    *.

250. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

251. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgatcg	Protospacer
* ********.********* ****.    *.

252. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

253. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcattgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

254. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

255. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttgccgttcgggcggaagggcgccagccacg	Protospacer
* *.  . ****** ** *************.

256. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

257. spacer 1.12|960627|32|CP034831|PILER-CR matches to NC_008388 (Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
tgcctatttcgggctgacgggcgacagccacg	Protospacer
.*.  *  *********.***** *******.

258. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

259. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgaccg	Protospacer
* ********.********* ****.    *.

260. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

261. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgaccg	Protospacer
* ********.********* ****.    *.

262. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

263. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgaccg	Protospacer
* ********.********* ****.    *.

264. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

265. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgatcg	Protospacer
* ********.********* ****.    *.

266. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

267. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcattgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

268. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

269. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttgccgttcgggcggaagggcgccagccacg	Protospacer
* *.  . ****** ** *************.

270. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
gggcatcgccgggctgatgggcgccggccgca	Protospacer
 *  *  ..****************.***.**

271. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NC_008388 (Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
tgcctatttcgggctgacgggcgacagccacg	Protospacer
.*.  *  *********.***** *******.

272. spacer 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK493321 (Cyanophage S-RIM4 isolate RW_11_0999, complete genome) position: , mismatch: 9, identity: 0.719

cgttgttaacggcagccttatctgctttacca	CRISPR spacer
cagcagtaacagcagccttacctgctttatta	Protospacer
*. .. ****.*********.********..*

273. spacer 2.3|978397|32|CP034831|CRISPRCasFinder,CRT matches to KY984068 (Erwinia phage vB_EamM_Y3, complete genome) position: , mismatch: 9, identity: 0.719

gcaccgcatgacatgcgatgaataccgtgata	CRISPR spacer
cggtggcatgacattcgatgaatgccgtgcaa	Protospacer
  .. ********* ********.*****  *

274. spacer 2.3|978397|32|CP034831|CRISPRCasFinder,CRT matches to NC_021976 (Acetobacter pasteurianus 386B plasmid Apa386Bp1, complete sequence) position: , mismatch: 9, identity: 0.719

gcaccgcatgacatgcgatgaataccgtgata	CRISPR spacer
taaccgcatgatatgcggtgaatacgcctatt	Protospacer
  *********.*****.*******  . ** 

275. spacer 2.3|978397|32|CP034831|CRISPRCasFinder,CRT matches to NZ_AP014882 (Acetobacter pasteurianus NBRC 101655 plasmid plasmid1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcaccgcatgacatgcgatgaataccgtgata	CRISPR spacer
taaccgcatgatatgcggtgaatacgcctatt	Protospacer
  *********.*****.*******  . ** 

276. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 9, identity: 0.719

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
agcaagcgcggaccgggccagtgcgtcggcga	Protospacer
 *   ****************.******..  

277. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
gaactgcccggaccgggcaagcgcgtgctgct	Protospacer
 .***** ********** *******    .*

278. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
gctcatcgcggaccgggccagcgcctccatcc	Protospacer
   *  ****************** ** **..

279. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719

tgact--gcgcggaccgggccagcgcgtcgattt	CRISPR spacer
--accgggcgcggcctgggccagcgcgtcgtaca	Protospacer
  **.  ****** *.**************  . 

280. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
ggcacgcgcggcccaggccagcgcgtcgcgct	Protospacer
 *  .****** **.*************  .*

281. spacer 2.8|978702|32|CP034831|CRISPRCasFinder,CRT matches to MN855673 (Bacteriophage sp. isolate 200, complete genome) position: , mismatch: 9, identity: 0.719

ggtaattatgccattgtcgtcaggggtaaaac	CRISPR spacer
atcaatgttgccattgtcgtcaggggcttgac	Protospacer
. .***  ******************.  .**

282. spacer 2.9|978763|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP021461 (Lactobacillus brevis strain ZLB004 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719

cctcttttagtctcggccatgaatcgttatta	CRISPR spacer
aaaacggtagcctcggccatgaaccgttatta	Protospacer
    .  ***.************.********

283. spacer 2.9|978763|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP035169 (Lactobacillus plantarum strain SRCM103418 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cctcttttagtctcggccatgaatcgttatta	CRISPR spacer
aaaacggtagcctcggccatgaaccgttatta	Protospacer
    .  ***.************.********

284. spacer 2.9|978763|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP035169 (Lactobacillus plantarum strain SRCM103418 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cctcttttagtctcggccatgaatcgttatta	CRISPR spacer
aaaacggtagcctcggccatgaaccgttatta	Protospacer
    .  ***.************.********

285. spacer 2.9|978763|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP047122 (Lactobacillus hilgardii strain FLUB plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cctcttttagtctcggccatgaatcgttatta	CRISPR spacer
aaaacggtagcctcggccatgaaccgttatta	Protospacer
    .  ***.************.********

286. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 9, identity: 0.719

tcactgatattaaataaatactatattttaca	CRISPR spacer
tattttttataatataaatactatattttagc	Protospacer
*  .*  *** * *****************  

287. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_015918 (Borreliella bissettii DN127 plasmid lp28-7, complete sequence) position: , mismatch: 9, identity: 0.719

tcactgatattaaataaatactatattttaca	CRISPR spacer
tattttttataaaaaaaatactatattttaac	Protospacer
*  .*  *** *** ***************  

288. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 9, identity: 0.719

tcactgatattaaataaatactatattttaca	CRISPR spacer
tattttttataatataaatactatattttagc	Protospacer
*  .*  *** * *****************  

289. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 9, identity: 0.719

tcactgatattaaataaatactatattttaca	CRISPR spacer
tattttttataatataaatactatattttagc	Protospacer
*  .*  *** * *****************  

290. spacer 2.10|978824|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP043029 (Pseudobutyrivibrio xylanivorans strain MA3014 plasmid pNP95, complete sequence) position: , mismatch: 9, identity: 0.719

tcactgatattaaataaatactatattttaca	CRISPR spacer
tawaatatatttaataaatattatatttttcc	Protospacer
*     ***** ********.******** * 

291. spacer 2.17|979251|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgacgccaaagggaacgtgaaagtgtctac	CRISPR spacer
gctgacaccaaaggcaacgtgaaagcaggtgt	Protospacer
 *****.******* **********..  *..

292. spacer 2.20|979434|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 9, identity: 0.719

ccttcgatttaacaggctggacaatcacgaca	CRISPR spacer
gacacaatttgacaggctggacaatctcgatt	Protospacer
  . *.****.*************** ***. 

293. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

294. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

295. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

296. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

297. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

298. spacer 1.12|960627|32|CP034831|PILER-CR matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

299. spacer 1.14|960749|32|CP034831|PILER-CR matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

cgtagctatactgataattcatcagcacagac	CRISPR spacer
gacggctctactgataattcagcagcaataat	Protospacer
 ...*** ************* *****  .*.

300. spacer 1.15|960810|32|CP034831|PILER-CR matches to CP054911 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
tgcacttttcaggaaagtagcgcctcttttcc	Protospacer
 *****.**********.*******..    .

301. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

302. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

303. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

304. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

305. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

306. spacer 1.20|960626|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 10, identity: 0.688

cgtaaaaatcgggctgatgggcgccagccaca	CRISPR spacer
cttaaaaatcaggctgatggccgccgcgattg	Protospacer
* ********.********* ****.    ..

307. spacer 1.22|960748|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

cgtagctatactgataattcatcagcacagac	CRISPR spacer
gacggctctactgataattcagcagcaataat	Protospacer
 ...*** ************* *****  .*.

308. spacer 1.23|960809|32|CP034831|CRISPRCasFinder,CRT matches to CP054911 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggcactcttcaggaaagcagcgccttcagggt	CRISPR spacer
tgcacttttcaggaaagtagcgcctcttttcc	Protospacer
 *****.**********.*******..    .

309. spacer 1.27|961055|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MH617588 (Microviridae sp. isolate ctec913, complete genome) position: , mismatch: 10, identity: 0.688

cagtgcaccaatagcattacgattctgataac	CRISPR spacer
accggaaccaatagcattaccatcctgatccg	Protospacer
    * ************** **.*****   

310. spacer 1.30|961238|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MT774404 (CrAssphage cr114_1, complete genome) position: , mismatch: 10, identity: 0.688

cgttgttaacggcagccttatctgctttacca	CRISPR spacer
taggtctaacggcaggcttatctgttttatct	Protospacer
..   .********* ********.****.* 

311. spacer 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK482690 (Escherichia phage vB_EcoM_LMP34, partial genome) position: , mismatch: 10, identity: 0.688

aggctttgacaatggcctggttaagttggagt	CRISPR spacer
gtctgtgaacaatggcctgtttaagtttgaga	Protospacer
.  . * .*********** ******* *** 

312. spacer 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK482689 (Escherichia phage vB_EcoM_LMP33, complete genome) position: , mismatch: 10, identity: 0.688

aggctttgacaatggcctggttaagttggagt	CRISPR spacer
gtctgtgaacaatggcctgtttaagtttgaga	Protospacer
.  . * .*********** ******* *** 

313. spacer 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to MK482688 (Escherichia phage vB_EcoM_LMP25, complete genome) position: , mismatch: 10, identity: 0.688

aggctttgacaatggcctggttaagttggagt	CRISPR spacer
gtctgtgaacaatggcctgtttaagtttgaga	Protospacer
.  . * .*********** ******* *** 

314. spacer 1.33|961421|32|CP034831|CRISPRCasFinder,CRT,PILER-CR matches to KT184316 (Enterobacteria phage XTG1, complete genome) position: , mismatch: 10, identity: 0.688

aggctttgacaatggcctggttaagttggagt	CRISPR spacer
gtctgtgaacaatggcctgtttaagtttgaga	Protospacer
.  . * .*********** ******* *** 

315. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP016500 (Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence) position: , mismatch: 10, identity: 0.688

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
ggtgggcgcgaaccgggccagcacgtcgtaaa	Protospacer
 *   *****.***********.*****    

316. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
agcgggcgcggtccaggccagcgcgtcgccgc	Protospacer
 *   ****** **.************* . .

317. spacer 2.11|978885|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP009059 (Borreliella afzelii K78 plasmid lp54, complete sequence) position: , mismatch: 10, identity: 0.688

caatgaatttgctccggaaatagataaagcgc	CRISPR spacer
ttctatatttgctccgaaaataaataaagatg	Protospacer
.  *. **********.*****.******   

318. spacer 2.11|978885|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP009214 (Borreliella afzelii Tom3107 plasmid lp54, complete sequence) position: , mismatch: 10, identity: 0.688

caatgaatttgctccggaaatagataaagcgc	CRISPR spacer
ttctatatttgctccgaaaataaataaagatg	Protospacer
.  *. **********.*****.******   

319. spacer 2.11|978885|32|CP034831|CRISPRCasFinder,CRT matches to NC_017241 (Borreliella afzelii PKo plasmid lp54, complete sequence) position: , mismatch: 10, identity: 0.688

caatgaatttgctccggaaatagataaagcgc	CRISPR spacer
ttctatatttgctccgaaaataaataaagatg	Protospacer
.  *. **********.*****.******   

320. spacer 2.12|978946|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcactggcgtataacctcttgcgtgccgt	CRISPR spacer
gatgctctggcgtattacctcttgcgatagag	Protospacer
*..** ********* **********    . 

321. spacer 2.18|979312|32|CP034831|CRISPRCasFinder,CRT matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tttaatcgcagttttaaatgttgcctgcgcat	CRISPR spacer
tcgaatagcagttttaattgttgcctatttcc	Protospacer
*. *** ********** ********.. . .

322. spacer 1.6|960260|32|CP034831|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 11, identity: 0.656

accggctgcgcgatcgccctgggtgaattcgt	CRISPR spacer
ggtggccgcgcgatcgcccagggtgagggacg	Protospacer
. .***.************ ******.     

323. spacer 1.6|960260|32|CP034831|PILER-CR,CRISPRCasFinder,CRT matches to NC_011732 (Gloeothece citriformis PCC 7424 plasmid pP742404, complete sequence) position: , mismatch: 11, identity: 0.656

accggctgcgcgatcgccctgggtgaattcgt	CRISPR spacer
tgacgctgcgcgatcgcccttgttgaacgacg	Protospacer
    **************** * ****.    

324. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.656

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
ccggcgcgcggcccgggccagcgcggcggcga	Protospacer
. . .****** ************* **..  

325. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
cacgtgcgggtaccgggccagcgcgtcaccgc	Protospacer
..  **** * ****************. . .

326. spacer 2.7|978641|32|CP034831|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.656

tgactgcgcggaccgggccagcgcgtcgattt	CRISPR spacer
ccggcgcgcggcccgggccagcgcggcggcga	Protospacer
. . .****** ************* **..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1675092 : 1684263 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_2 1752557 : 1763064 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 1872840 : 1880099 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_4 2176995 : 2182783 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_5 4267928 : 4315020 49 Burkholderia_phage(40.91%) tail,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage