Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034785 Escherichia coli strain ECZP248 plasmid pTBMCR401, complete sequence 0 crisprs NA 0 0 1 0
CP034786 Escherichia coli strain ECZP248 plasmid pTB402, complete sequence 0 crisprs RT 0 0 2 0
CP034784 Escherichia coli strain ECZP248 chromosome, complete genome 8 crisprs csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas1,cas2,cas3,cas14j,DEDDh,c2c9_V-U4,DinG 0 12 5 0

Results visualization

1. CP034785
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27367 : 90836 58 Escherichia_phage(36.36%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034786
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1987 : 15851 13 Escherichia_phage(76.92%) NA NA
DBSCAN-SWA_2 24637 : 83762 43 Escherichia_phage(42.11%) integrase,transposase attL 19287:19346|attR 33062:35252
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP034784
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_1 958264-958841 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_2 985885-986340 TypeI-E I-E
7 spacers
cas2,cas1,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_3 1480645-1480762 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_4 2090333-2090456 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_6 2880032-2880237 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_7 3000153-3000297 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_8 3237115-3237211 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034784_9 3376177-3376321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
CP034784_5 5.1|2740942|40|CP034784|CRISPRCasFinder 2740942-2740981 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
CP034784_2 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986219-986250 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
CP034784_2 2.7|986280|32|CP034784|CRT 986280-986311 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 2 0.938
CP034784_4 4.1|2090376|38|CP034784|CRISPRCasFinder 2090376-2090413 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP034784_1 1.4|958476|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 958476-958507 32 KU686197 Synechococcus phage S-CAM3 isolate 0808SB25, complete genome 118383-118414 5 0.844
CP034784_1 1.4|958476|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 958476-958507 32 KU686199 Synechococcus phage S-CAM3 isolate 1010CC42, complete genome 118389-118420 5 0.844
CP034784_1 1.4|958476|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 958476-958507 32 KU686198 Synechococcus phage S-CAM3 isolate 0910TB04, complete genome 118373-118404 5 0.844
CP034784_2 2.7|986280|32|CP034784|CRT 986280-986311 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP034784_1 1.6|958598|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 958598-958629 32 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 965187-965218 8 0.75
CP034784_1 1.9|958781|32|CP034784|CRISPRCasFinder,CRT 958781-958812 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP034784_2 2.1|985914|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 985914-985945 32 MF773750 Mycobacterium phage OKCentral2016, complete genome 32038-32069 8 0.75
CP034784_2 2.1|985914|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 985914-985945 32 JX307704 Mycobacterium virus Goose, complete genome 32135-32166 8 0.75
CP034784_2 2.3|986036|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986036-986067 32 NZ_CP042402 Weissella hellenica strain CBA3632 plasmid unnamed3, complete sequence 12282-12313 8 0.75
CP034784_2 2.4|986097|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986097-986128 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 458381-458412 8 0.75
CP034784_2 2.4|986097|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986097-986128 32 NZ_CP030762 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence 130817-130848 8 0.75
CP034784_2 2.7|986280|32|CP034784|CRT 986280-986311 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 8 0.75
CP034784_2 2.7|986280|32|CP034784|CRT 986280-986311 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP034784_2 2.3|986036|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986036-986067 32 CP003185 Thermoanaerobacterium saccharolyticum JW/SL-YS485 plasmid pMU3262, complete genome 44776-44807 9 0.719
CP034784_2 2.3|986036|32|CP034784|PILER-CR,CRISPRCasFinder,CRT 986036-986067 32 NC_019956 Thermoanaerobacterium thermosaccharolyticum M0795 plasmid pTHETHE01, complete sequence 105005-105036 9 0.719
CP034784_6 6.3|2880176|33|CP034784|CRISPRCasFinder,CRT 2880176-2880208 33 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4203 9 0.727
CP034784_6 6.5|2880177|32|CP034784|PILER-CR 2880177-2880208 32 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4202 9 0.719

1. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

2. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

3. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

4. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

5. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

6. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

7. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

8. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

9. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

10. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

11. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

12. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

13. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

14. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

15. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

16. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

17. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

18. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

19. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

20. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

21. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

22. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

23. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

24. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

25. spacer 5.1|2740942|40|CP034784|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

26. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

27. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

28. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

29. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

30. spacer 2.6|986219|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

31. spacer 2.7|986280|32|CP034784|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ggcgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
*.*********************.********

32. spacer 4.1|2090376|38|CP034784|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

33. spacer 1.4|958476|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to KU686197 (Synechococcus phage S-CAM3 isolate 0808SB25, complete genome) position: , mismatch: 5, identity: 0.844

ttttgtgattcagtaatcgtttgagtatgtac	CRISPR spacer
atttgtgatacagtaaacgtttgagtatctgc	Protospacer
 ******** ****** *********** *.*

34. spacer 1.4|958476|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to KU686199 (Synechococcus phage S-CAM3 isolate 1010CC42, complete genome) position: , mismatch: 5, identity: 0.844

ttttgtgattcagtaatcgtttgagtatgtac	CRISPR spacer
atttgtgatacagtaaacgtttgagtatctgc	Protospacer
 ******** ****** *********** *.*

35. spacer 1.4|958476|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to KU686198 (Synechococcus phage S-CAM3 isolate 0910TB04, complete genome) position: , mismatch: 5, identity: 0.844

ttttgtgattcagtaatcgtttgagtatgtac	CRISPR spacer
atttgtgatacagtaaacgtttgagtatctgc	Protospacer
 ******** ****** *********** *.*

36. spacer 2.7|986280|32|CP034784|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcactggatgcgatgatggat-atcacttg	CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc-	Protospacer
********** ******** ***. **** .. 

37. spacer 1.6|958598|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgctgacgcggtaaaaagcggggcgtgattcg	CRISPR spacer
gactgacgcggtaaaaggcggagcgggcattg	Protospacer
 .**************.****.*** *  *.*

38. spacer 1.9|958781|32|CP034784|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

39. spacer 2.1|985914|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 8, identity: 0.75

gagcgtagagattctcgaaaccgatccggacg	CRISPR spacer
cctcgtagagatcctcgaagccgatctcggcg	Protospacer
   *********.******.******. *.**

40. spacer 2.1|985914|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 8, identity: 0.75

gagcgtagagattctcgaaaccgatccggacg	CRISPR spacer
cctcgtagagatcctcgaagccgatctcggcg	Protospacer
   *********.******.******. *.**

41. spacer 2.3|986036|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042402 (Weissella hellenica strain CBA3632 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtaataaaaaatattctatttctgctgaatca	CRISPR spacer
gtaataaaaaatctactatttctgattttaga	Protospacer
************ * ********* *     *

42. spacer 2.4|986097|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cttgcgagcaaaagatccaggccgagaaagac	CRISPR spacer
aagccgagcaaaagatccaggcggtgaagggc	Protospacer
    ****************** * ***.*.*

43. spacer 2.4|986097|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cttgcgagcaaaagatccaggccgagaaagac	CRISPR spacer
aagccgagcaaaagatccaggcggtgaagggc	Protospacer
    ****************** * ***.*.*

44. spacer 2.7|986280|32|CP034784|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggatatcacttg	CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag	Protospacer
***********  ***********.. *.  *

45. spacer 2.7|986280|32|CP034784|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggata---tcacttg	CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac---	Protospacer
*********** ***.******* .    ***   

46. spacer 2.3|986036|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to CP003185 (Thermoanaerobacterium saccharolyticum JW/SL-YS485 plasmid pMU3262, complete genome) position: , mismatch: 9, identity: 0.719

gtaataaaaaatattctatttctgctgaatca	CRISPR spacer
ataataaataatattctgtttctgtgtgttta	Protospacer
.******* ********.******.  . *.*

47. spacer 2.3|986036|32|CP034784|PILER-CR,CRISPRCasFinder,CRT matches to NC_019956 (Thermoanaerobacterium thermosaccharolyticum M0795 plasmid pTHETHE01, complete sequence) position: , mismatch: 9, identity: 0.719

gtaataaaaaatattctatttctgctgaatca	CRISPR spacer
ataataaataatattctgtttctgtgtgttta	Protospacer
.******* ********.******.  . *.*

48. spacer 6.3|2880176|33|CP034784|CRISPRCasFinder,CRT matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.727

gttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
gttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
**************.* ******** ..*..  

49. spacer 6.5|2880177|32|CP034784|PILER-CR matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.719

ttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
ttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
*************.* ******** ..*..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 993704 : 1006886 12 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_2 1602351 : 1611792 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 2387207 : 2401467 17 Escherichia_phage(38.46%) lysis NA
DBSCAN-SWA_4 2406231 : 2425307 21 Escherichia_phage(55.56%) tRNA NA
DBSCAN-SWA_5 3442798 : 3515853 83 Shigella_phage(52.73%) capsid,head,terminase,plate,integrase,portal,tail,holin,protease attL 3456865:3456881|attR 3513299:3513315
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage