Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034694 Lactobacillus plantarum strain FBL-3a chromosome, complete genome 3 crisprs NA 0 8 0 0

Results visualization

1. CP034694
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034694_1 63897-64094 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034694_2 2447501-2448337 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034694_3 3060914-3060999 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034694_2 2.2|2447603|30|CP034694|CRT,CRISPRCasFinder 2447603-2447632 30 NZ_CP024415 Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence 20497-20526 0 1.0
CP034694_2 2.2|2447603|30|CP034694|CRT,CRISPRCasFinder 2447603-2447632 30 MG788324 Lactobacillus phage PM411, complete genome 29027-29056 0 1.0
CP034694_2 2.10|2448131|30|CP034694|CRT,CRISPRCasFinder 2448131-2448160 30 NZ_CP016901 Acinetobacter soli strain GFJ2 plasmid pGFJ5, complete sequence 4352-4381 4 0.867
CP034694_2 2.10|2448131|30|CP034694|CRT,CRISPRCasFinder 2448131-2448160 30 CP033566 Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-5, complete sequence 1164-1193 4 0.867
CP034694_2 2.14|2448001|27|CP034694|PILER-CR 2448001-2448027 27 NZ_CP022429 Pantoea ananatis strain YJ76 plasmid p_unamed1 264110-264136 5 0.815
CP034694_2 2.15|2448206|27|CP034694|PILER-CR 2448206-2448232 27 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 166412-166438 5 0.815
CP034694_2 2.8|2447999|30|CP034694|CRT,CRISPRCasFinder 2447999-2448028 30 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 418072-418101 6 0.8
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 AP013699 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S31-C30, *** SEQUENCING IN PROGRESS *** 26669-26698 7 0.767
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 AP013700 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S42-C58, *** SEQUENCING IN PROGRESS *** 22586-22615 7 0.767
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 AP013429 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C58A-MedDCM-OCT-S43-C47 27845-27874 7 0.767
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 AP013699 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S31-C30, *** SEQUENCING IN PROGRESS *** 26669-26698 7 0.767
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 AP013700 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S42-C58, *** SEQUENCING IN PROGRESS *** 22586-22615 7 0.767
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 AP013429 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C58A-MedDCM-OCT-S43-C47 27845-27874 7 0.767
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 NZ_CP033968 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence 192575-192604 8 0.733
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 NZ_CP037902 Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence 135574-135603 8 0.733
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 NZ_CP033968 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence 192575-192604 8 0.733
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 NZ_CP037902 Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence 135574-135603 8 0.733
CP034694_2 2.8|2447999|30|CP034694|CRT,CRISPRCasFinder 2447999-2448028 30 NZ_CP022429 Pantoea ananatis strain YJ76 plasmid p_unamed1 264109-264138 8 0.733
CP034694_2 2.11|2448197|30|CP034694|CRT,CRISPRCasFinder 2448197-2448226 30 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 166411-166440 8 0.733
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 48319-48348 9 0.7
CP034694_2 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder 2447669-2447698 30 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 140707-140736 9 0.7
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 48319-48348 9 0.7
CP034694_2 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder 2447801-2447830 30 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 140707-140736 9 0.7

1. spacer 2.2|2447603|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP024415 (Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence) position: , mismatch: 0, identity: 1.0 

gagtcgagtcctacccaccggttcccagtt	CRISPR spacer
gagtcgagtcctacccaccggttcccagtt	Protospacer
******************************

2. spacer 2.2|2447603|30|CP034694|CRT,CRISPRCasFinder matches to MG788324 (Lactobacillus phage PM411, complete genome) position: , mismatch: 0, identity: 1.0 

gagtcgagtcctacccaccggttcccagtt	CRISPR spacer
gagtcgagtcctacccaccggttcccagtt	Protospacer
******************************

3. spacer 2.10|2448131|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP016901 (Acinetobacter soli strain GFJ2 plasmid pGFJ5, complete sequence) position: , mismatch: 4, identity: 0.867 

tctttggcgtaactgtatgatgtaccgata-	CRISPR spacer
gcttgggcgtaactgtatgatgt-tcgatac	Protospacer
 *** ****************** .*****

4. spacer 2.10|2448131|30|CP034694|CRT,CRISPRCasFinder matches to CP033566 (Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-5, complete sequence) position: , mismatch: 4, identity: 0.867 

tctttggcgtaactgtatgatgtaccgata-	CRISPR spacer
gcttgggcgtaactgtatgatgt-tcgatac	Protospacer
 *** ****************** .*****

5. spacer 2.14|2448001|27|CP034694|PILER-CR matches to NZ_CP022429 (Pantoea ananatis strain YJ76 plasmid p_unamed1) position: , mismatch: 5, identity: 0.815 

ctggaactgaacgttgccggtatcgag	CRISPR spacer
ccggaacagaacgttgccggaatcgtc	Protospacer
*.***** ************ ****

6. spacer 2.15|2448206|27|CP034694|PILER-CR matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 5, identity: 0.815 

tctaattggcatagcaacaaactcggt	CRISPR spacer
tccaatttgcatagcaacaaacttgcc	Protospacer
**.**** ***************.* .

7. spacer 2.8|2447999|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 6, identity: 0.8 

tgctggaactgaacgttgccggtatcgaga	CRISPR spacer
cgatcggactgagggttgccggtatcgaga	Protospacer
.* * *.*****. ****************

8. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to AP013699 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S31-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
atttttctgccatttgttgttgccgatttc	Protospacer
 **  * ***********.********* .

9. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to AP013700 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S42-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
atttttctgccatttgttgttgccgatttc	Protospacer
 **  * ***********.********* .

10. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to AP013429 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C58A-MedDCM-OCT-S43-C47) position: , mismatch: 7, identity: 0.767 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
atttttctgccatttgttgttgccgatttc	Protospacer
 **  * ***********.********* .

11. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to AP013699 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S31-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
atttttctgccatttgttgttgccgatttc	Protospacer
 **  * ***********.********* .

12. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to AP013700 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C58A-MedDCM-OCT-S42-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
atttttctgccatttgttgttgccgatttc	Protospacer
 **  * ***********.********* .

13. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to AP013429 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C58A-MedDCM-OCT-S43-C47) position: , mismatch: 7, identity: 0.767 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
atttttctgccatttgttgttgccgatttc	Protospacer
 **  * ***********.********* .

14. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

---tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttat---ccatttgttgttgccgattat	Protospacer
   ..* .*   *********.***********

15. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

---tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttat---ccatttgttgttgccgattat	Protospacer
   ..* .*   *********.***********

16. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

---tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttat---ccatttgttgttgccgattat	Protospacer
   ..* .*   *********.***********

17. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

---tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttat---ccatttgttgttgccgattat	Protospacer
   ..* .*   *********.***********

18. spacer 2.8|2447999|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP022429 (Pantoea ananatis strain YJ76 plasmid p_unamed1) position: , mismatch: 8, identity: 0.733 

tgctggaactgaacgttgccggtatcgaga	CRISPR spacer
caccggaacagaacgttgccggaatcgtcg	Protospacer
..*.***** ************ ****  .

19. spacer 2.11|2448197|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 8, identity: 0.733 

aatctaattggcatagcaacaaactcggtg	CRISPR spacer
tctccaatttgcatagcaacaaacttgcca	Protospacer
  **.**** ***************.* ..

20. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 9, identity: 0.7 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttctccatttgttgttgccgattat	Protospacer
.    * . *********.***********

21. spacer 2.3|2447669|30|CP034694|CRT,CRISPRCasFinder matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 9, identity: 0.7 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttctccatttgttgttgccgattat	Protospacer
.    * . *********.***********

22. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 9, identity: 0.7 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttctccatttgttgttgccgattat	Protospacer
.    * . *********.***********

23. spacer 2.5|2447801|30|CP034694|CRT,CRISPRCasFinder matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 9, identity: 0.7 

tttggtgtgccatttgttattgccgattat	CRISPR spacer
cgaccttctccatttgttgttgccgattat	Protospacer
.    * . *********.***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage