Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP016379 Anoxybacter fermentans strain DY22613 chromosome, complete genome 24 crisprs cmr6gr7,cas10,cmr4gr7,cmr5gr11,cmr3gr5,cmr1gr7,cas3,DEDDh,DinG,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csx1,cas6,c2c10_CAS-V-U3,csa3,cas5 4 1 2 0

Results visualization

1. CP016379
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_1 636712-636896 TypeIII ?
2 spacers
cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csx1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_2 715751-715852 TypeV-U3 NA
1 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_3 717394-717562 TypeV-U3 NA
2 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_4 718056-718295 TypeV-U3 NA
3 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_5 720681-720864 TypeV-U3 NA
2 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_6 720887-720997 TypeV-U3 ?
1 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_7 721533-721716 TypeV-U3 ?
2 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_8 721725-721963 TypeV-U3 NA
3 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_9 722276-722753 TypeV-U3 NA
6 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_10 723243-723735 TypeV-U3 NA
6 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_11 723745-724113 TypeV-U3 NA
5 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_12 724671-724996 TypeV-U3 ?
4 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_13 725914-726176 TypeV-U3 NA
3 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_14 726760-726945 TypeV-U3 NA
2 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_15 727025-727398 TypeV-U3 NA
5 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_16 728065-728625 TypeV-U3 ?
7 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_17 729266-729661 TypeV-U3 NA
5 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_18 730423-730531 TypeV-U3 ?
1 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_19 730609-730913 TypeV-U3 NA
4 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_20 734951-735708 TypeV-U3 ?:I-B
10 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_21 737299-738022 TypeV-U3 NA
9 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_22 738386-738552 TypeV-U3 NA
2 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_23 739264-739834 TypeV-U3 NA
8 spacers
c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP016379_25 790515-790790 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP016379_9 9.1|722301|48|CP016379|CRT 722301-722348 48 CP016379.1 729011-729058 0 1.0
CP016379_18 18.1|730460|35|CP016379|CRISPRCasFinder 730460-730494 35 CP016379.1 717309-717343 0 1.0
CP016379_18 18.1|730460|35|CP016379|CRISPRCasFinder 730460-730494 35 CP016379.1 738292-738326 0 1.0
CP016379_7 7.1|721570|35|CP016379|CRISPRCasFinder 721570-721604 35 CP016379.1 717309-717343 1 0.971
CP016379_7 7.1|721570|35|CP016379|CRISPRCasFinder 721570-721604 35 CP016379.1 738292-738326 1 0.971
CP016379_21 21.4|737564|37|CP016379|CRT 737564-737600 37 CP016379.1 715714-715750 2 0.946

1. spacer 9.1|722301|48|CP016379|CRT matches to position: 729011-729058, mismatch: 0, identity: 1.0

gtaggttgcaacgctcgaattaaaccagatttccattacggacagcaa	CRISPR spacer
gtaggttgcaacgctcgaattaaaccagatttccattacggacagcaa	Protospacer
************************************************

2. spacer 18.1|730460|35|CP016379|CRISPRCasFinder matches to position: 717309-717343, mismatch: 0, identity: 1.0

tttgtcaacccgcctgttagtataggtgggttttt	CRISPR spacer
tttgtcaacccgcctgttagtataggtgggttttt	Protospacer
***********************************

3. spacer 18.1|730460|35|CP016379|CRISPRCasFinder matches to position: 738292-738326, mismatch: 0, identity: 1.0

tttgtcaacccgcctgttagtataggtgggttttt	CRISPR spacer
tttgtcaacccgcctgttagtataggtgggttttt	Protospacer
***********************************

4. spacer 7.1|721570|35|CP016379|CRISPRCasFinder matches to position: 717309-717343, mismatch: 1, identity: 0.971

tttgtcaacccgcctattagtataggtgggttttt	CRISPR spacer
tttgtcaacccgcctgttagtataggtgggttttt	Protospacer
***************.*******************

5. spacer 7.1|721570|35|CP016379|CRISPRCasFinder matches to position: 738292-738326, mismatch: 1, identity: 0.971

tttgtcaacccgcctattagtataggtgggttttt	CRISPR spacer
tttgtcaacccgcctgttagtataggtgggttttt	Protospacer
***************.*******************

6. spacer 21.4|737564|37|CP016379|CRT matches to position: 715714-715750, mismatch: 2, identity: 0.946

agaagaaattggatgggataaggaatataagcttttc	CRISPR spacer
agaggaaattggatgggataagaaatataagcttttc	Protospacer
***.******************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP016379_22 22.2|738486|33|CP016379|PILER-CR 738486-738518 33 MN693779 Marine virus AFVG_250M346, complete genome 56901-56933 9 0.727

1. spacer 22.2|738486|33|CP016379|PILER-CR matches to MN693779 (Marine virus AFVG_250M346, complete genome) position: , mismatch: 9, identity: 0.727

aggaggagaatatccagaagaaatacatgttgg	CRISPR spacer
tctaggagaatatccagatgaaatatattggga	Protospacer
   *************** ******.**   *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2126042 : 2133647 7 Burkholderia_virus(16.67%) NA NA
DBSCAN-SWA_2 2893523 : 2901901 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage