Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021334 Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence 1 crisprs RT 0 1 0 1
CP021333 Marinobacter salarius strain HL2708#2 chromosome, complete genome 0 crisprs DEDDh,cas3,csa3,WYL,DinG 0 0 0 0

Results visualization

1. CP021334
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021334_1 138897-138976 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021334_1 1.1|138923|28|CP021334|CRISPRCasFinder 138923-138950 28 NZ_CP021334 Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence 138923-138950 0 1.0

1. spacer 1.1|138923|28|CP021334|CRISPRCasFinder matches to NZ_CP021334 (Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence) position: , mismatch: 0, identity: 1.0

cagcaggacgtctcggaatgaactctta	CRISPR spacer
cagcaggacgtctcggaatgaactctta	Protospacer
****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP021334.1|AZR43659.1|236247_236565_+|hypothetical-protein 236247_236565_+ 105 aa aa 93 NA NA No NA