Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018719 Sterolibacteriaceae bacterium J5B plasmid pSTJ1 DNA, complete genome 1 crisprs NA 0 1 0 0
AP018718 Sterolibacteriaceae bacterium J5B DNA, complete genome 5 crisprs NA 2 15 0 0
AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2 DNA, complete genome 1 crisprs NA 0 11 0 0

Results visualization

1. AP018718
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018718_1 175055-179173 Orphan NA
58 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018718_2 580750-580827 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018718_3 1058892-1059866 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018718_4 2067963-2068147 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018718_5 2267378-2267541 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP018718_2 2.1|580774|30|AP018718|CRISPRCasFinder 580774-580803 30 AP018718.1 566263-566292 0 1.0
AP018718_2 2.1|580774|30|AP018718|CRISPRCasFinder 580774-580803 30 AP018718.1 566209-566238 1 0.967
AP018718_2 2.1|580774|30|AP018718|CRISPRCasFinder 580774-580803 30 AP018718.1 566317-566346 1 0.967
AP018718_4 4.2|2068065|47|AP018718|CRISPRCasFinder 2068065-2068111 47 AP018718.1 2068148-2068194 2 0.957

1. spacer 2.1|580774|30|AP018718|CRISPRCasFinder matches to position: 566263-566292, mismatch: 0, identity: 1.0

acgtctcattttccgccagcgccgactttc	CRISPR spacer
acgtctcattttccgccagcgccgactttc	Protospacer
******************************

2. spacer 2.1|580774|30|AP018718|CRISPRCasFinder matches to position: 566209-566238, mismatch: 1, identity: 0.967

acgtctcattttccgccagcgccgactttc	CRISPR spacer
acgtcccattttccgccagcgccgactttc	Protospacer
*****.************************

3. spacer 2.1|580774|30|AP018718|CRISPRCasFinder matches to position: 566317-566346, mismatch: 1, identity: 0.967

acgtctcattttccgccagcgccgactttc	CRISPR spacer
acgtcccattttccgccagcgccgactttc	Protospacer
*****.************************

4. spacer 4.2|2068065|47|AP018718|CRISPRCasFinder matches to position: 2068148-2068194, mismatch: 2, identity: 0.957

gggccgctcccctctcccccctgggaaaggggttgggggtgagggcc	CRISPR spacer
gggccactcccctctcccccctgggagaggggttgggggtgagggcc	Protospacer
*****.********************.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018718_3 3.10|1059532|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059532-1059561 30 MH019216 Streptomyces phage Wentworth, complete genome 16689-16718 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MK433260 Streptomyces phage Namo, complete genome 35655-35684 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MF467949 Streptomyces phage Spectropatronm, complete genome 35317-35346 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 KX670789 Streptomyces phage OlympicHelado, complete genome 35338-35367 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MK967386 Streptomyces phage Esketit, complete genome 35317-35346 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MN204500 Streptomyces phage Hoshi, complete genome 34914-34943 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MT684589 Streptomyces phage Maya, complete genome 35324-35353 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 KX670790 Streptomyces phage Rima, complete genome 35655-35684 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MN204494 Streptomyces phage Jaylociraptor, complete genome 35310-35339 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MN204497 Streptomyces phage Meibysrarus, complete genome 34687-34716 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 MK433259 Streptomyces phage IceWarrior, complete genome 34996-35025 4 0.867
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1019965-1019994 5 0.833
AP018718_2 2.1|580774|30|AP018718|CRISPRCasFinder 580774-580803 30 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 494776-494805 6 0.8
AP018718_2 2.1|580774|30|AP018718|CRISPRCasFinder 580774-580803 30 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 455356-455385 6 0.8
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 461411-461440 6 0.8
AP018718_3 3.2|1058996|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1058996-1059025 30 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1472465-1472494 7 0.767
AP018718_3 3.2|1058996|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1058996-1059025 30 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1614868-1614897 7 0.767
AP018718_3 3.2|1058996|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1058996-1059025 30 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 680013-680042 7 0.767
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 497277-497306 7 0.767
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 549945-549974 7 0.767
AP018718_3 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059666-1059695 30 HQ633061 Synechococcus phage S-CBM2, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces 45102-45131 7 0.767
AP018718_3 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059666-1059695 30 NZ_CP054716 Salmonella enterica strain 85-0120 plasmid unnamed3, complete sequence 12883-12912 7 0.767
AP018718_1 1.33|177337|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 177337-177368 32 MK112901 Salmonella virus KFS-SE2, complete genome 44629-44660 8 0.75
AP018718_1 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 177405-177438 34 NZ_CP029828 Burkholderia sp. JP2-270 plasmid p2, complete sequence 75719-75752 8 0.765
AP018718_1 1.61|176354|30|AP018718|PILER-CR 176354-176383 30 NZ_CP010687 Phaeobacter piscinae strain P14 plasmid pP14_f, complete sequence 1196-1225 8 0.733
AP018718_2 2.1|580774|30|AP018718|CRISPRCasFinder 580774-580803 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1443613-1443642 8 0.733
AP018718_3 3.3|1059063|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059063-1059092 30 CP003957 Rhodococcus opacus PD630 plasmid 8, complete sequence 142119-142148 8 0.733
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1843787-1843816 8 0.733
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1822437-1822466 8 0.733
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 158638-158667 8 0.733
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 158642-158671 8 0.733
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 158553-158582 8 0.733
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 158551-158580 8 0.733
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5629010-5629039 8 0.733
AP018718_3 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059599-1059628 30 NZ_CP010859 Marinovum algicola DG 898 plasmid pMaD4, complete sequence 159035-159064 8 0.733
AP018718_1 1.33|177337|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 177337-177368 32 NZ_CP011000 Sinorhizobium meliloti strain USDA1963 plasmid pHRB800, complete sequence 146166-146197 9 0.719
AP018718_1 1.33|177337|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 177337-177368 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 656158-656189 9 0.719
AP018718_1 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 177405-177438 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1610654-1610687 9 0.735
AP018718_1 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 177405-177438 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 396209-396242 9 0.735
AP018718_1 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 177405-177438 34 NZ_CP025432 Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence 72058-72091 9 0.735
AP018718_1 1.48|178392|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 178392-178425 34 NZ_LN614828 Legionella fallonii LLAP-10 plasmid II, complete sequence 16818-16851 9 0.735
AP018718_3 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059398-1059427 30 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 562501-562530 9 0.7
AP018718_3 3.9|1059465|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059465-1059494 30 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 101897-101926 9 0.7
AP018718_3 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059666-1059695 30 MG049919 Shigella phage vB_SflS-ISF001, complete genome 23917-23946 9 0.7
AP018718_3 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT 1059666-1059695 30 NC_041995 Shigella phage vB_SsoS-ISF002, complete genome 23937-23966 9 0.7
AP018718_1 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 175231-175262 32 MG962370 Mycobacterium phage Kykar, complete genome 10944-10975 10 0.688
AP018718_1 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 175231-175262 32 AF271693 Mycobacterium virus Bxb1, complete genome 11429-11460 10 0.688
AP018718_1 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 175231-175262 32 MH576975 Mycobacterium phage Target, complete genome 12167-12198 10 0.688
AP018718_1 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 175231-175262 32 JN699000 Mycobacterium virus BillKnuckles, complete genome 12060-12091 10 0.688
AP018718_1 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 175231-175262 32 NC_002656 Mycobacterium phage Bxb1, complete genome 11429-11460 10 0.688
AP018718_1 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR 175231-175262 32 JN699016 Mycobacterium phage Kugel, complete genome 11447-11478 10 0.688
AP018718_1 1.4|175299|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 175299-175332 34 NZ_CP039919 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626b, complete sequence 19599-19632 10 0.706
AP018718_1 1.56|178961|35|AP018718|CRISPRCasFinder,CRT,PILER-CR 178961-178995 35 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1738934-1738968 10 0.714
AP018718_1 1.48|178392|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 178392-178425 34 MN694142 Marine virus AFVG_250M416, complete genome 13675-13708 12 0.647
AP018718_1 1.48|178392|34|AP018718|CRISPRCasFinder,CRT,PILER-CR 178392-178425 34 MN694696 Marine virus AFVG_250M540, complete genome 61476-61509 12 0.647

1. spacer 3.10|1059532|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 4, identity: 0.867

cggtggtcaagcgggatgttgagc-gtctgt	CRISPR spacer
ccgtggtcgagcgggatgttgagcagcctg-	Protospacer
* ******.*************** *.*** 

2. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MK433260 (Streptomyces phage Namo, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

3. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MF467949 (Streptomyces phage Spectropatronm, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

4. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to KX670789 (Streptomyces phage OlympicHelado, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

5. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MK967386 (Streptomyces phage Esketit, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

6. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MN204500 (Streptomyces phage Hoshi, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

7. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MT684589 (Streptomyces phage Maya, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

8. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to KX670790 (Streptomyces phage Rima, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

9. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MN204494 (Streptomyces phage Jaylociraptor, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

10. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MN204497 (Streptomyces phage Meibysrarus, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

11. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MK433259 (Streptomyces phage IceWarrior, complete genome) position: , mismatch: 4, identity: 0.867

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
cgaagtcggtgcgcgacaaggtcttcgaca	Protospacer
.*******.****** ************* 

12. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 5, identity: 0.833

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
tggacgcgctgcgcgccaaggtcttcgatc	Protospacer
**.*  ** *******************.*

13. spacer 2.1|580774|30|AP018718|CRISPRCasFinder matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.8

acgtctcattttccgccagcgccgactttc	CRISPR spacer
acgtctcattttccggcagcggctatgctc	Protospacer
*************** ***** * *. .**

14. spacer 2.1|580774|30|AP018718|CRISPRCasFinder matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.8

acgtctcattttccgccagcgccgactttc	CRISPR spacer
acgtctcattttccggcagcggctatgctc	Protospacer
*************** ***** * *. .**

15. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
agacctcaatgcgcgccaaggccttcgagc	Protospacer
 **  **.*************.****** *

16. spacer 3.2|1058996|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.767

tcgatttcgttcggccagacattggccggt	CRISPR spacer
atgatttcgttcagccagatattggtggtt	Protospacer
 .**********.******.*****. * *

17. spacer 3.2|1058996|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.767

tcgatttcgttcggccagacattggccggt	CRISPR spacer
atgatttcgttcagccagatattggtagtt	Protospacer
 .**********.******.*****. * *

18. spacer 3.2|1058996|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 7, identity: 0.767

tcgatttcgttcggccagacattggccggt	CRISPR spacer
atgatttcgttcagccagatattggtggtt	Protospacer
 .**********.******.*****. * *

19. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
ggaagtcgatgctcgccaacgtcttgccct	Protospacer
 *********** ****** *****   *.

20. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
ggaagtcgatgctcgccaacgtcttgccct	Protospacer
 *********** ****** *****   *.

21. spacer 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to HQ633061 (Synechococcus phage S-CBM2, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces) position: , mismatch: 7, identity: 0.767

catcaaaaaagcaagagatcaggcagcatc	CRISPR spacer
tcctaaaaaagcaagacttcaggcagcaac	Protospacer
. ..************  ********** *

22. spacer 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054716 (Salmonella enterica strain 85-0120 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

catcaaaaaagcaagagatcaggcagcatc	CRISPR spacer
aaacaaaaaagcaagatatcaggctgctct	Protospacer
 * ************* ******* ** ..

23. spacer 1.33|177337|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to MK112901 (Salmonella virus KFS-SE2, complete genome) position: , mismatch: 8, identity: 0.75

tcacgaggagcgcaaccatgcctgcacaaacc	CRISPR spacer
acaccagaagcgcaaccatgcctgtgcaggca	Protospacer
 *** **.****************..**..* 

24. spacer 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.765

agaagttcgcgcgcgcacttgccggggttctggt	CRISPR spacer
agcgattcgcgcgcgcagttgctggggttgcgtt	Protospacer
** ..************ ****.****** .* *

25. spacer 1.61|176354|30|AP018718|PILER-CR matches to NZ_CP010687 (Phaeobacter piscinae strain P14 plasmid pP14_f, complete sequence) position: , mismatch: 8, identity: 0.733

agcgactttacgaaaagtcgcttcgatttt	CRISPR spacer
cggtactttacgaaaattcgcttcggcgat	Protospacer
 *  ************ ********..  *

26. spacer 2.1|580774|30|AP018718|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

acgtctcattttccgccagcgccgactttc	CRISPR spacer
tcgcctcattgtccgccagcgccgccgcga	Protospacer
 **.****** ************* * .  

27. spacer 3.3|1059063|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.733

aatctgcgctggcgttggatacgacccccc	CRISPR spacer
acgaagcgctgtcgttggatacggccccag	Protospacer
*    ****** ***********.****  

28. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
cgcctgcaagcgctcggccagcgcctgcgc	Protospacer
    .*****.**********.*******.

29. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
cgcctgcaagcgctcggccagcgcctgcgc	Protospacer
    .*****.**********.*******.

30. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
cgcctgcaagcgctcggccagcgcctgcgc	Protospacer
    .*****.**********.*******.

31. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
cgcctgcaagcgctcggccagcgcctgcgc	Protospacer
    .*****.**********.*******.

32. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
cgcctgcaagcgctcggccagcgcctgcgc	Protospacer
    .*****.**********.*******.

33. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
cgcctgcaagcgctcggccagcgcctgcgc	Protospacer
    .*****.**********.*******.

34. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
ccgagtcgatgcgcgccaagggcatcagcg	Protospacer
. .****************** * **..* 

35. spacer 3.11|1059599|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 8, identity: 0.733

tgaagtcgatgcgcgccaaggtcttcgacc	CRISPR spacer
ttgccgggctgcacgccaaggtcttcgacc	Protospacer
* .    * ***.*****************

36. spacer 1.33|177337|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011000 (Sinorhizobium meliloti strain USDA1963 plasmid pHRB800, complete sequence) position: , mismatch: 9, identity: 0.719

tcacgaggagcgcaaccatgcctgcacaaacc	CRISPR spacer
tcacgaggagcacaaccatgcttgaggtgaag	Protospacer
***********.*********.** .  .*  

37. spacer 1.33|177337|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tcacgaggagcgcaaccatgcctgcacaaacc	CRISPR spacer
tcacgaggagcacaaccatgcttgaggtgaag	Protospacer
***********.*********.** .  .*  

38. spacer 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

agaagttcgc-----gcgcgcacttgccggggttctggt	CRISPR spacer
-----atcacgaacggcccgcacttgccgggcttctggt	Protospacer
      **.*     ** ************* *******

39. spacer 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.735

agaagttcgc-----gcgcgcacttgccggggttctggt	CRISPR spacer
-----atcacgaacggcccgcacttgccgggcttctggt	Protospacer
      **.*     ** ************* *******

40. spacer 1.34|177405|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 9, identity: 0.735

agaagttcgcgcgcgcacttgccggggttctggt	CRISPR spacer
ttgggctcaagcgcggacttgccggggatctggt	Protospacer
  ..*.**. ***** *********** ******

41. spacer 1.48|178392|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN614828 (Legionella fallonii LLAP-10 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.735

aacgagattagggaaatactcaaaaaaggcccag	CRISPR spacer
catgagattatggaactactcaaaaaatacgaat	Protospacer
 *.******* **** *********** .*  * 

42. spacer 3.8|1059398|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7

atgacgcaagtgctcggccagtgcctgcgt	CRISPR spacer
gatgcgcgagtgctcggccagcgcctggaa	Protospacer
.  .***.*************.***** . 

43. spacer 3.9|1059465|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 9, identity: 0.7

aagaatatatataacgcgcatggcgctgta	CRISPR spacer
tgtgcgctatataaggcgcacggcgctgta	Protospacer
 . .   ******* *****.*********

44. spacer 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to MG049919 (Shigella phage vB_SflS-ISF001, complete genome) position: , mismatch: 9, identity: 0.7

catcaaaaaagcaagagatcaggcagcatc	CRISPR spacer
ggaagcgaaagcaaaagatcaggcagcagc	Protospacer
 .  . .*******.************* *

45. spacer 3.12|1059666|30|AP018718|PILER-CR,CRISPRCasFinder,CRT matches to NC_041995 (Shigella phage vB_SsoS-ISF002, complete genome) position: , mismatch: 9, identity: 0.7

catcaaaaaagcaagagatcaggcagcatc	CRISPR spacer
ggaagcgaaagcaaaagatcaggcagcagc	Protospacer
 .  . .*******.************* *

46. spacer 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to MG962370 (Mycobacterium phage Kykar, complete genome) position: , mismatch: 10, identity: 0.688

aaaagtcgcttcgattttgaaggtcgagtagt	CRISPR spacer
cacgttcgcctcgattttgaagggcgagaccg	Protospacer
 * . ****.************* ****    

47. spacer 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to AF271693 (Mycobacterium virus Bxb1, complete genome) position: , mismatch: 10, identity: 0.688

aaaagtcgcttcgattttgaaggtcgagtagt	CRISPR spacer
cacgttcgcctcgattttgaagggcgagaccg	Protospacer
 * . ****.************* ****    

48. spacer 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to MH576975 (Mycobacterium phage Target, complete genome) position: , mismatch: 10, identity: 0.688

aaaagtcgcttcgattttgaaggtcgagtagt	CRISPR spacer
cacgttcgcctcgattttgaagggcgagaccg	Protospacer
 * . ****.************* ****    

49. spacer 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to JN699000 (Mycobacterium virus BillKnuckles, complete genome) position: , mismatch: 10, identity: 0.688

aaaagtcgcttcgattttgaaggtcgagtagt	CRISPR spacer
cacgttcgcctcgattttgaagggcgagaccg	Protospacer
 * . ****.************* ****    

50. spacer 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NC_002656 (Mycobacterium phage Bxb1, complete genome) position: , mismatch: 10, identity: 0.688

aaaagtcgcttcgattttgaaggtcgagtagt	CRISPR spacer
cacgttcgcctcgattttgaagggcgagaccg	Protospacer
 * . ****.************* ****    

51. spacer 1.3|175231|32|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to JN699016 (Mycobacterium phage Kugel, complete genome) position: , mismatch: 10, identity: 0.688

aaaagtcgcttcgattttgaaggtcgagtagt	CRISPR spacer
cacgttcgcctcgattttgaagggcgagaccg	Protospacer
 * . ****.************* ****    

52. spacer 1.4|175299|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039919 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626b, complete sequence) position: , mismatch: 10, identity: 0.706

tctcggcttacgagcaggccgagaacaagacttt	CRISPR spacer
aacccgctttcgaacaggccgagaacaaggccgg	Protospacer
  .* **** ***.***************.*.  

53. spacer 1.56|178961|35|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.714

gatggtgctcatggcatttacgttccgcaaatctt	CRISPR spacer
cctgccaatcgtggaatttacgttccgcaaatccg	Protospacer
  ** .. **.*** ******************. 

54. spacer 1.48|178392|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to MN694142 (Marine virus AFVG_250M416, complete genome) position: , mismatch: 12, identity: 0.647

aacgagattagggaaatactcaaaaaaggcccag	CRISPR spacer
tggcagattagagaaatactcaaagaagatttct	Protospacer
 .  *******.************.***....  

55. spacer 1.48|178392|34|AP018718|CRISPRCasFinder,CRT,PILER-CR matches to MN694696 (Marine virus AFVG_250M540, complete genome) position: , mismatch: 12, identity: 0.647

aacgagattagggaaatactcaaaaaaggcccag	CRISPR spacer
tggcagattcgagaaatactcaaaaaagatatct	Protospacer
 .  ***** *.****************.. .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. AP018719
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018719_1 81984-82077 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018719_1 1.1|82017|28|AP018719|CRISPRCasFinder 82017-82044 28 NZ_AP018719 Sterolibacteriaceae bacterium J5B plasmid pSTJ1, complete sequence 82017-82044 0 1.0
AP018719_1 1.1|82017|28|AP018719|CRISPRCasFinder 82017-82044 28 MN694680 Marine virus AFVG_250M16, complete genome 40729-40756 5 0.821

1. spacer 1.1|82017|28|AP018719|CRISPRCasFinder matches to NZ_AP018719 (Sterolibacteriaceae bacterium J5B plasmid pSTJ1, complete sequence) position: , mismatch: 0, identity: 1.0

ccatgccgcaccagaggatcctccgttg	CRISPR spacer
ccatgccgcaccagaggatcctccgttg	Protospacer
****************************

2. spacer 1.1|82017|28|AP018719|CRISPRCasFinder matches to MN694680 (Marine virus AFVG_250M16, complete genome) position: , mismatch: 5, identity: 0.821

ccatgccgcaccagaggatcctccgttg	CRISPR spacer
acctgtcgcaccagagggtcctccgttt	Protospacer
 * **.***********.********* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. AP018720
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018720_1 77-843 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018720_1 1.1|113|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 113-142 30 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 113-142 0 1.0
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 179-209 0 1.0
AP018720_1 1.3|246|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 246-276 31 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 246-276 0 1.0
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 313-342 0 1.0
AP018720_1 1.5|379|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 379-408 30 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 379-408 0 1.0
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 445-474 0 1.0
AP018720_1 1.7|511|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 511-541 31 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 511-541 0 1.0
AP018720_1 1.8|578|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 578-607 30 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 578-607 0 1.0
AP018720_1 1.9|644|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 644-673 30 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 644-673 0 1.0
AP018720_1 1.10|710|31|AP018720|CRISPRCasFinder,CRT 710-740 31 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 710-740 0 1.0
AP018720_1 1.11|777|31|AP018720|CRT 777-807 31 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 777-807 0 1.0
AP018720_1 1.3|246|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 246-276 31 AY539836 Burkholderia cenocepacia phage BcepMu, complete genome 23317-23347 5 0.839
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 246599-246628 5 0.833
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 249052-249081 5 0.833
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018851 Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.1, complete sequence 121262-121292 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 185526-185556 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP023286 Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pCuR, complete sequence 247423-247453 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018859 Xanthomonas citri pv. citri strain LH201 plasmid pLH201.1, complete sequence 15819-15849 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018848 Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.1, complete sequence 57974-58004 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018855 Xanthomonas citri pv. citri strain LH276 plasmid pLH276.1, complete sequence 44959-44989 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018729 Xanthomonas gardneri strain JS749-3 plasmid pJS749-3.1, complete sequence 45126-45156 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018726 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence 36914-36944 6 0.806
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP018732 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence 144048-144078 6 0.806
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 996708-996737 6 0.8
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 775542-775571 6 0.8
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 996707-996736 6 0.8
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 182463-182492 6 0.8
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 993568-993597 6 0.8
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 947452-947481 6 0.8
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 578604-578633 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 477933-477962 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 MN586025 Mycobacterium phage Mdavu, complete genome 18034-18063 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 KT281789 Mycobacterium phage Enkosi, complete genome 18046-18075 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 MH020245 Mycobacterium phage SgtBeansprout, complete genome 18046-18075 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 KX808132 Mycobacterium phage Amelie, complete genome 18046-18075 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 MH399770 Mycobacterium phage Biglebops, complete genome 18046-18075 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 MF919518 Mycobacterium phage LilPharaoh, complete genome 18046-18075 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 877517-877546 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 387478-387507 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 502945-502974 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 228820-228849 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 386997-387026 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 199961-199990 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 91594-91623 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 356816-356845 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 37866-37895 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 269209-269238 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 258104-258133 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 290524-290553 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 11399-11428 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 379885-379914 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 276225-276254 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 130285-130314 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 244709-244738 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 273339-273368 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 122715-122744 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 270537-270566 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 341003-341032 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 280254-280283 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 75081-75110 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 394469-394498 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 130126-130155 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 154103-154132 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 292284-292313 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP033036 Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence 195038-195067 7 0.767
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 296413-296442 7 0.767
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 47129-47158 8 0.733
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 738364-738393 8 0.733
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NC_011273 Mycobacterium phage Myrna, complete genome 154454-154483 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 350558-350587 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NC_010509 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence 45060-45089 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP053022 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence 79564-79593 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP035507 Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence 75598-75627 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP023455 Rhodobacteraceae bacterium QY30 plasmid unnamed, complete sequence 85309-85338 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1057029-1057058 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP022306 Thalassococcus sp. S3 plasmid pS3C, complete sequence 42460-42489 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NC_005342 Burkholderia phage Bcep43, complete genome 12278-12307 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 EF602154 Burkholderia phage BcepNY3, complete genome 10851-10880 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NC_004333 Burkholderia phage Bcep781, complete genome 12304-12333 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 AY368235 Burkholderia cepacia phage Bcep43, complete genome 12278-12307 8 0.733
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 AF543311 Burkholderia cepacia phage Bcep781, complete genome 12304-12333 8 0.733
AP018720_1 1.9|644|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 644-673 30 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 248083-248112 8 0.733
AP018720_1 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 313-342 30 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 139739-139768 9 0.7
AP018720_1 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT 445-474 30 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 270622-270651 9 0.7
AP018720_1 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT 179-209 31 NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 24572-24602 10 0.677

1. spacer 1.1|113|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgttgctacgccggatgtagcgccctccg	CRISPR spacer
ctgttgctacgccggatgtagcgccctccg	Protospacer
******************************

2. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcgacgatttccgcttgtcgcgctgccgt	CRISPR spacer
aagcgacgatttccgcttgtcgcgctgccgt	Protospacer
*******************************

3. spacer 1.3|246|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

cgggtcgtaaaccttcaggtgcgggtagcac	CRISPR spacer
cgggtcgtaaaccttcaggtgcgggtagcac	Protospacer
*******************************

4. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
gacagccgcgcaggatcgatcacctgcaag	Protospacer
******************************

5. spacer 1.5|379|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

tgggagcctaagccatgtatgggattctcg	CRISPR spacer
tgggagcctaagccatgtatgggattctcg	Protospacer
******************************

6. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaaggcgcgccgccgg	Protospacer
******************************

7. spacer 1.7|511|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

agtccgaacccagcaatcagcatcgtctcga	CRISPR spacer
agtccgaacccagcaatcagcatcgtctcga	Protospacer
*******************************

8. spacer 1.8|578|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

tgctgcggttgtatctgcaatcgaaggtct	CRISPR spacer
tgctgcggttgtatctgcaatcgaaggtct	Protospacer
******************************

9. spacer 1.9|644|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

gccgtaggcggcgcttgcccaccggcgaaa	CRISPR spacer
gccgtaggcggcgcttgcccaccggcgaaa	Protospacer
******************************

10. spacer 1.10|710|31|AP018720|CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatacgtcagcatctagcgatataggg	CRISPR spacer
ttgccatacgtcagcatctagcgatataggg	Protospacer
*******************************

11. spacer 1.11|777|31|AP018720|CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 0, identity: 1.0

aggctggacggtggtgcttgccctcccaagc	CRISPR spacer
aggctggacggtggtgcttgccctcccaagc	Protospacer
*******************************

12. spacer 1.3|246|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to AY539836 (Burkholderia cenocepacia phage BcepMu, complete genome) position: , mismatch: 5, identity: 0.839

cgggtcgtaaaccttcaggtgcgggtagcac	CRISPR spacer
ggtgtcgtagaccttcacgtgcgggtagcag	Protospacer
 * ******.******* ************ 

13. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.833

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
tgcggcaagcgccgcacggcgcgccgcctc	Protospacer
 * ************* ***********  

14. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 5, identity: 0.833

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
gcgggcaagcgccgcaagccgggccgcctg	Protospacer
* .*************** ** ****** *

15. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018851 (Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

16. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

17. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023286 (Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pCuR, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

18. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018859 (Xanthomonas citri pv. citri strain LH201 plasmid pLH201.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

19. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018848 (Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

20. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018855 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

21. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018729 (Xanthomonas gardneri strain JS749-3 plasmid pJS749-3.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

22. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018726 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

23. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018732 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence) position: , mismatch: 6, identity: 0.806

aagcgacgatttccgcttgtcgc--gctgccgt	CRISPR spacer
aagcgaggatttcagcttgtcgctagcaacc--	Protospacer
****** ****** *********  ** .**  

24. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaacgcgcgcggtgtt	Protospacer
***************** ****** *.   

25. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaacgcgcgcggtgtt	Protospacer
***************** ****** *.   

26. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaacgcgcgcggtgtt	Protospacer
***************** ****** *.   

27. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaacgcgcgcggtgtt	Protospacer
***************** ****** *.   

28. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaacgcgcgcggtgtt	Protospacer
***************** ****** *.   

29. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggaggcaagcgccgcaacgcgcgcggtgtt	Protospacer
***************** ****** *.   

30. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
gtctcatgcgcaggctcgattacctgcaag	Protospacer
* *   .******* *****.*********

31. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
gcctgccgcgccggatccatcacctgccgc	Protospacer
* * ******* ***** ********* . 

32. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MN586025 (Mycobacterium phage Mdavu, complete genome) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
attacccgcgcaggatcggtcacctgtatg	Protospacer
. .* *************.*******.* *

33. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to KT281789 (Mycobacterium phage Enkosi, complete genome) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
attacccgcgcaggatcggtcacctgtatg	Protospacer
. .* *************.*******.* *

34. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MH020245 (Mycobacterium phage SgtBeansprout, complete genome) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
attacccgcgcaggatcggtcacctgtatg	Protospacer
. .* *************.*******.* *

35. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to KX808132 (Mycobacterium phage Amelie, complete genome) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
attacccgcgcaggatcggtcacctgtatg	Protospacer
. .* *************.*******.* *

36. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MH399770 (Mycobacterium phage Biglebops, complete genome) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
attacccgcgcaggatcggtcacctgtatg	Protospacer
. .* *************.*******.* *

37. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MF919518 (Mycobacterium phage LilPharaoh, complete genome) position: , mismatch: 7, identity: 0.767

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
attacccgcgcaggatcggtcacctgtatg	Protospacer
. .* *************.*******.* *

38. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ccgggcaagcgccgcaagccgcgccgaaag	Protospacer
  .*************** *******  .*

39. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

40. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

41. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

42. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

43. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cggggcaagcgcggcaaggcgcgccaggcg	Protospacer
 *.********* ************.   *

44. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cggggcaagcgcggcaaggcgcgccaggcg	Protospacer
 *.********* ************.   *

45. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
gtcctcaagcgccgcaaggcgcgctgcgag	Protospacer
*    *******************.** .*

46. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

47. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

48. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

49. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

50. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cggggcaagcgcggcaaggcgcgccaggcg	Protospacer
 *.********* ************.   *

51. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

52. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

53. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

54. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

55. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

56. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cggggcaagcgcggcaaggcgcgccaggcg	Protospacer
 *.********* ************.   *

57. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

58. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

59. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

60. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

61. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

62. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

63. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

64. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ggcggcaagcgcctcaaggcgcgctgattt	Protospacer
** ********** **********.* .  

65. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
tggtgcgagcgccgcaaggcgcgacgctag	Protospacer
 *. **.**************** ***..*

66. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 7, identity: 0.767

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
tggtgcgagcgccgcaaggcgcgacgctag	Protospacer
 *. **.**************** ***..*

67. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
ggctgccccgcaggatcgatcacctttgca	Protospacer
*.* *** ***************** .. .

68. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
aacagccgcgcgggatcgagcaccgccccc	Protospacer
.**********.******* ****  *   

69. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 8, identity: 0.733

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
gtgggccgcgctggctcgatcacctgcctc	Protospacer
*  .******* ** ************   

70. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
tctcccaagacccgcaaggcgcgccgccgc	Protospacer
     ****  ****************** 

71. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_010509 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
atcggcaagcgcggcaaggtgcgccgtagc	Protospacer
.  ********* ******.******. * 

72. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
gaaggaaagcgccgcaaggcgcgtcttatc	Protospacer
*.*** *****************.* .   

73. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035507 (Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
tgcttcaagcgccgcgaggcgcgcggccaa	Protospacer
 *   **********.******** ***..

74. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023455 (Rhodobacteraceae bacterium QY30 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cctgaaaagcgccgaagggcgcgccgccgc	Protospacer
   *. ******** *.************ 

75. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
tcggcccgccgccgcacggcgcgccgccgg	Protospacer
  .* * . ******* *************

76. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022306 (Thalassococcus sp. S3 plasmid pS3C, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
gatggccagcgcctcaaggcgcgccgggtc	Protospacer
*. *** ****** ************    

77. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_005342 (Burkholderia phage Bcep43, complete genome) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cgcgcaggacgccgcaatgcgcgccgccgg	Protospacer
 * *  ...******** ************

78. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cgcgcaggacgccgcaatgcgcgccgccgg	Protospacer
 * *  ...******** ************

79. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NC_004333 (Burkholderia phage Bcep781, complete genome) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cgcgcaggacgccgcaatgcgcgccgccgg	Protospacer
 * *  ...******** ************

80. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to AY368235 (Burkholderia cepacia phage Bcep43, complete genome) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cgcgcaggacgccgcaatgcgcgccgccgg	Protospacer
 * *  ...******** ************

81. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to AF543311 (Burkholderia cepacia phage Bcep781, complete genome) position: , mismatch: 8, identity: 0.733

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
cgcgcaggacgccgcaatgcgcgccgccgg	Protospacer
 * *  ...******** ************

82. spacer 1.9|644|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gccgtaggcggcgcttgcccaccggcgaaa	CRISPR spacer
agcgtaggcggggcttgcccaccgcgatag	Protospacer
. ********* ************  . *.

83. spacer 1.4|313|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 9, identity: 0.7

gacagccgcgcaggatcgatcacctgcaag	CRISPR spacer
atttctggagcaggatcgatgacctgcaag	Protospacer
. .  . * *********** *********

84. spacer 1.6|445|30|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ggaggcaagcgccgcaaggcgcgccgccgg	CRISPR spacer
ctcaaggagctccgcaaggcgcgccgcctg	Protospacer
   .. .*** ***************** *

85. spacer 1.2|179|31|AP018720|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 10, identity: 0.677

aagcgacgatttccgcttgtcgcgctgccgt	CRISPR spacer
gccggaccatttcagcttgtcgcgctggacc	Protospacer
.   *** ***** *************   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage