Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033062 Synechococcus elongatus UTEX 3055 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 1 crisprs NA 0 18 0 0
CP033061 Synechococcus elongatus UTEX 3055 chromosome, complete genome 0 crisprs NA 0 0 0 0

Results visualization

1. CP033063
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033063_1 2384-3707 Orphan I-A,I-B,II-B
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033063_1 1.1|2420|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 2420-2454 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2420-2454 0 1.0
CP033063_1 1.2|2491|37|CP033063|PILER-CR,CRISPRCasFinder,CRT 2491-2527 37 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2491-2527 0 1.0
CP033063_1 1.3|2564|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 2564-2598 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2564-2598 0 1.0
CP033063_1 1.4|2635|36|CP033063|PILER-CR,CRISPRCasFinder,CRT 2635-2670 36 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2635-2670 0 1.0
CP033063_1 1.5|2707|34|CP033063|PILER-CR,CRISPRCasFinder,CRT 2707-2740 34 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2707-2740 0 1.0
CP033063_1 1.6|2777|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 2777-2811 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2777-2811 0 1.0
CP033063_1 1.7|2848|37|CP033063|PILER-CR,CRISPRCasFinder,CRT 2848-2884 37 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2848-2884 0 1.0
CP033063_1 1.8|2921|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 2921-2955 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2921-2955 0 1.0
CP033063_1 1.9|2992|36|CP033063|PILER-CR,CRISPRCasFinder,CRT 2992-3027 36 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 2992-3027 0 1.0
CP033063_1 1.10|3064|37|CP033063|PILER-CR,CRISPRCasFinder,CRT 3064-3100 37 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3064-3100 0 1.0
CP033063_1 1.11|3137|34|CP033063|PILER-CR,CRISPRCasFinder,CRT 3137-3170 34 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3137-3170 0 1.0
CP033063_1 1.12|3207|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 3207-3241 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3207-3241 0 1.0
CP033063_1 1.13|3278|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 3278-3312 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3278-3312 0 1.0
CP033063_1 1.14|3349|36|CP033063|PILER-CR,CRISPRCasFinder,CRT 3349-3384 36 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3349-3384 0 1.0
CP033063_1 1.15|3421|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 3421-3455 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3421-3455 0 1.0
CP033063_1 1.16|3492|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 3492-3526 35 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3492-3526 0 1.0
CP033063_1 1.17|3563|36|CP033063|PILER-CR,CRISPRCasFinder,CRT 3563-3598 36 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3563-3598 0 1.0
CP033063_1 1.18|3635|37|CP033063|PILER-CR,CRISPRCasFinder,CRT 3635-3671 37 NZ_CP033063 Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence 3635-3671 0 1.0
CP033063_1 1.12|3207|35|CP033063|PILER-CR,CRISPRCasFinder,CRT 3207-3241 35 NZ_CP028898 Gammaproteobacteria bacterium DM2 plasmid unnamed, complete sequence 2834-2868 8 0.771

1. spacer 1.1|2420|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ttaccgggtcaaggtttggcgctggtggatttcca	CRISPR spacer
ttaccgggtcaaggtttggcgctggtggatttcca	Protospacer
***********************************

2. spacer 1.2|2491|37|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

agagacatctgggaagagaacggctgggacaaaaaat	CRISPR spacer
agagacatctgggaagagaacggctgggacaaaaaat	Protospacer
*************************************

3. spacer 1.3|2564|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gagagagacttgctagagattgcagataatctcta	CRISPR spacer
gagagagacttgctagagattgcagataatctcta	Protospacer
***********************************

4. spacer 1.4|2635|36|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

agaggcgggccaccagggaggccaggaaggttaggg	CRISPR spacer
agaggcgggccaccagggaggccaggaaggttaggg	Protospacer
************************************

5. spacer 1.5|2707|34|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gcattcaagctaggaaaaggcccccgcgtctcag	CRISPR spacer
gcattcaagctaggaaaaggcccccgcgtctcag	Protospacer
**********************************

6. spacer 1.6|2777|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcaagacttgggcagtggatatcggtggcctttc	CRISPR spacer
ctcaagacttgggcagtggatatcggtggcctttc	Protospacer
***********************************

7. spacer 1.7|2848|37|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gcaaacacaggccgtggccctcgcgtgacagtccagt	CRISPR spacer
gcaaacacaggccgtggccctcgcgtgacagtccagt	Protospacer
*************************************

8. spacer 1.8|2921|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

actcaacttctcagtcaaacccctactttatagga	CRISPR spacer
actcaacttctcagtcaaacccctactttatagga	Protospacer
***********************************

9. spacer 1.9|2992|36|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gggaagatgacatcgacattgacgagtttgtcagcc	CRISPR spacer
gggaagatgacatcgacattgacgagtttgtcagcc	Protospacer
************************************

10. spacer 1.10|3064|37|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gaacccctaggactgcggtttaagcttctcaagtctc	CRISPR spacer
gaacccctaggactgcggtttaagcttctcaagtctc	Protospacer
*************************************

11. spacer 1.11|3137|34|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccaggcggtttgtgcggcaagaccggtgagat	CRISPR spacer
ttccaggcggtttgtgcggcaagaccggtgagat	Protospacer
**********************************

12. spacer 1.12|3207|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

tagccctgcatcagttcctcacccgcagctaggcc	CRISPR spacer
tagccctgcatcagttcctcacccgcagctaggcc	Protospacer
***********************************

13. spacer 1.13|3278|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ttatagaaatggtaggcaaatcctgcccaagctaa	CRISPR spacer
ttatagaaatggtaggcaaatcctgcccaagctaa	Protospacer
***********************************

14. spacer 1.14|3349|36|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

actctcaagacacgagggcctccttatggagttgct	CRISPR spacer
actctcaagacacgagggcctccttatggagttgct	Protospacer
************************************

15. spacer 1.15|3421|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgttggggtctttgggcttgtgcagcccgatcgt	CRISPR spacer
ttgttggggtctttgggcttgtgcagcccgatcgt	Protospacer
***********************************

16. spacer 1.16|3492|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

acggaatcgcaactattcggtactaatcgccggtg	CRISPR spacer
acggaatcgcaactattcggtactaatcgccggtg	Protospacer
***********************************

17. spacer 1.17|3563|36|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ccccagaaaagaacacagggggtcgctctccctctg	CRISPR spacer
ccccagaaaagaacacagggggtcgctctccctctg	Protospacer
************************************

18. spacer 1.18|3635|37|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033063 (Synechococcus elongatus UTEX 3055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

cgctcaataccggctgcggtttgcgggaaaaactcac	CRISPR spacer
cgctcaataccggctgcggtttgcgggaaaaactcac	Protospacer
*************************************

19. spacer 1.12|3207|35|CP033063|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028898 (Gammaproteobacteria bacterium DM2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771 

tagccctgcatcagttcctcacccgcagctaggcc--	CRISPR spacer
tagccctgcatcagttcagcacccg--ggtggcactg	Protospacer
*****************  ******  * *.*  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage