Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033688 Mycobacterium avium subsp. paratuberculosis strain Telford chromosome, complete genome 1 crisprs cas4,WYL,csa3,cas3,DinG,DEDDh 0 2 1 0

Results visualization

1. CP033688
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033688_1 422196-422286 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033688_1 1.1|422229|25|CP033688|CRISPRCasFinder 422229-422253 25 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 131283-131307 4 0.84
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 79911-79940 6 0.8
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 125440-125469 7 0.767
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 576541-576570 7 0.767
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NC_013193 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence 107046-107075 7 0.767
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 517672-517701 7 0.767
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 MT657333 Microbacterium phage Casend, complete genome 60372-60401 7 0.767
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4993432-4993461 8 0.733
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 34530-34559 8 0.733
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 132707-132736 9 0.7
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 326083-326112 9 0.7
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1583679-1583708 9 0.7
CP033688_2 2.1|1311790|30|CP033688|CRISPRCasFinder 1311790-1311819 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 369234-369263 9 0.7

1. spacer 1.1|422229|25|CP033688|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 4, identity: 0.84

gggtgggatggcccgcctcctcctc	CRISPR spacer
ctatgggatggcccgcctcctcttc	Protospacer
  .*******************.**

2. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.8

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
gctcccgcggcggcggttcggtgcgcaggg	Protospacer
 * ********* **********.**.* *

3. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggtcgcgtcgccggttcggtgtgcgggc	Protospacer
.*. .**** ******************  

4. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.767

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
cgggcagcggcgccggctcggtgtgcggca	Protospacer
. . * **********.************.

5. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 7, identity: 0.767

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggcagcggcgccggttcgctgtgccgct	Protospacer
.*. * ************** ***** ** 

6. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccgtcaccgccgccggttcggtgagcggcg	Protospacer
.*..*  ** ************* ******

7. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 7, identity: 0.767

tcacccgcggcgccggttcggtgtgcggcg----	CRISPR spacer
tctcccgcggcaccggttcggt----gacgccct	Protospacer
** ********.**********    *.**    

8. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggccgcggcgcccgttcggtgagcgagc	Protospacer
.*. ********** ******** ***.  

9. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccttccgcgtcgccggttcggtgtgttcgg	Protospacer
.* .***** ***************.   *

10. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.7

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
cgggtcaatgcgccggttcggtgtccggcg	Protospacer
. . .*.  *************** *****

11. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 9, identity: 0.7

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccacccgcggcggcagttcggtgtaataat	Protospacer
.*********** *.*********.  .  

12. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
agcagagcggccccggttcggggtgcggcc	Protospacer
      ***** ********* ******* 

13. spacer 2.1|1311790|30|CP033688|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.7

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
agcagagcggccccggttcggggtgcggcc	Protospacer
      ***** ********* ******* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3785711 : 3850567 59 Tupanvirus(17.65%) holin,tRNA,protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage