Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034486 Staphylococcus aureus strain PMB 64-1 chromosome, complete genome 9 crisprs NA 2 2 0 0

Results visualization

1. CP034486
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_1 43502-43588 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_2 204563-204643 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_3 594904-594996 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_4 1042941-1043026 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_5 1539725-1539805 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_6 1651164-1651249 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_7 1805253-1805350 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_8 1822167-1822245 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034486_9 1959178-1959285 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2094900-2094928 0 1.0
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 874001-874029 1 0.966
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 1185944-1185972 1 0.966
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2485071-2485099 1 0.966
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 210022-210050 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 253704-253732 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 253761-253789 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 302615-302643 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 521895-521923 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 522008-522036 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 1008650-1008678 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2281050-2281078 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2281108-2281136 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2281166-2281194 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2390541-2390569 2 0.931
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 CP034486.1 2405761-2405789 2 0.931
CP034486_6 6.1|1651194|26|CP034486|CRISPRCasFinder 1651194-1651219 26 CP034486.1 521817-521842 2 0.923

1. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2094900-2094928, mismatch: 0, identity: 1.0

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtttgtagaatttcttttcgaaa	Protospacer
*****************************

2. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 874001-874029, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaa	Protospacer
********.********************

3. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 1185944-1185972, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaa	Protospacer
********.********************

4. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2485071-2485099, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcttgtagaatttcttttcgaaa	Protospacer
*******.*********************

5. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 210022-210050, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaaattcttttcgaaa	Protospacer
********.******* ************

6. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 253704-253732, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

7. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 253761-253789, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

8. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 302615-302643, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

9. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 521895-521923, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttctttttgaaa	Protospacer
********.***************.****

10. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 522008-522036, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttctttttgaaa	Protospacer
********.***************.****

11. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 1008650-1008678, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

12. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2281050-2281078, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

13. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2281108-2281136, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

14. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2281166-2281194, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

15. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2390541-2390569, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

16. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to position: 2405761-2405789, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

17. spacer 6.1|1651194|26|CP034486|CRISPRCasFinder matches to position: 521817-521842, mismatch: 2, identity: 0.923

tcgtcaccttctatgttggggccccg	CRISPR spacer
tcgtcagcttctgtgttggggccccg	Protospacer
****** *****.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034486_2 2.1|204589|29|CP034486|CRISPRCasFinder 204589-204617 29 MN693281 Marine virus AFVG_25M371, complete genome 6448-6476 7 0.759
CP034486_4 4.1|1042968|32|CP034486|CRISPRCasFinder 1042968-1042999 32 MT889383 Mycobacterium phage MiniLon, complete genome 11248-11279 9 0.719
CP034486_4 4.1|1042968|32|CP034486|CRISPRCasFinder 1042968-1042999 32 KT281791 Mycobacterium phage Lolly9, complete genome 11248-11279 9 0.719

1. spacer 2.1|204589|29|CP034486|CRISPRCasFinder matches to MN693281 (Marine virus AFVG_25M371, complete genome) position: , mismatch: 7, identity: 0.759

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtttgtaggatttcttctaagtg	Protospacer
**************.*******.* .. .

2. spacer 4.1|1042968|32|CP034486|CRISPRCasFinder matches to MT889383 (Mycobacterium phage MiniLon, complete genome) position: , mismatch: 9, identity: 0.719

gcacattattgaaatctgacttttggtcagct	CRISPR spacer
accccttcttgaaatctgactttaggtcctga	Protospacer
.* * ** *************** ****    

3. spacer 4.1|1042968|32|CP034486|CRISPRCasFinder matches to KT281791 (Mycobacterium phage Lolly9, complete genome) position: , mismatch: 9, identity: 0.719

gcacattattgaaatctgacttttggtcagct	CRISPR spacer
accccttcttgaaatctgactttaggtcctga	Protospacer
.* * ** *************** ****    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage