Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025918 Escherichia coli strain 120899 plasmid p120899_76, complete sequence 0 crisprs NA 0 0 0 0
CP025916 Escherichia coli strain 120899 chromosome, complete genome 7 crisprs NA 0 15 0 0
CP025917 Escherichia coli strain 120899 plasmid p120899_146, complete sequence 0 crisprs NA 0 0 0 0
CP025919 Escherichia coli strain 120899 plasmid p120899_50, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP025916
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_1 294990-295081 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_2 610739-610884 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_3 850310-850406 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_4 2970664-2970781 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_5 3400523-3401039 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_6 3426884-3427217 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025916_7 4617595-4617718 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025916_1 1.1|295016|40|CP025916|CRISPRCasFinder 295016-295055 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP025916_7 7.1|4617638|38|CP025916|CRISPRCasFinder 4617638-4617675 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP025916_6 6.5|3427157|32|CP025916|CRT 3427157-3427188 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 39364-39395 5 0.844
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 99-130 6 0.812
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 97059-97090 7 0.781
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 362913-362944 7 0.781
CP025916_5 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT 3400979-3401010 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP025916_5 5.14|3400857|34|CP025916|PILER-CR 3400857-3400890 34 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 447778-447811 7 0.794
CP025916_6 6.5|3427157|32|CP025916|CRT 3427157-3427188 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP025916_5 5.1|3400552|32|CP025916|CRISPRCasFinder,CRT 3400552-3400583 32 MK972713 Salmonella phage SW5, complete genome 18872-18903 8 0.75
CP025916_5 5.1|3400552|32|CP025916|CRISPRCasFinder,CRT 3400552-3400583 32 MK972714 Salmonella phage SW3, complete genome 19094-19125 8 0.75
CP025916_5 5.1|3400552|32|CP025916|CRISPRCasFinder,CRT 3400552-3400583 32 NC_049460 Salmonella phage SI7, complete genome 9314-9345 8 0.75
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57773 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 376196-376227 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 MH155873 Microbacterium phage Paschalis, complete genome 25033-25064 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 546692-546723 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 202063-202094 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 86816-86847 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 570824-570855 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 500613-500644 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 162469-162500 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 89306-89337 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 638043-638074 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1365174-1365205 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 124144-124175 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 496002-496033 8 0.75
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 767196-767227 8 0.75
CP025916_5 5.7|3400918|32|CP025916|CRISPRCasFinder,CRT 3400918-3400949 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP025916_5 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT 3400979-3401010 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP025916_5 5.14|3400857|34|CP025916|PILER-CR 3400857-3400890 34 NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 97-130 8 0.765
CP025916_6 6.1|3426913|32|CP025916|PILER-CR,CRISPRCasFinder,CRT 3426913-3426944 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
CP025916_6 6.3|3427035|32|CP025916|PILER-CR,CRISPRCasFinder,CRT 3427035-3427066 32 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9223 8 0.75
CP025916_6 6.5|3427157|32|CP025916|CRT 3427157-3427188 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP025916_5 5.3|3400674|32|CP025916|CRISPRCasFinder,CRT 3400674-3400705 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52228 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60757-60788 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41217-41248 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-728 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41217-41248 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184797 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54225-54256 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46038-46069 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51662-51693 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26853 9 0.719
CP025916_5 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT 3400735-3400766 32 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145953-145984 9 0.719
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 447780-447811 9 0.719
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 335975-336006 9 0.719
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 207494-207525 9 0.719
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 226955-226986 9 0.719
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 NZ_CP014519 Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence 62779-62810 9 0.719
CP025916_5 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT 3400857-3400888 32 MH834603 Arthrobacter phage Bridgette, complete genome 29555-29586 9 0.719
CP025916_5 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT 3400979-3401010 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57775 9 0.735
CP025916_5 5.14|3400857|34|CP025916|PILER-CR 3400857-3400890 34 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 97059-97092 9 0.735
CP025916_5 5.14|3400857|34|CP025916|PILER-CR 3400857-3400890 34 MH155873 Microbacterium phage Paschalis, complete genome 25033-25066 9 0.735
CP025916_6 6.1|3426913|32|CP025916|PILER-CR,CRISPRCasFinder,CRT 3426913-3426944 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
CP025916_6 6.5|3427157|32|CP025916|CRT 3427157-3427188 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP025916_5 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT 3400979-3401010 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
CP025916_5 5.9|3400552|34|CP025916|PILER-CR 3400552-3400585 34 MK972713 Salmonella phage SW5, complete genome 18872-18905 10 0.706
CP025916_5 5.9|3400552|34|CP025916|PILER-CR 3400552-3400585 34 MK972714 Salmonella phage SW3, complete genome 19094-19127 10 0.706
CP025916_5 5.9|3400552|34|CP025916|PILER-CR 3400552-3400585 34 NC_049460 Salmonella phage SI7, complete genome 9314-9347 10 0.706
CP025916_5 5.11|3400674|34|CP025916|PILER-CR 3400674-3400707 34 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52230 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-730 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184799 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26855 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60755-60788 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41215-41248 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41215-41248 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54223-54256 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46036-46069 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51660-51693 10 0.706
CP025916_5 5.12|3400735|34|CP025916|PILER-CR 3400735-3400768 34 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145951-145984 10 0.706

1. spacer 1.1|295016|40|CP025916|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 7.1|4617638|38|CP025916|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 6.5|3427157|32|CP025916|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
*.*********************.*******.

4. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.844

--tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
agtcg--gcggtgagcgcggcgtcgctcaggatg	Protospacer
  ***  ******.***********.******* 

5. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 6, identity: 0.812

tcggtg-cggtgggcgcggcgtcgttcaggatc	CRISPR spacer
-cgtcgtcggtggtctcggcgtcgttcaggatg	Protospacer
 ** .* ****** * **************** 

6. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 7, identity: 0.781

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tggcgacggtgggcgcggcctcgtccaggagc	Protospacer
* *  .************* ****.***** *

7. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 7, identity: 0.781

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
ccagtccggcgggcgcggcgtcgttctcgaac	Protospacer
.*.** ***.****************  ** *

8. spacer 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

9. spacer 5.14|3400857|34|CP025916|PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 7, identity: 0.794

tcggtgcggtgggcgcggcgtcgttcaggatcgt--	CRISPR spacer
gcggtgcggtgggcgcgtcgtcgctc--tatcatct	Protospacer
 **************** *****.**   ***.*  

10. spacer 6.5|3427157|32|CP025916|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcactggatgcgatgatggat-atcactta	CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc-	Protospacer
********** ******** ***. **** .. 

11. spacer 5.1|3400552|32|CP025916|CRISPRCasFinder,CRT matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 8, identity: 0.75

acaaatgacactgagtgaaaagcagcagcgat	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt	Protospacer
   ***** ************.*****.*  *

12. spacer 5.1|3400552|32|CP025916|CRISPRCasFinder,CRT matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 8, identity: 0.75

acaaatgacactgagtgaaaagcagcagcgat	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt	Protospacer
   ***** ************.*****.*  *

13. spacer 5.1|3400552|32|CP025916|CRISPRCasFinder,CRT matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 8, identity: 0.75

acaaatgacactgagtgaaaagcagcagcgat	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt	Protospacer
   ***** ************.*****.*  *

14. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 8, identity: 0.75

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttc	Protospacer
 *   *. ******** *********** ***

15. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

16. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tcgccgcggtgggcgcggcgtcgtatcggtcg	Protospacer
*** .******************* . ** . 

17. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *  

18. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tgggtgcgctgggcgcggcctcgttgtcggtg	Protospacer
* ****** ********** *****   *.* 

19. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcaag	Protospacer
 *.*.***.*** *************** *  

20. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *  

21. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *  

22. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

23. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

24. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *  

25. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

26. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

27. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

28. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *  

29. spacer 5.7|3400918|32|CP025916|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

30. spacer 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

31. spacer 5.14|3400857|34|CP025916|PILER-CR matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 8, identity: 0.765

tcggtg-cggtgggcgcggcgtcgttcaggatcgt	CRISPR spacer
-cgtcgtcggtggtctcggcgtcgttcaggatgtc	Protospacer
 ** .* ****** * ****************  .

32. spacer 6.1|3426913|32|CP025916|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

33. spacer 6.3|3427035|32|CP025916|PILER-CR,CRISPRCasFinder,CRT matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75

tccgtttggtccaccaaatgtttgatgcttca	CRISPR spacer
tcttatcaatccaccaaatttttgattcttca	Protospacer
**.  *...********** ****** *****

34. spacer 6.5|3427157|32|CP025916|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggata---tcactta	CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac---	Protospacer
*********** ***.******* .    ***   

35. spacer 5.3|3400674|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccgatcacacgctcccacgggccgtaccagtc	CRISPR spacer
ttcggcagccgctcccaccggccggaccagtc	Protospacer
.. . **  ********* ***** *******

36. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

37. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

38. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

39. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

40. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

41. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

42. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

43. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

44. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

45. spacer 5.4|3400735|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

46. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
gcggtgcggtgggcgcgtcgtcgctctatcat	Protospacer
 **************** *****.** .   .

47. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tcggtgcggtgtgcgcggcggcggcggcggac	Protospacer
*********** ******** ** . . *. *

48. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
aggtcgtggtgggcgcggcgtcctgcaggaag	Protospacer
  * .*.*************** * *****  

49. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
ggggtgcgggcggcgcggcgtcgttggtgact	Protospacer
  *******  ************** . **..

50. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP014519 (Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
gcaatgccgtgggcgcgccgtcgttcatggga	Protospacer
 *..*** ********* ********* *.  

51. spacer 5.6|3400857|32|CP025916|CRISPRCasFinder,CRT matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 9, identity: 0.719

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tcgcttcggtgggcgcggcgtcgagggggccg	Protospacer
*** * *****************   .** . 

52. spacer 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*  

53. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 9, identity: 0.735

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttcga	Protospacer
 *   *. ******** *********** **** 

54. spacer 5.14|3400857|34|CP025916|PILER-CR matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.735

tcggtgcggtgggcgcggcgtcgttcaggatcgt	CRISPR spacer
tggcgacggtgggcgcggcctcgtccaggagctg	Protospacer
* *  .************* ****.***** *  

55. spacer 5.14|3400857|34|CP025916|PILER-CR matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 9, identity: 0.735

tcggtgcggtgggcgcggcgtcgttcaggatcgt	CRISPR spacer
tcgccgcggtgggcgcggcgtcgtatcggtcgct	Protospacer
*** .******************* . ** .  *

56. spacer 6.1|3426913|32|CP025916|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

57. spacer 6.5|3427157|32|CP025916|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag	Protospacer
***********  ***********.. *.  .

58. spacer 5.8|3400979|32|CP025916|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

59. spacer 5.9|3400552|34|CP025916|PILER-CR matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 10, identity: 0.706

acaaatgacactgagtgaaaagcagcagcgatgt	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc	Protospacer
   ***** ************.*****.*  * .

60. spacer 5.9|3400552|34|CP025916|PILER-CR matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 10, identity: 0.706

acaaatgacactgagtgaaaagcagcagcgatgt	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc	Protospacer
   ***** ************.*****.*  * .

61. spacer 5.9|3400552|34|CP025916|PILER-CR matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 10, identity: 0.706

acaaatgacactgagtgaaaagcagcagcgatgt	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc	Protospacer
   ***** ************.*****.*  * .

62. spacer 5.11|3400674|34|CP025916|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ccgatcacacgctcccacgggccgtaccagtcgt	CRISPR spacer
ttcggcagccgctcccaccggccggaccagtcga	Protospacer
.. . **  ********* ***** ******** 

63. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

64. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

65. spacer 5.12|3400735|34|CP025916|PILER-CR matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

66. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

67. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

68. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

69. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

70. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

71. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

72. spacer 5.12|3400735|34|CP025916|PILER-CR matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 10, identity: 0.706

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage