Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025856 Escherichia coli strain 504838 chromosome, complete genome 11 crisprs NA 0 25 0 0
CP025857 Escherichia coli strain 504838 plasmid p504838_108, complete sequence 0 crisprs NA 0 0 0 0
CP025858 Escherichia coli strain 504838 plasmid p504838_88, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP025856
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_1 309454-309577 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_2 1052826-1052917 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_3 1195631-1196319 Orphan I-F
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_4 1205383-1206190 Orphan I-F
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_5 1365828-1365972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_6 1772401-1772545 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_7 2089305-2089420 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_8 2113689-2113821 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_9 3612933-3613050 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_10 4030652-4030738 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025856_11 4056436-4056891 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025856_2 2.1|1052852|40|CP025856|CRISPRCasFinder 1052852-1052891 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP025856_8 8.1|2113706|42|CP025856|PILER-CR 2113706-2113747 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP025856_1 1.1|309497|38|CP025856|CRISPRCasFinder 309497-309534 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP025856_8 8.2|2113765|40|CP025856|PILER-CR 2113765-2113804 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 10940-10971 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 12055-12086 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 12646-12677 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 15835-15866 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 25956-25987 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 28428-28459 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 29051-29082 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 31524-31555 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 17746-17777 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 20745-20776 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 21368-21399 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 29522-29553 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 30636-30667 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 31259-31290 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 1904-1935 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 31530-31561 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 32719-32750 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 33342-33373 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 23319-23350 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 25854-25885 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 26477-26508 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 27600-27631 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 24958-24989 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 28154-28185 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 28809-28840 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 6077-6108 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 7191-7222 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 7814-7845 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 29726-29757 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 30840-30871 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 31463-31494 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 20352-20383 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 20975-21006 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 22090-22121 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 14641-14672 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 17177-17208 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 17832-17863 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 18955-18986 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 39432-39463 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 40547-40578 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 41170-41201 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 1032-1063 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 1655-1686 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 4654-4685 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 14667-14698 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 17749-17780 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_020122 Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence 22346-22377 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_020122 Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence 22937-22968 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 29097-29128 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 30212-30243 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 30835-30866 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 3904-3935 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 4527-4558 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 7526-7557 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 17746-17777 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 20745-20776 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 21368-21399 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 24565-24596 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 51598-51629 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 52253-52284 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 41998-42029 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 42653-42684 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 72864-72895 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 94105-94136 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 94760-94791 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 124972-125003 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 65343-65374 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 65966-65997 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 68972-69003 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 65343-65374 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 65966-65997 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 68972-69003 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 89410-89441 3 0.906
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 22483-22514 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 34258-34289 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 29924-29955 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 10813-10844 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 34462-34493 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 17354-17385 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 44169-44200 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 18379-18410 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 19492-19523 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_020122 Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence 23985-24016 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 34016-34047 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 2789-2820 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 22483-22514 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 53368-53399 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 43767-43798 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 95875-95906 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 63837-63868 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 63837-63868 4 0.875
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 48223-48254 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 58856-58887 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 5229-5260 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 7923-7954 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 5254-5285 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 7908-7939 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 36092-36123 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 38789-38820 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 24993-25024 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 27685-27716 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 5253-5284 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 5985-6016 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 37664-37695 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 40360-40391 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 45738-45769 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 48432-48463 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 53993-54024 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 56687-56718 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 5571-5602 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 8268-8299 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 23088-23119 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 25782-25813 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 5346-5377 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 8042-8073 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 5345-5376 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 8041-8072 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 132855-132886 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 135547-135578 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP050010 Citrobacter sp. Y3 plasmid unnamed1, complete sequence 4683-4714 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 24109-24140 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 26801-26832 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP024879 Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence 37661-37692 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 41875-41906 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 44567-44598 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 3214-3245 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 5907-5938 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 47853-47884 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 50545-50576 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 585-616 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 40472-40503 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 42811-42842 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 49173-49204 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 4670-4701 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 36619-36650 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 2807-2838 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 5503-5534 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 11020-11051 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 13714-13745 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 46942-46973 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 49634-49665 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 32762-32793 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 35457-35488 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 47702-47733 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 50396-50427 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 40680-40711 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 44723-44754 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 41270-41301 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 43962-43993 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 42972-43003 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 45669-45700 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 13093-13124 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 15786-15817 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 5275-5306 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 7790-7821 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 180527-180558 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 183224-183255 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 5346-5377 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 8042-8073 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 10851-10882 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 13543-13574 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 49084-49115 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP048224 Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence 114884-114915 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 6744-6775 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 59962-59993 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022182 Aeromonas salmonicida strain S68 plasmid pS68-1, complete sequence 27364-27395 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022182 Aeromonas salmonicida strain S68 plasmid pS68-1, complete sequence 31507-31538 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP021020 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pC, complete sequence 19969-20000 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_009350 Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence 129470-129501 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP038103 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence 154400-154431 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP038104 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa9-like, complete sequence 33711-33742 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP017144 Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed1, complete sequence 14520-14551 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP017144 Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed1, complete sequence 18690-18721 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022177 Aeromonas salmonicida strain S44 plasmid pS44-2, complete sequence 46154-46185 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022177 Aeromonas salmonicida strain S44 plasmid pS44-2, complete sequence 50288-50319 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022171 Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence 27718-27749 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP022171 Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence 31869-31900 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KY555070 Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa9, complete sequence 33702-33733 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KY555069 Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence 132109-132140 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 122983-123014 5 0.844
CP025856_3 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT 1196079-1196110 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 413945-413976 5 0.844
CP025856_3 3.18|1196081|32|CP025856|PILER-CR 1196081-1196112 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 413945-413976 5 0.844
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 33130-33161 6 0.812
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 50170-50201 6 0.812
CP025856_11 11.2|4056526|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056526-4056557 32 NZ_CP041426 Escherichia coli strain STEC388 plasmid pSTEC388_1, complete sequence 15256-15287 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_CP034578 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08E, complete sequence 2106-2137 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_AP017930 Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 plasmid pLs13-a, complete sequence 4021-4052 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_CP043525 Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96 plasmid pSD96_01, complete sequence 3312-3343 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_CP014889 Lactobacillus backii strain TMW 1.1991 plasmid pL11991-8, complete sequence 1082-1113 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NC_015860 Lactococcus lactis subsp. lactis plasmid pIL1, complete sequence 3081-3112 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 143632-143663 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_CP044372 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-4, complete sequence 5474-5505 6 0.812
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 148696-148727 6 0.812
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 155069-155100 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 162510-162541 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 166047-166078 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 150893-150924 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP048224 Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence 110752-110783 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NC_009350 Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence 133620-133651 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP038103 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence 158505-158536 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_KY555069 Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence 136214-136245 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP010894 Pseudomonas sp. MRSN12121 plasmid, complete sequence 4328-4359 7 0.781
CP025856_3 3.2|1195719|32|CP025856|CRISPRCasFinder,CRT 1195719-1195750 32 MH460460 Dickeya phage vB_DsoM_JA13, complete genome 233743-233774 7 0.781
CP025856_3 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT 1196079-1196110 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1623143-1623174 7 0.781
CP025856_3 3.12|1195721|32|CP025856|PILER-CR 1195721-1195752 32 MH460460 Dickeya phage vB_DsoM_JA13, complete genome 233743-233774 7 0.781
CP025856_3 3.18|1196081|32|CP025856|PILER-CR 1196081-1196112 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1623143-1623174 7 0.781
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229180-229234 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229281-229335 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239674-239728 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239775-239829 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230586-230640 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230687-230741 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211556-211610 7 0.873
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211657-211711 7 0.873
CP025856_11 11.7|4056831|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056831-4056862 32 NC_030948 Ralstonia phage RSP15 DNA, complete genome 100984-101015 7 0.781
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP015092 Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence 121474-121505 8 0.75
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LR699555 Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI 100383-100414 8 0.75
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LR699555 Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI 103869-103900 8 0.75
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 39674-39705 8 0.75
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 42787-42818 8 0.75
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_LR027556 Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence 166651-166682 8 0.75
CP025856_3 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT 1195659-1195690 32 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 358532-358563 8 0.75
CP025856_3 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT 1196079-1196110 32 EU307294 Burkholderia phage Bups phi1 clone 4 partial sequence 42-73 8 0.75
CP025856_3 3.18|1196081|32|CP025856|PILER-CR 1196081-1196112 32 EU307294 Burkholderia phage Bups phi1 clone 4 partial sequence 42-73 8 0.75
CP025856_4 4.2|1205471|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205471-1205502 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 209791-209822 8 0.75
CP025856_4 4.3|1205531|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205531-1205562 32 NZ_LR134457 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence 34172-34203 8 0.75
CP025856_4 4.7|1205771|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205771-1205802 32 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 228610-228641 8 0.75
CP025856_4 4.9|1205891|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205891-1205922 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1097936-1097967 8 0.75
CP025856_4 4.12|1206071|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1206071-1206102 32 NC_021067 Vibrio phage helene 12B3 genomic sequence 11083-11114 8 0.75
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229382-229436 8 0.855
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239876-239930 8 0.855
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230788-230842 8 0.855
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211758-211812 8 0.855
CP025856_11 11.1|4056465|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056465-4056496 32 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 9271-9302 8 0.75
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 MK064565 Sulfolobales Beppu rod-shaped virus 1 clone D, complete genome 8044-8075 8 0.75
CP025856_3 3.2|1195719|32|CP025856|CRISPRCasFinder,CRT 1195719-1195750 32 NC_005017 Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence 23086-23117 9 0.719
CP025856_3 3.2|1195719|32|CP025856|CRISPRCasFinder,CRT 1195719-1195750 32 NC_008791 Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence 23087-23118 9 0.719
CP025856_3 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT 1196079-1196110 32 CP006878 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602a, complete sequence 32499-32530 9 0.719
CP025856_3 3.10|1196200|32|CP025856|CRISPRCasFinder,CRT 1196200-1196231 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 363649-363680 9 0.719
CP025856_3 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT 1196260-1196291 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1033677-1033708 9 0.719
CP025856_3 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT 1196260-1196291 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 886475-886506 9 0.719
CP025856_3 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT 1196260-1196291 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1033677-1033708 9 0.719
CP025856_3 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT 1196260-1196291 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 112904-112935 9 0.719
CP025856_3 3.12|1195721|32|CP025856|PILER-CR 1195721-1195752 32 NC_005017 Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence 23086-23117 9 0.719
CP025856_3 3.12|1195721|32|CP025856|PILER-CR 1195721-1195752 32 NC_008791 Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence 23087-23118 9 0.719
CP025856_3 3.18|1196081|32|CP025856|PILER-CR 1196081-1196112 32 CP006878 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602a, complete sequence 32499-32530 9 0.719
CP025856_3 3.20|1196202|32|CP025856|PILER-CR 1196202-1196233 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 363649-363680 9 0.719
CP025856_3 3.21|1196262|32|CP025856|PILER-CR 1196262-1196293 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1033677-1033708 9 0.719
CP025856_3 3.21|1196262|32|CP025856|PILER-CR 1196262-1196293 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 886475-886506 9 0.719
CP025856_3 3.21|1196262|32|CP025856|PILER-CR 1196262-1196293 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1033677-1033708 9 0.719
CP025856_3 3.21|1196262|32|CP025856|PILER-CR 1196262-1196293 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 112904-112935 9 0.719
CP025856_4 4.3|1205531|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205531-1205562 32 NZ_CP016485 Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence 2910-2941 9 0.719
CP025856_4 4.4|1205591|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205591-1205622 32 NZ_CP045307 Legionella longbeachae strain B41211CHC plasmid pB41211CHC_76k, complete sequence 65108-65139 9 0.719
CP025856_4 4.12|1206071|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1206071-1206102 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 439300-439331 9 0.719
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87169-87223 9 0.836
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 158418-158472 9 0.836
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_CP013682 Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence 145876-145907 9 0.719
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 NZ_CP013295 Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence 156592-156623 9 0.719
CP025856_11 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT 4056587-4056618 32 MN694366 Marine virus AFVG_250M1050, complete genome 2162-2193 9 0.719
CP025856_4 4.2|1205471|32|CP025856|CRISPRCasFinder,CRT,PILER-CR 1205471-1205502 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 148490-148521 10 0.688
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229079-229133 10 0.818
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239573-239627 10 0.818
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230485-230539 10 0.818
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211455-211509 10 0.818
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194092-194146 11 0.8
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204586-204640 11 0.8
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195420-195474 11 0.8
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176375-176429 11 0.8
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27377-27431 11 0.8
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14103-14157 11 0.8
CP025856_10 10.1|4030678|35|CP025856|CRISPRCasFinder 4030678-4030712 35 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139208-139242 11 0.686
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194185-194239 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194278-194332 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204679-204733 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204772-204826 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195513-195567 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195606-195660 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176468-176522 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176561-176615 12 0.782
CP025856_6 6.1|1772446|55|CP025856|CRISPRCasFinder 1772446-1772500 55 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27278-27332 12 0.782

1. spacer 2.1|1052852|40|CP025856|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 8.1|2113706|42|CP025856|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 1.1|309497|38|CP025856|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 8.2|2113765|40|CP025856|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

5. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

6. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

7. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

8. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

9. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

10. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

11. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

12. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

13. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

14. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

15. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

16. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

17. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

18. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

19. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

20. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

21. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

22. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

23. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

24. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

25. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

26. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

27. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

28. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

29. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

30. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

31. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

32. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

33. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

34. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

35. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

36. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

37. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

38. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

39. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

40. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

41. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

42. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

43. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

44. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

45. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

46. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

47. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

48. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

49. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

50. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

51. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

52. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

53. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

54. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

55. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

56. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

57. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

58. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

59. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

60. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

61. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

62. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

63. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

64. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

65. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

66. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

67. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

68. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

69. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

70. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

71. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

72. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

73. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

74. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

75. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

76. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc	Protospacer
* * ***************************.

77. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 3, identity: 0.906

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaagggcagagacagcttgct	Protospacer
* ***************  *************

78. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

79. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc	Protospacer
* * ** ************************.

80. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

81. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc	Protospacer
* * ** ************************.

82. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc	Protospacer
* * ** ************************.

83. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc	Protospacer
* * ** ************************.

84. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc	Protospacer
* * ** ************************.

85. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccgaaggggcgagacagcttgtc	Protospacer
* * **************************..

86. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

87. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

88. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc	Protospacer
* * ** ************************.

89. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

90. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

91. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

92. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

93. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

94. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

95. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 4, identity: 0.875

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc	Protospacer
* * ********.******************.

96. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

97. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

98. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

99. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

100. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

101. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

102. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

103. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

104. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

105. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

106. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

107. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

108. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

109. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

110. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

111. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

112. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

113. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

114. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

115. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

116. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

117. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

118. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

119. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

120. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

121. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

122. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

123. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

124. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

125. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

126. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

127. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

128. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

129. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

130. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

131. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

132. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

133. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

134. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

135. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

136. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

137. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

138. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

139. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

140. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

141. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

142. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

143. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

144. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

145. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

146. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

147. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

148. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

149. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

150. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

151. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

152. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

153. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

154. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

155. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

156. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

157. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

158. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

159. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

160. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

161. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

162. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

163. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

164. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

165. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

166. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc	Protospacer
* *************************  * .

167. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP048224 (Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

168. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

169. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

170. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022182 (Aeromonas salmonicida strain S68 plasmid pS68-1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

171. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022182 (Aeromonas salmonicida strain S68 plasmid pS68-1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

172. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP021020 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pC, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct-	CRISPR spacer
gatggaagcccgaaggggcgagaca-cgcgcag	Protospacer
* *********************** * .**  

173. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_009350 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

174. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

175. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP038104 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa9-like, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

176. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP017144 (Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

177. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP017144 (Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

178. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022177 (Aeromonas salmonicida strain S44 plasmid pS44-2, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

179. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022177 (Aeromonas salmonicida strain S44 plasmid pS44-2, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

180. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022171 (Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

181. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP022171 (Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

182. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KY555070 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa9, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

183. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KY555069 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt	Protospacer
* *****.******************* * .*

184. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 5, identity: 0.844

gctggaagcccgaaggggcgagacagct-tgct	CRISPR spacer
gatggaagcccgaagggcagagacagccgtgc-	Protospacer
* ***************  ********. *** 

185. spacer 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 5, identity: 0.844

caggacgtcggcgcgactgagcagg-cccggtg	CRISPR spacer
ccgcacggcggcgcgactgagcaggaccccgt-	Protospacer
* * *** ***************** *** ** 

186. spacer 3.18|1196081|32|CP025856|PILER-CR matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 5, identity: 0.844

caggacgtcggcgcgactgagcagg-cccggtg	CRISPR spacer
ccgcacggcggcgcgactgagcaggaccccgt-	Protospacer
* * *** ***************** *** ** 

187. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 6, identity: 0.812

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gctggaagcccgtaggggcgagacgggcggcc	Protospacer
************ ***********.* . **.

188. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 6, identity: 0.812

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gctggaagcccgtaggggcgagacgggcggcc	Protospacer
************ ***********.* . **.

189. spacer 11.2|4056526|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041426 (Escherichia coli strain STEC388 plasmid pSTEC388_1, complete sequence) position: , mismatch: 6, identity: 0.812

aatatggataccgcgattcatgcgacgataaa	CRISPR spacer
aatatggataccgtgattcatgtgacaaccag	Protospacer
*************.********.***.*. *.

190. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034578 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08E, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

191. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017930 (Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 plasmid pLs13-a, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

192. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043525 (Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96 plasmid pSD96_01, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

193. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014889 (Lactobacillus backii strain TMW 1.1991 plasmid pL11991-8, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

194. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NC_015860 (Lactococcus lactis subsp. lactis plasmid pIL1, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

195. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

196. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044372 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-4, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

197. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

198. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagaccgcgcagc	Protospacer
* ********************** ** .. .

199. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagaccgcgcagc	Protospacer
* ********************** ** .. .

200. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccgaaggggcgagaccgcgcagc	Protospacer
* ********************** ** .. .

201. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaagcccggaggggcgagaccgcgcggc	Protospacer
* **********.*********** ** .* .

202. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP048224 (Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag	Protospacer
* *****.****************.** *   

203. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NC_009350 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag	Protospacer
* *****.****************.** *   

204. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag	Protospacer
* *****.****************.** *   

205. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_KY555069 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag	Protospacer
* *****.****************.** *   

206. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP010894 (Pseudomonas sp. MRSN12121 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gattgatgcccgaaggggcgagactgccggca	Protospacer
* * ** ***************** **. ** 

207. spacer 3.2|1195719|32|CP025856|CRISPRCasFinder,CRT matches to MH460460 (Dickeya phage vB_DsoM_JA13, complete genome) position: , mismatch: 7, identity: 0.781

gccgggcgt-atttgaaataacctgatcaatgt	CRISPR spacer
-cagattgtgatttgaaacaagctgatcaatgt	Protospacer
 * *. .** ********.** ***********

208. spacer 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781

caggacgtcggcgcgactgagcaggcccggtg	CRISPR spacer
gatcacgtcggcgcgaccgagcaggaccgggt	Protospacer
 *  *************.******* ****  

209. spacer 3.12|1195721|32|CP025856|PILER-CR matches to MH460460 (Dickeya phage vB_DsoM_JA13, complete genome) position: , mismatch: 7, identity: 0.781

gccgggcgt-atttgaaataacctgatcaatgt	CRISPR spacer
-cagattgtgatttgaaacaagctgatcaatgt	Protospacer
 * *. .** ********.** ***********

210. spacer 3.18|1196081|32|CP025856|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781

caggacgtcggcgcgactgagcaggcccggtg	CRISPR spacer
gatcacgtcggcgcgaccgagcaggaccgggt	Protospacer
 *  *************.******* ****  

211. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

212. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

213. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

214. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

215. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

216. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

217. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

218. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

219. spacer 11.7|4056831|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NC_030948 (Ralstonia phage RSP15 DNA, complete genome) position: , mismatch: 7, identity: 0.781

acaaaacgcgatcaatacagttttgttttgca	CRISPR spacer
ccgaaagaagatcaatacagttttgttcttca	Protospacer
 *.*** . ******************.* **

220. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP015092 (Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gctggaagcccgcacgggcgagacccgttttg	Protospacer
************ * *********   ** . 

221. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LR699555 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct---	CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgccagg	Protospacer
****.************ *****   *..**.   

222. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LR699555 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct---	CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgccagg	Protospacer
****.************ *****   *..**.   

223. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct---	CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgcaagg	Protospacer
****.************ *****   *..**    

224. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct---	CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgcaagg	Protospacer
****.************ *****   *..**    

225. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_LR027556 (Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gctggaagcccgcacgggcgagacccgttttg	Protospacer
************ * *********   ** . 

226. spacer 3.1|1195659|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.75

gctggaagcccgaaggggcgagacagcttgct	CRISPR spacer
gatcgtcacccgaatgggcgagaccgcttgcg	Protospacer
* * *  .****** ********* ****** 

227. spacer 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT matches to EU307294 (Burkholderia phage Bups phi1 clone 4 partial sequence) position: , mismatch: 8, identity: 0.75

caggacgtcggcgcgactgagcaggcccggtg	CRISPR spacer
caggacgtcggcgcgatcgagcacgagcagct	Protospacer
****************..***** *  *.*. 

228. spacer 3.18|1196081|32|CP025856|PILER-CR matches to EU307294 (Burkholderia phage Bups phi1 clone 4 partial sequence) position: , mismatch: 8, identity: 0.75

caggacgtcggcgcgactgagcaggcccggtg	CRISPR spacer
caggacgtcggcgcgatcgagcacgagcagct	Protospacer
****************..***** *  *.*. 

229. spacer 4.2|1205471|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.75

agttcattcagcacgagcacccactcggtgaa	CRISPR spacer
ggcactctcagcaccagcacctactcggtgag	Protospacer
.*. * .******* ******.*********.

230. spacer 4.3|1205531|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 8, identity: 0.75

cgaaaactcccgaatcgcccggatcgcgttca	CRISPR spacer
cgtgaacctccgaatcgcccggatcgccgccg	Protospacer
** .***..******************  .*.

231. spacer 4.7|1205771|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.75

ttttaactgccgtaagggtgtgccctacgatt	CRISPR spacer
tccaaactaccgtaatggtgtgccctatcatg	Protospacer
*.. ****.****** ***********. ** 

232. spacer 4.9|1205891|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75

--ttgaatcccttgcgcgtgacgataccgatgac	CRISPR spacer
ggtgcgat--cttgctcgtgacgacaccgatgag	Protospacer
  *  .**  ***** ********.******** 

233. spacer 4.12|1206071|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NC_021067 (Vibrio phage helene 12B3 genomic sequence) position: , mismatch: 8, identity: 0.75

tttctccattagcgcgaccggtttttctgccg	CRISPR spacer
gtactccattagagcgactggtttttgggttg	Protospacer
 * ********* *****.*******  *..*

234. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

235. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

236. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

237. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

238. spacer 11.1|4056465|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 8, identity: 0.75

gcgttgtgtatatcaacaaggcaatgatggac	CRISPR spacer
gcgttgtctataccaacaaggcagtatgcgat	Protospacer
******* ****.**********.*.   **.

239. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to MK064565 (Sulfolobales Beppu rod-shaped virus 1 clone D, complete genome) position: , mismatch: 8, identity: 0.75

caaaaaaatagattggaaaacatttagattca---	CRISPR spacer
acaaaaaagagactggaaaacattt---tttaatt	Protospacer
  ****** ***.************   **.*   

240. spacer 3.2|1195719|32|CP025856|CRISPRCasFinder,CRT matches to NC_005017 (Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719

-gccgggcgtatttgaaataacctgatcaatgt	CRISPR spacer
caacaag-atattggaaataaccagatcaatga	Protospacer
 . *..* .**** ********* ******** 

241. spacer 3.2|1195719|32|CP025856|CRISPRCasFinder,CRT matches to NC_008791 (Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719

-gccgggcgtatttgaaataacctgatcaatgt	CRISPR spacer
caacaag-atattggaaataaccagatcaatga	Protospacer
 . *..* .**** ********* ******** 

242. spacer 3.8|1196079|32|CP025856|CRISPRCasFinder,CRT matches to CP006878 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602a, complete sequence) position: , mismatch: 9, identity: 0.719

caggacgtcggcgcgactgagcaggcccggtg	CRISPR spacer
ccaagcgtccgcgcgactgagcagggccgcac	Protospacer
* ...**** *************** ***   

243. spacer 3.10|1196200|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 9, identity: 0.719

attggcagtcgttggggttttgaaatattaga	CRISPR spacer
cctgtacgtcgatgcggttttgaaatattatc	Protospacer
 .**   **** ** ***************  

244. spacer 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

245. spacer 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

246. spacer 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

247. spacer 3.11|1196260|32|CP025856|CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

248. spacer 3.12|1195721|32|CP025856|PILER-CR matches to NC_005017 (Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719

-gccgggcgtatttgaaataacctgatcaatgt	CRISPR spacer
caacaag-atattggaaataaccagatcaatga	Protospacer
 . *..* .**** ********* ******** 

249. spacer 3.12|1195721|32|CP025856|PILER-CR matches to NC_008791 (Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719

-gccgggcgtatttgaaataacctgatcaatgt	CRISPR spacer
caacaag-atattggaaataaccagatcaatga	Protospacer
 . *..* .**** ********* ******** 

250. spacer 3.18|1196081|32|CP025856|PILER-CR matches to CP006878 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602a, complete sequence) position: , mismatch: 9, identity: 0.719

caggacgtcggcgcgactgagcaggcccggtg	CRISPR spacer
ccaagcgtccgcgcgactgagcagggccgcac	Protospacer
* ...**** *************** ***   

251. spacer 3.20|1196202|32|CP025856|PILER-CR matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 9, identity: 0.719

attggcagtcgttggggttttgaaatattaga	CRISPR spacer
cctgtacgtcgatgcggttttgaaatattatc	Protospacer
 .**   **** ** ***************  

252. spacer 3.21|1196262|32|CP025856|PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

253. spacer 3.21|1196262|32|CP025856|PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

254. spacer 3.21|1196262|32|CP025856|PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

255. spacer 3.21|1196262|32|CP025856|PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgatctgttgcgtgaaatagtcaggcaatac	CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca	Protospacer
. *. ************** * ******.*  

256. spacer 4.3|1205531|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016485 (Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaaactc-----ccgaatcgcccggatcgcgttca	CRISPR spacer
-----atccattggccggatcgcccggatcgcgatca	Protospacer
     *..*     ***.*************** ***

257. spacer 4.4|1205591|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045307 (Legionella longbeachae strain B41211CHC plasmid pB41211CHC_76k, complete sequence) position: , mismatch: 9, identity: 0.719

tagaaattaatagctgtagtgattgcatgcca	CRISPR spacer
tagaaattaatagttgtattgatgtcttttac	Protospacer
*************.**** ****  * * .  

258. spacer 4.12|1206071|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.719

tttctccattagcgcgaccggtttttctgccg	CRISPR spacer
aatctccattcgcgcgcccggtttttggcgca	Protospacer
  ******** ***** *********    *.

259. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.836

ggcgca-cgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca--	CRISPR spacer
-gtgcaccgaatgccggatgcggcgtgaacgccttatccgtcctacaat--gcctgat	Protospacer
 *.*** *** ***************************** ****** *  ***..  

260. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.836

ggcgcacgactgccggatgcggcgtgaacgccttatccggc--ctacacttcgccca	CRISPR spacer
ggcgcacaattgccggatgcggcgtgaacgccttatccgcctaccgaactgcgcc--	Protospacer
*******.*.***************************** *  *.. *** ****  

261. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013682 (Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence) position: , mismatch: 9, identity: 0.719

caaaaaaatagattggaaaacatttagattca	CRISPR spacer
agataaaatagattataaaacatttagaagac	Protospacer
 .* **********. ************    

262. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013295 (Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence) position: , mismatch: 9, identity: 0.719

caaaaaaatagattggaaaacatttagattca	CRISPR spacer
agataaaatagattataaaacatttagaagac	Protospacer
 .* **********. ************    

263. spacer 11.3|4056587|32|CP025856|PILER-CR,CRISPRCasFinder,CRT matches to MN694366 (Marine virus AFVG_250M1050, complete genome) position: , mismatch: 9, identity: 0.719

caaaaaaatagattggaaaacatttagattca	CRISPR spacer
caaaaaaatagatttgaacacataaaaggcaa	Protospacer
************** *** ****  *.. . *

264. spacer 4.2|1205471|32|CP025856|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 10, identity: 0.688

agttcattcagcacgagcacccactcggtgaa	CRISPR spacer
gcccccgacagcccgagcacccactccgtgag	Protospacer
. ..*   **** ************* ****.

265. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

266. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

267. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

268. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

269. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

270. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

271. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

272. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

273. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ggcgcacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagtgc	Protospacer
*******.**.**********************************.  * . .  

274. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.8

-ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
aggcgt-tgattgccggatgcggcgtaaacgccttatccggcctacattcggcaag	Protospacer
 ****. .**.***************.********************.*. **  .

275. spacer 10.1|4030678|35|CP025856|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 11, identity: 0.686

ggacgccgccgccgcgaagccgtttccgatgttga	CRISPR spacer
ggaagccgccgccgcgaacccgtttttcccgggcc	Protospacer
*** ************** ******..  .*    

276. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

277. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

278. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

279. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

280. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

281. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

282. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

283. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

284. spacer 6.1|1772446|55|CP025856|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ggtacacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagcac	Protospacer
**..***.**.**********************************.  * . *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage