Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033057 Morganella morganii strain L241 plasmid pNDM5-L241, complete sequence 0 crisprs NA 0 0 4 0
CP033056 Morganella morganii strain L241 chromosome, complete genome 1 crisprs WYL,csa3,cas8f,cas5f,cas7f,cas6f,DEDDh,cas3,DinG 1 1 8 0

Results visualization

1. CP033057
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3255 2 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_2 6517 : 10970 6 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_3 15570 : 16086 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_4 34717 : 38888 3 Moraxella_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033056
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033056_1 2536737-2536812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033056_1 1.1|2536762|26|CP033056|CRISPRCasFinder 2536762-2536787 26 CP033056.1 407444-407469 1 0.962

1. spacer 1.1|2536762|26|CP033056|CRISPRCasFinder matches to position: 407444-407469, mismatch: 1, identity: 0.962

atctcctcccaaaatcagcgccaggt	CRISPR spacer
atctcttcccaaaatcagcgccaggt	Protospacer
*****.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033056_1 1.1|2536762|26|CP033056|CRISPRCasFinder 2536762-2536787 26 NZ_CP054717 Salmonella enterica strain 85-0120 plasmid unnamed1, complete sequence 25466-25491 3 0.885
CP033056_1 1.1|2536762|26|CP033056|CRISPRCasFinder 2536762-2536787 26 NZ_CP024167 Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_02, complete sequence 57375-57400 3 0.885

1. spacer 1.1|2536762|26|CP033056|CRISPRCasFinder matches to NZ_CP054717 (Salmonella enterica strain 85-0120 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.885

atctcctcccaaaatcagcgccaggt	CRISPR spacer
atctcctcccaatatcagctccaggc	Protospacer
************ ****** *****.

2. spacer 1.1|2536762|26|CP033056|CRISPRCasFinder matches to NZ_CP024167 (Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_02, complete sequence) position: , mismatch: 3, identity: 0.885

atctcctcccaaaatcagcgccaggt	CRISPR spacer
atctcctcccaatatcagctccaggc	Protospacer
************ ****** *****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 97759 : 106606 8 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_2 1253165 : 1296432 55 Morganella_phage(41.3%) terminase,protease,portal,holin,tail NA
DBSCAN-SWA_3 1394579 : 1433791 62 Morganella_phage(20.45%) lysis,portal,coat,holin,tail NA
DBSCAN-SWA_4 1650779 : 1723898 82 Morganella_phage(58.82%) terminase,protease,portal,head,holin,tail,tRNA,capsid NA
DBSCAN-SWA_5 2175911 : 2236129 73 Morganella_phage(74.58%) integrase,terminase,protease,head,holin,tail,capsid attL 2191795:2191851|attR 2236161:2236217
DBSCAN-SWA_6 2663241 : 2673084 8 Bacillus_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_7 2857425 : 2865480 8 Mycobacterium_phage(33.33%) tRNA NA
DBSCAN-SWA_8 3799882 : 3820134 27 Morganella_phage(94.74%) integrase attL 3799689:3799706|attR 3817882:3817899
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage