Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034214 Escherichia albertii strain NCTC 9362 plasmid pNCTC_9362 0 crisprs NA 0 0 0 0
CP034213 Escherichia albertii strain NCTC 9362 chromosome, complete genome 5 crisprs NA 0 2 0 0

Results visualization

1. CP034213
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034213_1 616148-616271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034213_2 2039590-2039719 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034213_3 2699497-2699638 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034213_4 3490407-3490532 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034213_5 4470827-4470965 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034213_1 1.1|616191|38|CP034213|CRISPRCasFinder 616191-616228 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921
CP034213_2 2.1|2039625|60|CP034213|CRISPRCasFinder 2039625-2039684 60 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397081-397140 12 0.8

1. spacer 1.1|616191|38|CP034213|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaatatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******. ****************************

2. spacer 2.1|2039625|60|CP034213|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.8

gccaccgcacaattgccggatgtggcgtaaacgccttatccggtctac--cgttaaggca	CRISPR spacer
accggtgcacaattgccggatgcggcgtaaacgccttatccggcctacatggataaatca	Protospacer
.**. .****************.********************.****   * ***. **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage