1. spacer 1.13|1024961|30|CP034170|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.833
-cacgagggccaccgggaaggtccgcaaccg CRISPR spacer
gcac-acggccaccggcaaggtccgcaaggg Protospacer
*** * ********* *********** *
2. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443392 (Rhodococcus hoagii strain PAM1340 plasmid pVAPA1340, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
3. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443389 (Rhodococcus hoagii strain PAM1357 plasmid pVAPA1357, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
4. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443403 (Rhodococcus hoagii strain PAM2288 plasmid pVAPA2288, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
5. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443388 (Rhodococcus hoagii strain PAM1216 plasmid pVAPA1216, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
6. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443393 (Rhodococcus hoagii strain PAM1637 plasmid pVAPA1637, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
7. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443402 (Rhodococcus hoagii strain PAM2285 plasmid pVAPA2285, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
8. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443390 (Rhodococcus hoagii strain PAM1422 plasmid pVAPA1422, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
9. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443395 (Rhodococcus hoagii strain PAM2282 plasmid pVAPA2282, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
10. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443404 (Rhodococcus hoagii strain PAM2287 plasmid pVAPA2287, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
11. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443405 (Rhodococcus hoagii strain PAM2279 plasmid pVAPA2279, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
12. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443391 (Rhodococcus hoagii strain PAM1600 plasmid pVAPA1600, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
13. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443394 (Rhodococcus hoagii strain PAM1643 plasmid pVAPA1643, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
14. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443396 (Rhodococcus hoagii strain PAM1271 plasmid pVAPA1271, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
15. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443406 (Rhodococcus hoagii strain PAM1413 plasmid pVAPB1413, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
16. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443397 (Rhodococcus hoagii strain PAM1475 plasmid pVAPB1475, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
17. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KX443407 (Rhodococcus hoagii strain PAM1533 plasmid PVAPB1533, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
18. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP027795 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas2, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
19. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
agggcgacctcggcggacttgacggagaaggc Protospacer
******** ************.*** * * *
20. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP041646 (Rhodococcus hoagii strain WY plasmid pWY, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
21. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_014247 (Rhodococcus equi plasmid pVAPAMBE116, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
22. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
agggcgacctcggcggacttgacggagaaggc Protospacer
******** ************.*** * * *
23. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_002576 (Rhodococcus equi 103 plasmid p103, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
24. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
agggcgacctcggcggacttgacggagaaggc Protospacer
******** ************.*** * * *
25. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_011150 (Rhodococcus equi plasmid pVAPB1593, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
26. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_011151 (Rhodococcus equi plasmid pVAPA1037, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
27. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
agggcgacctcggcggacttgacggagaaggc Protospacer
******** ************.*** * * *
28. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
agggcgacctcggcggacttgacggagaaggc Protospacer
******** ************.*** * * *
29. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_004854 (Rhodococcus equi ATCC33701 plasmid pREAT701, complete sequence) position: , mismatch: 6, identity: 0.812
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgcgggtcgccggcggacttcgcggcgtcgtc Protospacer
* * * **.********** ***********
30. spacer 1.8|1024657|31|CP034170|CRISPRCasFinder matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.806
gagctggcagggccagccgct---caggccgaaa CRISPR spacer
gatctggcagggccagccgctcgacgggcct--- Protospacer
** ****************** *.****
31. spacer 1.15|1025095|32|CP034170|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 6, identity: 0.812
gcccgcaaccgttccagctccaaagcactgtc CRISPR spacer
gcgttcaaccgttccggctccaaatcactgtg Protospacer
** . **********.******** ******
32. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.812
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
ggcgtccttcgcatcggtcttgccgtcgcccc Protospacer
**. ******** ******** ******* *
33. spacer 1.35|1026318|32|CP034170|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.812
aggccaacctgttccacggcgaccacacaacc- CRISPR spacer
cggccaacctgttccccggctacc-tataaccg Protospacer
************** **** *** .*.****
34. spacer 1.35|1026318|32|CP034170|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.812
aggccaacctgttccacggcgaccacacaacc- CRISPR spacer
cggccaacctgttccccggctacc-tataaccg Protospacer
************** **** *** .*.****
35. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP045301 (Azotobacter salinestris strain KACC 13899 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
-aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
tggcaag-tcggtcagcccgtcgatctgggcta Protospacer
..**** **** ***** ************ *
36. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
cggcg-cggggactgtccgggccgaccgaccat Protospacer
**** ********* *******.*****.*.
37. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP013267 (Sphingobium baderi strain DE-13 plasmid pDE3, complete sequence) position: , mismatch: 6, identity: 0.812
--tatcggccaacaggtccggctggaccgaccga CRISPR spacer
ggtgttg--caacaggtccggcgggaccgaccgg Protospacer
*.*.* ************* **********.
38. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_014007 (Sphingobium japonicum UT26S plasmid pCHQ1, complete sequence) position: , mismatch: 6, identity: 0.812
--tatcggccaacaggtccggctggaccgaccga CRISPR spacer
ggtgttg--caacaggtccggcgggaccgaccgg Protospacer
*.*.* ************* **********.
39. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.812
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
acgcggtgcgccgcctcgaggcggccggcgcg Protospacer
** .* ******** ************ ***
40. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.812
acttg---ctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
---tggaccggcggcgcgtcgaggcggccttcgcc Protospacer
** * *** *************** *****
41. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 6, identity: 0.812
-acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
tgctcg-tgcgccgcgacgaggcggcggtcggc Protospacer
.**.* ********* ********* **** *
42. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_AP017976 (Microbacterium sp. TPU 3598 plasmid MST3P, complete sequence) position: , mismatch: 6, identity: 0.812
acttgctgcgccgcgtcgaggcggc-cgtcgcc CRISPR spacer
gtttgctgcgccgggtcgaggctgcgtgtcgc- Protospacer
..*********** ******** ** .*****
43. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443392 (Rhodococcus hoagii strain PAM1340 plasmid pVAPA1340, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
44. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443389 (Rhodococcus hoagii strain PAM1357 plasmid pVAPA1357, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
45. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443403 (Rhodococcus hoagii strain PAM2288 plasmid pVAPA2288, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
46. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443388 (Rhodococcus hoagii strain PAM1216 plasmid pVAPA1216, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
47. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443393 (Rhodococcus hoagii strain PAM1637 plasmid pVAPA1637, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
48. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443402 (Rhodococcus hoagii strain PAM2285 plasmid pVAPA2285, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
49. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443390 (Rhodococcus hoagii strain PAM1422 plasmid pVAPA1422, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
50. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443395 (Rhodococcus hoagii strain PAM2282 plasmid pVAPA2282, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
51. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443404 (Rhodococcus hoagii strain PAM2287 plasmid pVAPA2287, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
52. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443405 (Rhodococcus hoagii strain PAM2279 plasmid pVAPA2279, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
53. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443391 (Rhodococcus hoagii strain PAM1600 plasmid pVAPA1600, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
54. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443394 (Rhodococcus hoagii strain PAM1643 plasmid pVAPA1643, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
55. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443396 (Rhodococcus hoagii strain PAM1271 plasmid pVAPA1271, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
56. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443406 (Rhodococcus hoagii strain PAM1413 plasmid pVAPB1413, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
57. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443397 (Rhodococcus hoagii strain PAM1475 plasmid pVAPB1475, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
58. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KX443407 (Rhodococcus hoagii strain PAM1533 plasmid PVAPB1533, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
59. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP027795 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas2, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
60. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP041646 (Rhodococcus hoagii strain WY plasmid pWY, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
61. spacer 1.76|1024475|33|CP034170|CRT matches to NC_014247 (Rhodococcus equi plasmid pVAPAMBE116, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
62. spacer 1.76|1024475|33|CP034170|CRT matches to NC_002576 (Rhodococcus equi 103 plasmid p103, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
63. spacer 1.76|1024475|33|CP034170|CRT matches to NC_011150 (Rhodococcus equi plasmid pVAPB1593, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
64. spacer 1.76|1024475|33|CP034170|CRT matches to NC_011151 (Rhodococcus equi plasmid pVAPA1037, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
65. spacer 1.76|1024475|33|CP034170|CRT matches to NC_004854 (Rhodococcus equi ATCC33701 plasmid pREAT701, complete sequence) position: , mismatch: 6, identity: 0.818
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgggtcgccggcggacttcgcggcgtcgtcga Protospacer
* * * **.********** ************.
66. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 6, identity: 0.818
ttgggcgccgccggggtggccccggtg-tgggta CRISPR spacer
gtcggcgccgcccgggtggccgcggtgctcggt- Protospacer
* ********* ******** ***** * ***
67. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.818
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
acgcggtgcgccgcctcgaggcggccggcgcgg Protospacer
** .* ******** ************ *** *
68. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to MN703409 (Arthrobacter phage LittleTokyo, complete genome) position: , mismatch: 7, identity: 0.781
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
aactcgacgccggcggacctggcggcgtcggt Protospacer
*. *****.********.*********** .
69. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.781
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
agggcgacctcggcggacttgacggaaaaggc Protospacer
******** ************.*** . * *
70. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcgtcggcgtcggcggacttggcggcgacata Protospacer
. * **.******************** *.*
71. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 7, identity: 0.781
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcggcgacggcggcggccttggcggcgatctc Protospacer
. ******* ****** ********** . **
72. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 7, identity: 0.781
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
aagacgacatcggcggacttggccgcgagttc Protospacer
*.*.****.************** *** **
73. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
74. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
75. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
76. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
77. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
78. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
79. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
atcggcgccgccggggtggccctgctggtggc Protospacer
* *******************.* ** **.
80. spacer 1.13|1024961|30|CP034170|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cacgagggccaccgggaaggtccgcaaccg CRISPR spacer
gatgacggccaccggcaaggtccgcaaggt Protospacer
*.** ********* ***********
81. spacer 1.18|1025278|32|CP034170|CRISPRCasFinder matches to NC_048193 (Escherichia phage vB_EcoP_PTXU04, complete genome) position: , mismatch: 7, identity: 0.781
tcctggtattgagttgagaaagagcggcgagc CRISPR spacer
tctgcgtgatgagttgagaaacagcggtgagc Protospacer
**. **. ************ *****.****
82. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 7, identity: 0.781
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
gctcggactcgcttcggtcattccgtcgcggc Protospacer
* *. .*********** ************
83. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
gctcggactcgcttcggtcattccgtcgcggc Protospacer
* *. .*********** ************
84. spacer 1.25|1025707|32|CP034170|CRISPRCasFinder matches to MF766045 (Streptomyces phage Daudau, complete genome) position: , mismatch: 7, identity: 0.781
ggcggaccgggccaggactcggcgaagatgct CRISPR spacer
gcgaggccgggctacgactcggcgaagatgcg Protospacer
* .*.******.* ****************
85. spacer 1.35|1026318|32|CP034170|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
aggccaacctgttccacggcgaccacacaacc CRISPR spacer
aggcctacctgttcctcggcgaccgcgacgcc Protospacer
***** ********* ********.*. .**
86. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gaacagcgcgcgcagccggtcgatgtgggcga Protospacer
.* **. ** ************* *******
87. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NC_047879 (Bordetella phage MW2, complete genome) position: , mismatch: 7, identity: 0.781
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
ggcgacggggactgactgggccaagtgacctg Protospacer
**** ***********.******* .**.* .
88. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
gaggtggctgaccgaccgggccagccgatcga Protospacer
*. ** * ***.**********.********
89. spacer 1.43|1026806|32|CP034170|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcaacctcggagacggcctcttcgatgtggt CRISPR spacer
ggcaccctcggagacgccctcttcgccgtcct Protospacer
*** *********** ******** .** *
90. spacer 1.43|1026806|32|CP034170|CRISPRCasFinder matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
cgcaacctcggagacggcctcttcgatgtggt CRISPR spacer
ggcaccctcggagacgccctcttcgccgtcct Protospacer
*** *********** ******** .** *
91. spacer 1.46|1026989|32|CP034170|CRISPRCasFinder matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 7, identity: 0.781
cccaacgacgtattcgacgccaacggcaacca CRISPR spacer
gtcgtcgacgtcatcgacgccaacggcaaccc Protospacer
.*. ****** ******************
92. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP013712 (Klebsiella pneumoniae strain J1 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
acgacgttctcgtcgccgtgcagcagcttgtc Protospacer
* *.* ********.*****.*********
93. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 7, identity: 0.781
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
acgacgttctcgtcgccgtgcagcagcttgtc Protospacer
* *.* ********.*****.*********
94. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 7, identity: 0.781
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
acgacgttctcgtcgccgtgcagcagcttgtc Protospacer
* *.* ********.*****.*********
95. spacer 1.61|1027906|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctatccgtggtgatgggcgt----cgtgctttt CRISPR spacer
tcgctatccctggtgatcggcgtgctcggtgc---- Protospacer
********* ******* ***** ****
96. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.781
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cggtggcgcgcggggtcgaggcggccgtcgcc Protospacer
** .**** * ******************
97. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ccacggtgcgccgcgtcgaggcggtcggcgcg Protospacer
* .* ******************.** ***
98. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.781
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
atctgctgcgccgcatcgacgcggccgatccc Protospacer
*..***********.**** ******* . **
99. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.781
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
atctgctgcgccgcatcgacgcggccgatccc Protospacer
*..***********.**** ******* . **
100. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
acgcgctgcgccgcgccgtggcggccgaggcg Protospacer
** .***********.** ******** **
101. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
acttgctgcgccgcgtcgaggcggc-cgtcgcc CRISPR spacer
tgttgctgcgcggcgacgaggcggcgcgccgt- Protospacer
********* *** ********* **.**.
102. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gcgctgtttcggcggccttggcggcgtcgtggg Protospacer
* ** .. ******* ************** **
103. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cggacatggcggcggccttgggggcgtcgtcgg Protospacer
** *.* ****** ***** ***********
104. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gggcgacctcggcggacttgacggagaaggcgc Protospacer
******* ************.*** * * **
105. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gggcgacctcggcggacttgacggagaaggcgc Protospacer
******* ************.*** * * **
106. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gggcgacctcggcggacttgacggagaaggcgc Protospacer
******* ************.*** * * **
107. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gggcgacctcggcggacttgacggagaaggcgc Protospacer
******* ************.*** * * **
108. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.788
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gggcgacctcggcggacttgacggagaaggcgc Protospacer
******* ************.*** * * **
109. spacer 1.84|1024961|31|CP034170|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
cacgagggccaccgggaaggtccgcaaccgg CRISPR spacer
gatgacggccaccggcaaggtccgcaaggtg Protospacer
*.** ********* *********** *
110. spacer 1.86|1025095|33|CP034170|CRT matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccgcaaccgttccagctccaaagcactgtcg CRISPR spacer
gcgttcaaccgttccggctccaaatcactgtga Protospacer
** . **********.******** ****** .
111. spacer 1.89|1025278|33|CP034170|CRT matches to NC_048193 (Escherichia phage vB_EcoP_PTXU04, complete genome) position: , mismatch: 7, identity: 0.788
tcctggtattgagttgagaaagagcggcgagcg CRISPR spacer
tctgcgtgatgagttgagaaacagcggtgagcg Protospacer
**. **. ************ *****.*****
112. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.788
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
ggcgtccttcgcatcggtcttgccgtcgccccg Protospacer
**. ******** ******** ******* *.
113. spacer 1.106|1026318|33|CP034170|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788
aggccaacctgttccacggcgaccacacaaccg CRISPR spacer
aggcctacctgttcctcggcgaccgcgacgccg Protospacer
***** ********* ********.*. .***
114. spacer 1.112|1026684|33|CP034170|CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
gaggtggctgaccgaccgggccagccgatcgag Protospacer
*. ** * ***.**********.*********
115. spacer 1.116|1026928|33|CP034170|CRT matches to NZ_CP013267 (Sphingobium baderi strain DE-13 plasmid pDE3, complete sequence) position: , mismatch: 7, identity: 0.788
--tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
ggtgttg--caacaggtccggcgggaccgaccggc Protospacer
*.*.* ************* **********.
116. spacer 1.116|1026928|33|CP034170|CRT matches to NC_014007 (Sphingobium japonicum UT26S plasmid pCHQ1, complete sequence) position: , mismatch: 7, identity: 0.788
--tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
ggtgttg--caacaggtccggcgggaccgaccggc Protospacer
*.*.* ************* **********.
117. spacer 1.120|1027172|33|CP034170|CRT matches to NZ_CP013712 (Klebsiella pneumoniae strain J1 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
aaggccatctcgtcgtcgtgcggcagcttgtag CRISPR spacer
acgacgttctcgtcgccgtgcagcagcttgtcg Protospacer
* *.* ********.*****.********* *
118. spacer 1.120|1027172|33|CP034170|CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 7, identity: 0.788
aaggccatctcgtcgtcgtgcggcagcttgtag CRISPR spacer
acgacgttctcgtcgccgtgcagcagcttgtcg Protospacer
* *.* ********.*****.********* *
119. spacer 1.120|1027172|33|CP034170|CRT matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 7, identity: 0.788
aaggccatctcgtcgtcgtgcggcagcttgtag CRISPR spacer
acgacgttctcgtcgccgtgcagcagcttgtcg Protospacer
* *.* ********.*****.********* *
120. spacer 1.133|1027967|33|CP034170|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.788
acttg---ctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
---tggaccggcggcgcgtcgaggcggccttcgcca Protospacer
** * *** *************** *****.
121. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 7, identity: 0.788
-acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
tgctcg-tgcgccgcgacgaggcggcggtcggca Protospacer
.**.* ********* ********* **** *.
122. spacer 1.1|1024230|32|CP034170|CRISPRCasFinder matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 8, identity: 0.75
acgtcgatcaccgcggcagcggacgagcaaga CRISPR spacer
aagccgatcactgcggcagcggtcgagccgcc Protospacer
* *.*******.********** ***** .
123. spacer 1.3|1024352|32|CP034170|CRISPRCasFinder matches to NC_048173 (Erwinia phage Derbicus, complete genome) position: , mismatch: 8, identity: 0.75
ttaccggagtcggcaccgtcgggactaccggc- CRISPR spacer
ttaccgcagtcggcaccgacggg-tcatagact Protospacer
****** *********** **** ..*. *.*
124. spacer 1.3|1024352|32|CP034170|CRISPRCasFinder matches to NC_031007 (Erwinia phage vB_EamM_EarlPhillipIV, complete genome) position: , mismatch: 8, identity: 0.75
ttaccggagtcggcaccgtcgggactaccggc- CRISPR spacer
ttaccgcagtcggcaccgacggg-tcatagact Protospacer
****** *********** **** ..*. *.*
125. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcgtcggcgtcggcggacttggcggcgaccag Protospacer
. * **.******************** *
126. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
acgacgacgtcggcggcctgggcggcgctgag Protospacer
* *.************ ** *******..*
127. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_013596 (Streptosporangium roseum DSM 43021 plasmid pSROS01, complete sequence) position: , mismatch: 8, identity: 0.75
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
atccggacgtcggccgacttgacggcgtaggc Protospacer
* ********* ******.****** * *
128. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 8, identity: 0.75
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
cggtgctcctcggcgggctgggcggcgtcgtc Protospacer
** * *******.** ************
129. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
ttgtcggcgtcggcggccttggcggcgccctt Protospacer
* **.********* **********.* *.
130. spacer 1.7|1024596|32|CP034170|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75
gagctggcagggccagccgctcaggccgaaac CRISPR spacer
cagatggccgggccagccgctcagccggtcgc Protospacer
** **** *************** * * .*
131. spacer 1.7|1024596|32|CP034170|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
gagctggcagggccagccgctcaggccgaaac CRISPR spacer
cagatggccgggccagccgctcagccggtcgc Protospacer
** **** *************** * * .*
132. spacer 1.7|1024596|32|CP034170|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
gagctggcagggccagccgctcaggccgaaac CRISPR spacer
cagatggccgggccagccgctcagccggtcgc Protospacer
** **** *************** * * .*
133. spacer 1.7|1024596|32|CP034170|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
gagctggcagggccagccgctcaggccgaaac CRISPR spacer
cagatggccgggccagccgctcagccggtcgc Protospacer
** **** *************** * * .*
134. spacer 1.8|1024657|31|CP034170|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 8, identity: 0.742
gagctggcagggccagccgctcaggccgaaa CRISPR spacer
gctctggcagggcgagccgcgcaggcagttc Protospacer
* ********** ****** ***** *
135. spacer 1.8|1024657|31|CP034170|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742
gagctggcagggccagccgctcaggccgaaa CRISPR spacer
cagatggccgggccagccgctcagccggtcg Protospacer
** **** *************** * * .
136. spacer 1.8|1024657|31|CP034170|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742
gagctggcagggccagccgctcaggccgaaa CRISPR spacer
cagatggccgggccagccgctcagccggtcg Protospacer
** **** *************** * * .
137. spacer 1.8|1024657|31|CP034170|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742
gagctggcagggccagccgctcaggccgaaa CRISPR spacer
cagatggccgggccagccgctcagccggtcg Protospacer
** **** *************** * * .
138. spacer 1.8|1024657|31|CP034170|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.742
gagctggcagggccagccgctcaggccgaaa CRISPR spacer
cagatggccgggccagccgctcagccggtcg Protospacer
** **** *************** * * .
139. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
140. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
141. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
142. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
143. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
144. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gctggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
145. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gtcggcgccgcccgggtggccgcggtgctcgg Protospacer
* ********* ******** *****. *
146. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
147. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
148. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
149. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
150. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
151. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
152. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
153. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
154. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
155. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
156. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
157. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
158. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
159. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
160. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
161. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
162. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
163. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
164. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
165. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
166. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
167. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
168. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
169. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
170. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
171. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
172. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
173. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
174. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
175. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
176. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
177. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
178. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
179. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
180. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
181. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
182. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
183. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
184. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
185. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
186. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
187. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
188. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
189. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
190. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
191. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
192. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
193. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggc Protospacer
. ********** ******* *****. **.
194. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacacc-----ccgcccggattcggcgctggccc CRISPR spacer
-----cagcctctaccggacggattcggcgctggccc Protospacer
** * *** ******************
195. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacacc-----ccgcccggattcggcgctggccc CRISPR spacer
-----cagcctctaccggacggattcggcgctggccc Protospacer
** * *** ******************
196. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacacc-----ccgcccggattcggcgctggccc CRISPR spacer
-----cagcctctaccgcacggattcggcgctggtcc Protospacer
** * **** ***************.**
197. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacaccccgcccggattcggcgctggccc CRISPR spacer
gcacccaccacgcccggatccggcgctgcacc Protospacer
* **** *********.******** **
198. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacacc-----ccgcccggattcggcgctggccc CRISPR spacer
-----cagcctctaccgcacggattcggcgctggtcc Protospacer
** * **** ***************.**
199. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacacc-----ccgcccggattcggcgctggccc CRISPR spacer
-----cagcctctaccgcacggattcggcgctggtcc Protospacer
** * **** ***************.**
200. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
gatgacacc-----ccgcccggattcggcgctggccc CRISPR spacer
-----cagcctctaccgggcggattcggcgctggccc Protospacer
** * *** ******************
201. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccct Protospacer
*. ******** *********** **** .
202. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccct Protospacer
*. ******** *********** **** .
203. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccct Protospacer
*. ******** *********** **** .
204. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccct Protospacer
*. ******** *********** **** .
205. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
gctcggactcgcttcggtgattccgtcgcggc Protospacer
* *. .********** ************
206. spacer 1.23|1025584|32|CP034170|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtttccttcgcttcggtctttccgtcgcggc CRISPR spacer
agcgtccttcgcgtcggtcttgccgtcacctc Protospacer
.*. ******** ******** *****.* *
207. spacer 1.24|1025645|33|CP034170|CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 8, identity: 0.758
gacgtccaccccggcatgttcgctgtagccgtt CRISPR spacer
ggcgtcaacgccggcatgttcgctgtcgagata Protospacer
*.**** ** **************** * .*
208. spacer 1.24|1025645|33|CP034170|CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 8, identity: 0.758
gacgtccaccccggcatgttcgctgtagccgtt CRISPR spacer
ggcgtcaacgccggcatgttcgctgtcgagatg Protospacer
*.**** ** **************** * .*
209. spacer 1.29|1025951|32|CP034170|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 8, identity: 0.75
cggcgcaccacccgcgacatgggtggggcgcc CRISPR spacer
ttgaccatcacccgcgacatgggtgcgggggc Protospacer
. * **.***************** ** * *
210. spacer 1.35|1026318|32|CP034170|CRISPRCasFinder matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 8, identity: 0.75
aggccaacctgttccacggcgaccacacaacc CRISPR spacer
tcgtcaacccgttccacggcgaccactcagaa Protospacer
*.*****.**************** **.
211. spacer 1.35|1026318|32|CP034170|CRISPRCasFinder matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 8, identity: 0.75
aggccaacctgttccacggcgaccacacaacc CRISPR spacer
tcgtcaacccgttccacggcgaccactcagaa Protospacer
*.*****.**************** **.
212. spacer 1.35|1026318|32|CP034170|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
aggccaacctgttccacggcgaccacacaacc- CRISPR spacer
cggccaacctgttcgacgacgacc-cgcggcgg Protospacer
************* ***.***** *.*..*
213. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcagccggccgatctgggcgg Protospacer
. *.*.***********.***********.
214. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 8, identity: 0.75
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcagccggccgatctgggcgg Protospacer
. *.*.***********.***********.
215. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.75
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcagccggccgatctgggcgg Protospacer
. *.*.***********.***********.
216. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 8, identity: 0.75
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcagccggccgatctgggcgg Protospacer
. *.*.***********.***********.
217. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcagccggccgatctgggcgg Protospacer
. *.*.***********.***********.
218. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.75
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
cagcagggcgcgcagccggttgatctgggcgg Protospacer
* ** ** *********.**********.
219. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
caggtggctgaccgaccgggccagccgatcga Protospacer
. ** * ***.**********.********
220. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
gagatggctgaccgaccgggccaagcgatcga Protospacer
*. .* * ***.*********** *******
221. spacer 1.43|1026806|32|CP034170|CRISPRCasFinder matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 8, identity: 0.75
cgcaacctcggagacggcctcttcgatgtggt CRISPR spacer
gccgacctcggggacggccgcttcgatggcgc Protospacer
*.*******.******* ******** *.
222. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
ccggggccaacaggcccgactggaccgactgg Protospacer
. **********.***.**********.*.
223. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG792102 (Escherichia phage P13803, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
224. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG803184 (Escherichia phage P13353 complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
225. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KU298437 (Escherichia phage phiON-2011, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
226. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG803185 (Escherichia phage P13357 complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
227. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HE664024 (Escherichia phage P13374 complete proviral genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
228. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG792105 (Escherichia phage P14437, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
229. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG792103 (Escherichia phage P8983, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
230. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG803182 (Escherichia phage P13363 complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
231. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_028660 (Escherichia phage phi191, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
232. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HG803183 (Escherichia phage P13368 complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
233. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_018846 (Escherichia phage P13374, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
234. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_028685 (Shigella phage Ss-VASD, complete genome) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcggggccagcaggtccggctgggccgagggg Protospacer
* *****.*************.**** *.
235. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
ttcagccgaacaggtccggctggacggagcgg Protospacer
* . * * ***************** ** **.
236. spacer 1.46|1026989|32|CP034170|CRISPRCasFinder matches to MG251388 (Pseudomonas phage Psp6, complete genome) position: , mismatch: 8, identity: 0.75
cccaacgacgtattcgacgccaacggcaacca CRISPR spacer
gacggcgacggcttcgacgccaacggcaaacc Protospacer
*..***** ***************** *
237. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.75
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
tacgtggtctcgtcgtcgagcggcagctcgtc Protospacer
* *. .*********** *********.**
238. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_002679 (Mesorhizobium japonicum MAFF 303099 plasmid pMLa, complete sequence) position: , mismatch: 8, identity: 0.75
------aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
gcctggaag------tcgacgtagtgcggcagcttgta Protospacer
*** *** *** ***************
239. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.75
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
acgttgatctggtcgtcgggcggcagcttcca Protospacer
* * . **** ******* ********** .*
240. spacer 1.52|1027355|33|CP034170|CRISPRCasFinder,PILER-CR matches to KY290950 (Aeromonas phage 59.1, complete genome) position: , mismatch: 8, identity: 0.758
gagttctttcaccgtcaccgacccgaacgtgcc CRISPR spacer
aaagtacgtcaccgtcaccgatccgaatgtgcc Protospacer
.*. * . *************.*****.*****
241. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
atctgctgcgccgggtcgaggcgggcgaggat Protospacer
*..********** ********** ** * .
242. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ccaccgtgcgccgcgtcgaggcggtcggcgcg Protospacer
* . ******************.** ***
243. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75
-acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
tgcgcgcc-cgcctcgtcgaggcggccttcgcg Protospacer
.* .**. **** ************* ****
244. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cctatgcgcgccgcgacgaggcggccgtcgag Protospacer
** .******** **************
245. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cctatgcgcgccgcgacgaggcggccgtcgag Protospacer
** .******** **************
246. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
247. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
248. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
249. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ccgcgcgcggccgcgtcgaggcggccgacacc Protospacer
* .** ****************** *.**
250. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.75
--acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cggtctgcggca--gcatcgaggcggccgtcgcc Protospacer
...*** **. **.*****************
251. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
252. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
253. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
254. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
255. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
256. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
257. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
258. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
259. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
260. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
261. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
262. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
263. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
264. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
265. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
accccgagggccgcgacgaggcggccttcgcc Protospacer
**.. * ****** ********** *****
266. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
267. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
268. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
269. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
270. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
271. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
272. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
273. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
274. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
275. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
276. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
277. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
278. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
279. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
280. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
281. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
282. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
283. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
284. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
285. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
286. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
287. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
288. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
289. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
290. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
291. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
292. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
293. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
294. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
295. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
296. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
297. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
298. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
299. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
300. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
301. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
302. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
303. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggcc-gtcgcc CRISPR spacer
ggccgccgcgccgtgtcgaggcggccggtcgg- Protospacer
. ..**.******.************ ****
304. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
305. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
306. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
307. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
308. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
309. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
310. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
311. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
312. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccg Protospacer
. .************ ****** **** * *
313. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc---- CRISPR spacer
acttgctgcaccgcatcgagg----cgccgctgaaa Protospacer
*********.****.****** **.***.
314. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
tcatcccgcgccgcgtggaggcggccggcggg Protospacer
* * *.********* ********** **
315. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
gcgtgctgagccgcgtcgaggccgcctatggc Protospacer
.* ***** ************* *** .* *
316. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ccctgctggcccgcgtcgaggcggccaccagc Protospacer
*.***** ****************..*. *
317. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
agctgctgcgccgcggcgtggcggccagccgc Protospacer
* .************ ** *******. * *
318. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
tcatcccgcgccgcgtggaggcggccggcggg Protospacer
* * *.********* ********** **
319. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
agtggctgcgccgcgtcgaggtgggcgaccag Protospacer
* * *****************.** ** *
320. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
agtggctgcgccgcgtcgaggtgggcgaccag Protospacer
* * *****************.** ** *
321. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
agctgctgcgccgcggcgtggcggccagccgc Protospacer
* .************ ** *******. * *
322. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 8, identity: 0.75
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cgctccagcgcggcgtcgaggcggacgtcgtc Protospacer
.* * **** ************ *****.*
323. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.75
acttgct--gcgccgcgtcgaggcggccgtcgcc CRISPR spacer
--tcgccgagcgccgcgccgaggcggccgccgag Protospacer
*.**. ********.***********.**
324. spacer 1.66|1028212|32|CP034170|CRISPRCasFinder,PILER-CR matches to MN602268 (Bacteriophage DSS3_MAL1, complete genome) position: , mismatch: 8, identity: 0.75
acagggaccgacaccaccgggtccgggaccga CRISPR spacer
attctggtcgacaccatcggctccgggaccga Protospacer
*. *..********.*** ***********
325. spacer 1.67|1028273|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 8, identity: 0.75
tgggccgcgatggtgttgcgttgactgtggag CRISPR spacer
agggccgcgacggtgttgcgatgaaaacggcg Protospacer
*********.********* *** ..** *
326. spacer 1.70|1028456|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttcgtcgcgtacaccgatctcgtctgattc CRISPR spacer
cgttcgtcgcgtacaccgcgctcaccatcctc Protospacer
****************** ***..* .**
327. spacer 1.72|1024231|33|CP034170|CRT matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 8, identity: 0.758
cgtcgatcaccgcggcagcggacgagcaagagg CRISPR spacer
agccgatcactgcggcagcggtcgagccgccgg Protospacer
*.*******.********** ***** . **
328. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 8, identity: 0.758
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggcgccgtcgtcgg Protospacer
. * *************** *********
329. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 8, identity: 0.758
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggcgccgtcgtcgg Protospacer
. * *************** *********
330. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 8, identity: 0.758
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggcgccgtcgtcgg Protospacer
. * *************** *********
331. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_KY000054 (Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence) position: , mismatch: 8, identity: 0.758
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggcgccgtcgtcgg Protospacer
. * *************** *********
332. spacer 1.76|1024475|33|CP034170|CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 8, identity: 0.758
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
tctctgcctcggcggccttagcggcgtcgtcgg Protospacer
* .* ******* ***.*************
333. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.758
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
gggcgacctcggcggacttgacggaaaaggcgc Protospacer
******* ************.*** . * **
334. spacer 1.79|1024658|32|CP034170|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75
agctggcagggccagccgctcaggccgaaacg CRISPR spacer
agatggccgggccagccgctcagccggtcgcc Protospacer
** **** *************** * * .*
335. spacer 1.79|1024658|32|CP034170|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
agctggcagggccagccgctcaggccgaaacg CRISPR spacer
agatggccgggccagccgctcagccggtcgcc Protospacer
** **** *************** * * .*
336. spacer 1.79|1024658|32|CP034170|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
agctggcagggccagccgctcaggccgaaacg CRISPR spacer
agatggccgggccagccgctcagccggtcgcc Protospacer
** **** *************** * * .*
337. spacer 1.79|1024658|32|CP034170|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
agctggcagggccagccgctcaggccgaaacg CRISPR spacer
agatggccgggccagccgctcagccggtcgcc Protospacer
** **** *************** * * .*
338. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
339. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
340. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
341. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
342. spacer 1.81|1024778|33|CP034170|CRT matches to NC_013930 (Thioalkalivibrio sp. K90mix plasmid pTK9001, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
aagaacggggcaggggttgccccggtgtgggta Protospacer
*..** ** ***** ***************
343. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
344. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
345. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
atcggcgccgccggggtggccctgctggtggcg Protospacer
* *******************.* ** **..
346. spacer 1.83|1024900|33|CP034170|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.758
gatgacacc-----ccgcccggattcggcgctggcccg CRISPR spacer
-----cagcctctaccggacggattcggcgctggcccg Protospacer
** * *** *******************
347. spacer 1.83|1024900|33|CP034170|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
gatgacacc-----ccgcccggattcggcgctggcccg CRISPR spacer
-----cagcctctaccgggcggattcggcgctggcccg Protospacer
** * *** *******************
348. spacer 1.83|1024900|33|CP034170|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.758
gatgacacc-----ccgcccggattcggcgctggcccg CRISPR spacer
-----cagcctctaccggacggattcggcgctggcccg Protospacer
** * *** *******************
349. spacer 1.83|1024900|33|CP034170|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
gatgacacc-----ccgcccggattcggcgctggcccg CRISPR spacer
-----cagcctctaccgcacggattcggcgctggtccg Protospacer
** * **** ***************.***
350. spacer 1.83|1024900|33|CP034170|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
gatgacacc-----ccgcccggattcggcgctggcccg CRISPR spacer
-----cagcctctaccgcacggattcggcgctggtccg Protospacer
** * **** ***************.***
351. spacer 1.83|1024900|33|CP034170|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758
gatgacacc-----ccgcccggattcggcgctggcccg CRISPR spacer
-----cagcctctaccgcacggattcggcgctggtccg Protospacer
** * **** ***************.***
352. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.758
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
gctcggactcgcttcggtcattccgtcgcggcc Protospacer
* *. .*********** ************
353. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 8, identity: 0.758
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
gctcggactcgcttcggtcattccgtcgcggcc Protospacer
* *. .*********** ************
354. spacer 1.95|1025645|34|CP034170|CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 8, identity: 0.765
gacgtccaccccggcatgttcgctgtagccgttg CRISPR spacer
ggcgtcaacgccggcatgttcgctgtcgagatag Protospacer
*.**** ** **************** * .* *
355. spacer 1.95|1025645|34|CP034170|CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 8, identity: 0.765
gacgtccaccccggcatgttcgctgtagccgttg CRISPR spacer
ggcgtcaacgccggcatgttcgctgtcgagatgg Protospacer
*.**** ** **************** * .* *
356. spacer 1.96|1025707|33|CP034170|CRT matches to MF766045 (Streptomyces phage Daudau, complete genome) position: , mismatch: 8, identity: 0.758
ggcggaccgggccaggactcggcgaagatgctg CRISPR spacer
gcgaggccgggctacgactcggcgaagatgcgc Protospacer
* .*.******.* ****************
357. spacer 1.106|1026318|33|CP034170|CRT matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 8, identity: 0.758
aggccaacctgttccacggcgaccacacaaccg CRISPR spacer
tcgtcaacccgttccacggcgaccactcagaag Protospacer
*.*****.**************** **. *
358. spacer 1.106|1026318|33|CP034170|CRT matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 8, identity: 0.758
aggccaacctgttccacggcgaccacacaaccg CRISPR spacer
tcgtcaacccgttccacggcgaccactcagaag Protospacer
*.*****.**************** **. *
359. spacer 1.107|1026379|33|CP034170|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.758
aacaagttcgggcagccggtcgatctgggcgag CRISPR spacer
gaacagcgcgcgcagccggtcgatgtgggcgat Protospacer
.* **. ** ************* *******
360. spacer 1.112|1026684|33|CP034170|CRT matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
caggtggctgaccgaccgggccagccgatcgag Protospacer
. ** * ***.**********.*********
361. spacer 1.112|1026684|33|CP034170|CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
gagatggctgaccgaccgggccaagcgatcgag Protospacer
*. .* * ***.*********** ********
362. spacer 1.112|1026684|33|CP034170|CRT matches to NC_047879 (Bordetella phage MW2, complete genome) position: , mismatch: 8, identity: 0.758
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
ggcgacggggactgactgggccaagtgacctga Protospacer
**** ***********.******* .**.* ..
363. spacer 1.114|1026806|33|CP034170|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
cgcaacctcggagacggcctcttcgatgtggtg CRISPR spacer
ggcaccctcggagacgccctcttcgccgtcctc Protospacer
*** *********** ******** .** *
364. spacer 1.114|1026806|33|CP034170|CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
cgcaacctcggagacggcctcttcgatgtggtg CRISPR spacer
ggcaccctcggagacgccctcttcgccgtcctc Protospacer
*** *********** ******** .** *
365. spacer 1.117|1026989|33|CP034170|CRT matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 8, identity: 0.758
cccaacgacgtattcgacgccaacggcaaccag CRISPR spacer
gtcgtcgacgtcatcgacgccaacggcaacccc Protospacer
.*. ****** ******************
366. spacer 1.117|1026989|33|CP034170|CRT matches to MG251388 (Pseudomonas phage Psp6, complete genome) position: , mismatch: 8, identity: 0.758
cccaacgacgtattcgacgccaacggcaaccag CRISPR spacer
gacggcgacggcttcgacgccaacggcaaaccg Protospacer
*..***** ***************** * *
367. spacer 1.120|1027172|33|CP034170|CRT matches to NC_002679 (Mesorhizobium japonicum MAFF 303099 plasmid pMLa, complete sequence) position: , mismatch: 8, identity: 0.758
------aaggccatctcgtcgtcgtgcggcagcttgtag CRISPR spacer
gcctggaag------tcgacgtagtgcggcagcttgtag Protospacer
*** *** *** ****************
368. spacer 1.123|1027355|34|CP034170|CRT matches to NC_016654 (Rhodococcus phage REQ3, complete genome) position: , mismatch: 8, identity: 0.765
gagttcttt--caccgtcaccgacccgaacgtgccg CRISPR spacer
--gtccctcgaaacggtcgccgacccgaacgtgccg Protospacer
**.*.*. ** ***.*****************
369. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.758
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
cggtggcgcgcggggtcgaggcggccgtcgcca Protospacer
** .**** * ******************.
370. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.758
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ccacggtgcgccgcgtcgaggcggtcggcgcgt Protospacer
* .* ******************.** ***
371. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ccgcgcgcggccgcgtcgaggcggccgacaccg Protospacer
* .** ****************** *.***
372. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
atctgctgcgccgcatcgacgcggccgatccca Protospacer
*..***********.**** ******* . **.
373. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.758
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
accccgagggccgcgacgaggcggccttcgccg Protospacer
**.. * ****** ********** ******
374. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
atctgctgcgccgcatcgacgcggccgatccca Protospacer
*..***********.**** ******* . **.
375. spacer 1.1|1024230|32|CP034170|CRISPRCasFinder matches to MK359313 (Gordonia phage Vasanti, complete genome) position: , mismatch: 9, identity: 0.719
acgtcgatcaccgcggcagcggacgagcaaga CRISPR spacer
acgtcgatcgccgcggccgcggactgcaggta Protospacer
*********.******* ****** . .. *
376. spacer 1.1|1024230|32|CP034170|CRISPRCasFinder matches to MH576966 (Mycobacterium phage Thyatira, complete genome) position: , mismatch: 9, identity: 0.719
acgtcgatcaccgcggcagcggacgagcaaga CRISPR spacer
gtgtcgatcaccgcggcggcggccgggtatct Protospacer
..***************.**** **.*.*
377. spacer 1.2|1024291|32|CP034170|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtg-gtgacaccgaattggcctgtccagcg CRISPR spacer
-aaatgcccgagaccgaaatggcctgtccagct Protospacer
..** .** ****** *************
378. spacer 1.2|1024291|32|CP034170|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtg-gtgacaccgaattggcctgtccagcg CRISPR spacer
-aaatgcccgagaccgaaatggcctgtccagct Protospacer
..** .** ****** *************
379. spacer 1.2|1024291|32|CP034170|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtg-gtgacaccgaattggcctgtccagcg CRISPR spacer
-aaatgcccgagaccgaaatggcctgtccagct Protospacer
..** .** ****** *************
380. spacer 1.2|1024291|32|CP034170|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtg-gtgacaccgaattggcctgtccagcg CRISPR spacer
-aaatgcccgagaccgaaatggcctgtccagct Protospacer
..** .** ****** *************
381. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggcgccgtcgtc Protospacer
. . * *************** *******
382. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggcgccgtcgtc Protospacer
. . * *************** *******
383. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggcgccgtcgtc Protospacer
. . * *************** *******
384. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_KY000054 (Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggcgccgtcgtc Protospacer
. . * *************** *******
385. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
acgtcgacgtcgccggacttgccggcgagcag Protospacer
* * ******** ******** *****
386. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tcgggattttcggggggcttggcggcgtcgtc Protospacer
** . . **** **.***************
387. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
aaggcgacgtcgggggactcggcggtcagggt Protospacer
*.*********** *****.*****. * .
388. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcgtcggcatcggcggacttggcggcgaccag Protospacer
. * **.*.****************** *
389. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
tgggcgatgtcggcggactgggcgtgcaggta Protospacer
******.*********** **** **
390. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcgtcggcatcggcggacttggcggcgaccag Protospacer
. * **.*.****************** *
391. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gacacgacctcggcggagttggcggcgctgtg Protospacer
.. .**** ******** *********..**
392. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcaaagccgtcggcggtcttggcggcctcggc Protospacer
. .. * ********* ********* *** *
393. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
ccgatgtcgtcggcggacttgccggcgacgaa Protospacer
*..* ************** ***** **
394. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 9, identity: 0.719
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
ttctctgcctcggcggccttagcggcgtcgtc Protospacer
* .* ******* ***.***********
395. spacer 1.7|1024596|32|CP034170|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 9, identity: 0.719
gagctggcagggccagccgctcaggccgaaac CRISPR spacer
gctctggcagggcgagccgcgcaggcagttct Protospacer
* ********** ****** ***** * .
396. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
397. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
398. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
399. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
400. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
agtgaggccgccggggtcgacccggtgtggcg Protospacer
*. *********** * **********
401. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
402. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
403. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
404. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
405. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
406. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
407. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
408. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
409. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
410. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
411. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
412. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP026718 (Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
413. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtc Protospacer
. ************** ********.* .
414. spacer 1.17|1025217|32|CP034170|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
gcattacctgcctgccgcacctgctcccgttt CRISPR spacer
acgtaggatgcctgccgcacctgcaccagttc Protospacer
.*.* . **************** ** ***.
415. spacer 1.20|1025400|32|CP034170|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.719
cactccgcagactcgcgggtcgggccaaacgt CRISPR spacer
agcgaagcagagtcgcgggtcgggccgaacaa Protospacer
.* ***** **************.***.
416. spacer 1.28|1025890|32|CP034170|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgaactcagcggcgccaaggaaacggtttgt CRISPR spacer
acgaagtcagcggcgacaaggaaaccgacgtc Protospacer
.**** ********* ********* * . .
417. spacer 1.32|1026134|32|CP034170|CRISPRCasFinder matches to NC_015854 (Acidithiobacillus caldus SM-1 plasmid pLAtc3, complete sequence) position: , mismatch: 9, identity: 0.719
cgggttgcctgggagatccgcgacaggcgagc CRISPR spacer
cgggatgcctgggagattcgcgagcgctggca Protospacer
**** ************.***** * .*.
418. spacer 1.32|1026134|32|CP034170|CRISPRCasFinder matches to NZ_CP026330 (Acidithiobacillus caldus strain MTH-04 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
cgggttgcctgggagatccgcgacaggcgagc CRISPR spacer
cgggatgcctgggagattcgcgagcgctggca Protospacer
**** ************.***** * .*.
419. spacer 1.32|1026134|32|CP034170|CRISPRCasFinder matches to NC_010600 (Acidithiobacillus caldus strain MNG plasmid pTcM1, complete sequence) position: , mismatch: 9, identity: 0.719
cgggttgcctgggagatccgcgacaggcgagc CRISPR spacer
cgggatgcctgggagattcgcgagcgctggca Protospacer
**** ************.***** * .*.
420. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
cgggaaatcgggcagcccgtcgagctgggcgc Protospacer
. .*. ********** ***** *******
421. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgaaaggggggcggccggtcgatctggtcga Protospacer
. **. ****.************** ***
422. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
cgggaaatcgggcagcccgtcgagctgggcgc Protospacer
. .*. ********** ***** *******
423. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgaaaggggggcggccggtcgatctggtcga Protospacer
. **. ****.************** ***
424. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
cgggaagtcgggcagcccgtcgagctgggcgc Protospacer
. .*. ********** ***** *******
425. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
cgggaagtcgggcagcccgtcgagctgggcgc Protospacer
. .*. ********** ***** *******
426. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcaggcggccgatctgggcgg Protospacer
. *.*.******* ***.***********.
427. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagt-tcgggcagccggtcgatctgggcga CRISPR spacer
-gcgggcgccgggcagccggtcgatatcggcgc Protospacer
.*..*. .**************** * ****
428. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcaggcggccgatctgggcgg Protospacer
. *.*.******* ***.***********.
429. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagt--tcgggcagccggtcgatctgggcga CRISPR spacer
--ctggccgccgagcagccgggcgatctgggcgt Protospacer
* .*. .**.******** ***********
430. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcaggcggccgatctgggcgg Protospacer
. *.*.******* ***.***********.
431. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcaggcggccgatctgggcgg Protospacer
. *.*.******* ***.***********.
432. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcaggcggccgatctgggcgg Protospacer
. *.*.******* ***.***********.
433. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gcgcaatccgggcaggcggccgatctgggcgg Protospacer
. *.*.******* ***.***********.
434. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
ctcagcatcgggctggcggtcgatctgggcct Protospacer
**. ****** * **************
435. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP037915 (Sphingomonas sp. AAP5 plasmid p150, complete sequence) position: , mismatch: 9, identity: 0.719
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
cacaagttcggccaggcggtcgatttcgttcc Protospacer
********** *** ********.* * .
436. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
cagatggctgactgatcgggccaagcgatcga Protospacer
. .* * ******.******** *******
437. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
cagatggctgactgatcgggccaagcgatcga Protospacer
. .* * ******.******** *******
438. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 9, identity: 0.719
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
cagatccccgactgaccgcgccagccgatcga Protospacer
. .** ********* ****.********
439. spacer 1.41|1026684|32|CP034170|CRISPRCasFinder matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcggggactgaccgggccaaccgatcga CRISPR spacer
cagatggctgactgatcgggccaagcgatcga Protospacer
. .* * ******.******** *******
440. spacer 1.42|1026745|32|CP034170|CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 9, identity: 0.719
gagccggttgagtttggcgagattgctttctg CRISPR spacer
cagcgggttgaggttggcgagattggacgcct Protospacer
*** ******* ************ . *.
441. spacer 1.43|1026806|32|CP034170|CRISPRCasFinder matches to LC208019 (Aeropyrum globular virus 1 genomic DNA, complete genome) position: , mismatch: 9, identity: 0.719
cgcaacctcggagacggcctcttcgatgtggt CRISPR spacer
ctcaacctcgaggacggcctcttcggggcctg Protospacer
* ********..*************. *.
442. spacer 1.44|1026867|32|CP034170|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ccctacgccatcttcatgcagatggtccaaca CRISPR spacer
atccacgacatcttcatccagatggtcaagag Protospacer
.*.*** ********* ********* *. .
443. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
444. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
445. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
446. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
447. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
448. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682374 (Escherichia phage PA8, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
449. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
450. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_000924 (Enterobacteria phage 933W, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
451. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_049924 (Stx2-converting phage Stx2a_F451 proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
452. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
453. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682381 (Escherichia phage PA28, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
454. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
455. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to MG986485 (Escherichia phage SH2026Stx1, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
456. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
457. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AF125520 (Bacteriophage 933W, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
458. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
459. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
460. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KU238070 (Stx converting phage vB_EcoS_ST2-8624, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
461. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
462. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
463. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP012533 (Stx2-converting phage Stx2a_F723 proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
464. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
465. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
466. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to MT225101 (Escherichia phage Lys19259Vzw, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
467. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
468. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
469. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KU977419 (Stx1 converting phage AU5Stx1, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
470. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to JQ011318 (Escherichia phage TL-2011c, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
471. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP004402 (Stx2 converting phage I DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
472. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
473. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
474. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
475. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HM208303 (Stx2 converting phage vB_EcoP_24B, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
476. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
477. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
478. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
479. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP012534 (Stx2-converting phage Stx2a_F765 proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
480. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to HQ424691 (Enterobacteria phage VT2phi_272, complete sequence) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
481. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
482. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
483. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_049923 (Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
484. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KU977420 (Stx1 converting phage AU6Stx1, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
485. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682371 (Escherichia phage PA2, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
486. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
487. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
488. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_049925 (Stx converting phage vB_EcoS_P27, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
489. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
490. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_010237 (Enterobacteria phage Min27, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
491. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
492. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to AP012529 (Stx2-converting phage Stx2a_F403 proviral DNA, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
493. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NC_049917 (Escherichia phage Lys12581Vzw, complete genome) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
acggggccagcaggtccggctgggccgaaggg Protospacer
*****.*************.**** *.
494. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
gatcggcgaacaggtccggatggaaccatttc Protospacer
****** *********** **** * *..
495. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
gatcggcgaacaggtccggatggaaccatttc Protospacer
****** *********** **** * *..
496. spacer 1.46|1026989|32|CP034170|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.719
cccaacgacgtattcgacgccaacggcaacca CRISPR spacer
gaggtggacgtcttcgacgccaccggcaacct Protospacer
. ***** ********** ********
497. spacer 1.46|1026989|32|CP034170|CRISPRCasFinder matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 9, identity: 0.719
cccaacgacgtattcgacgccaacggcaacca CRISPR spacer
cagaacgacgtattcgacgctgacggcggagc Protospacer
* *****************..*****..
498. spacer 1.46|1026989|32|CP034170|CRISPRCasFinder matches to NZ_CP023073 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666d, complete sequence) position: , mismatch: 9, identity: 0.719
-----cccaacgacgtattcgacgccaacggcaacca CRISPR spacer
gagctcct-----cgtattcgacgccatcagcaaccc Protospacer
**. ************** *.******
499. spacer 1.48|1027111|32|CP034170|CRISPRCasFinder matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggctggcggcacgtgtagccgagaacgtcgc CRISPR spacer
cggctggcggcacgggtcgccgatgaacgggt Protospacer
************** ** ***** .* *.
500. spacer 1.51|1027294|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tgaaatgagttcaccaccgaccaccaacacct CRISPR spacer
tgcccccgcttcaccaccgacctccagcacct Protospacer
** . . ************* ***.*****
501. spacer 1.57|1027662|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP042820 (Octadecabacter sp. SW4 plasmid pow41, complete sequence) position: , mismatch: 9, identity: 0.719
cgaccatcgtcgcggctccaacggcgagcgtg CRISPR spacer
cttccttcgtcgcggctgcaacggcgttttta Protospacer
* ** *********** ******** . *.
502. spacer 1.57|1027662|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP040754 (Sulfitobacter sp. BSw21498 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgaccatcgtcgcggctccaacggcgagcgtg CRISPR spacer
cttccttcgtcgcggctgcaacggcgttttta Protospacer
* ** *********** ******** . *.
503. spacer 1.59|1027784|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgacccgcgagactacgagactccggaagcg CRISPR spacer
acgtgccgcgcaactacgagactccggatggc Protospacer
.* ***** .**************** *
504. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
505. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
506. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
507. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
508. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
509. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
510. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
511. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
512. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
513. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
514. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
515. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
516. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
517. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
518. spacer 1.60|1027845|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggtg----tgggcacgccggataggccggcgac CRISPR spacer
----atgaccttgagcacgccggataggcgggcggt Protospacer
.** **.*************** ****..
519. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
gtctctggcgccgcggcgaggcggctgtcgca Protospacer
...* . ******** *********.*****
520. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cggcgcgcggccgcgtcgaggcggccgacacc Protospacer
.** ****************** *.**
521. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
agcacgtgcgccgggtcgaggcggtcgtcgga Protospacer
* . ******* **********.*****
522. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ggatcgtccgccgcatcgaggcggacgtcgcg Protospacer
. * * ******.********* ******
523. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cggcgcgcggccgcgtcgaggcggccgacacc Protospacer
.** ****************** *.**
524. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
agggcgagtgcggcgtcgaggccgccgtcgcc Protospacer
* *.** ********** *********
525. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
cgctgctgcgccgcgtcgagcaggcctacctc Protospacer
.***************** **** * .*
526. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
aaacgtgtcgccgcgtcgatgaggccgtcgca Protospacer
* .*. *********** * *********
527. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
gcttcctgcgccgcatcgaggcggagtttccg Protospacer
.*** *********.********* *. *
528. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
aagagctgcgccgcgccaaggcggccgagccg Protospacer
* ***********.*.********* *
529. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_023498 (Mycobacterium phage Validus, complete genome) position: , mismatch: 9, identity: 0.719
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
gccagcggcgccgcgccgaggcggccgggccg Protospacer
.*. ** ********.*********** *
530. spacer 1.63|1028028|32|CP034170|CRISPRCasFinder,PILER-CR matches to MH825712 (Microbacterium phage ValentiniPuff, complete genome) position: , mismatch: 9, identity: 0.719
ccaaccttgaaccgggcaccctgccacggggc CRISPR spacer
gacaggttgaaccgggtgccctgccacggcgg Protospacer
* **********..*********** *
531. spacer 1.65|1028151|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccccgccgccatcgactggctcaggtgaa CRISPR spacer
gcgccccgccggcatcgacaggccgggcatga Protospacer
*********** ******* ***. .* .*
532. spacer 1.65|1028151|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccccgccgccatcgactggctcaggtgaa CRISPR spacer
caactccgccgccatcgacttggtcagggtga Protospacer
.*.*************** * ***** .*
533. spacer 1.67|1028273|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
tgggccgcgatggtgttgcgttgactgtggag CRISPR spacer
tgggccgcaatgatgttgcgttgtgcacgggc Protospacer
********.***.********** ...**.
534. spacer 1.69|1028395|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtgggcctggctccgaggttgttgacgtagtt CRISPR spacer
aagcgcccggctccggggttgttgacgacggc Protospacer
. * ***.*******.*********** * .
535. spacer 1.76|1024475|33|CP034170|CRT matches to MN703409 (Arthrobacter phage LittleTokyo, complete genome) position: , mismatch: 9, identity: 0.727
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
actcgacgccggcggacctggcggcgtcggtca Protospacer
. *****.********.*********** . .
536. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 9, identity: 0.727
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggtgccgtcgtcgg Protospacer
. * *************.* *********
537. spacer 1.76|1024475|33|CP034170|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 9, identity: 0.727
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggtgccgtcgtcgg Protospacer
. * *************.* *********
538. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 9, identity: 0.727
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cctttccttcggcggacttggtgccgtcgtcgg Protospacer
. * *************.* *********
539. spacer 1.76|1024475|33|CP034170|CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gggcgacgtcggcggacttggcggcgtcgtcgg CRISPR spacer
cgggattttcggggggcttggcggcgtcgtcgc Protospacer
** . . **** **.****************
540. spacer 1.79|1024658|32|CP034170|CRT matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 9, identity: 0.719
agctggcagggccagccgctcaggccgaaacg CRISPR spacer
ctctggcagggcgagccgcgcaggcagttctg Protospacer
********** ****** ***** * .*
541. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
542. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
543. spacer 1.81|1024778|33|CP034170|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
544. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
545. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
546. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gctggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
547. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
agtgaggccgccggggtcgacccggtgtggcga Protospacer
*. *********** * ********** *
548. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
549. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
550. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
551. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
552. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
553. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
554. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
555. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
556. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
557. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
558. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
559. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
560. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
561. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
562. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
563. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
564. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
565. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
566. spacer 1.81|1024778|33|CP034170|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
567. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
568. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
569. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
570. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
571. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
572. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
573. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
574. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
575. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
576. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
577. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
578. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
579. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
580. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
581. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
582. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
583. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
584. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
585. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
586. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
587. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
588. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
589. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
590. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
591. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
592. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
593. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
594. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
595. spacer 1.81|1024778|33|CP034170|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gccggcgccgccgcggtggccgcggtgccggcc Protospacer
. ********** ******* *****. **.
596. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccctt Protospacer
*. ******** *********** **** .
597. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.727
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccctt Protospacer
*. ******** *********** **** .
598. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.727
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccctt Protospacer
*. ******** *********** **** .
599. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.727
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
cgcgtccttcgcgtcggtctttccctcgccctt Protospacer
*. ******** *********** **** .
600. spacer 1.94|1025584|33|CP034170|CRT matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggtttccttcgcttcggtctttccgtcgcggca CRISPR spacer
gctcggactcgcttcggtgattccgtcgcggcc Protospacer
* *. .********** ************
601. spacer 1.107|1026379|33|CP034170|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727
aacaagttcgggcagccggtcgatctgggcgag CRISPR spacer
cgggaaatcgggcagcccgtcgagctgggcgcg Protospacer
. .*. ********** ***** ******* *
602. spacer 1.107|1026379|33|CP034170|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.727
aacaagttcgggcagccggtcgatctgggcgag CRISPR spacer
cgggaaatcgggcagcccgtcgagctgggcgcg Protospacer
. .*. ********** ***** ******* *
603. spacer 1.107|1026379|33|CP034170|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.727
aacaagttcgggcagccggtcgatctgggcgag CRISPR spacer
cgggaagtcgggcagcccgtcgagctgggcgcg Protospacer
. .*. ********** ***** ******* *
604. spacer 1.107|1026379|33|CP034170|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727
aacaagttcgggcagccggtcgatctgggcgag CRISPR spacer
cgggaagtcgggcagcccgtcgagctgggcgcg Protospacer
. .*. ********** ***** ******* *
605. spacer 1.112|1026684|33|CP034170|CRT matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 9, identity: 0.727
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
cagatggctgactgatcgggccaagcgatcgag Protospacer
. .* * ******.******** ********
606. spacer 1.112|1026684|33|CP034170|CRT matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 9, identity: 0.727
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
cagatggctgactgatcgggccaagcgatcgag Protospacer
. .* * ******.******** ********
607. spacer 1.112|1026684|33|CP034170|CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 9, identity: 0.727
ggcgtcggggactgaccgggccaaccgatcgag CRISPR spacer
cagatggctgactgatcgggccaagcgatcgag Protospacer
. .* * ******.******** ********
608. spacer 1.114|1026806|33|CP034170|CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 9, identity: 0.727
cgcaacctcggagacggcctcttcgatgtggtg CRISPR spacer
gccgacctcggggacggccgcttcgatggcgcc Protospacer
*.*******.******* ******** *.
609. spacer 1.116|1026928|33|CP034170|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
ccggggccaacaggcccgactggaccgactgga Protospacer
. **********.***.**********.*..
610. spacer 1.116|1026928|33|CP034170|CRT matches to HG792102 (Escherichia phage P13803, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
611. spacer 1.116|1026928|33|CP034170|CRT matches to HG803184 (Escherichia phage P13353 complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
612. spacer 1.116|1026928|33|CP034170|CRT matches to KU298437 (Escherichia phage phiON-2011, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
613. spacer 1.116|1026928|33|CP034170|CRT matches to HG803185 (Escherichia phage P13357 complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
614. spacer 1.116|1026928|33|CP034170|CRT matches to HE664024 (Escherichia phage P13374 complete proviral genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
615. spacer 1.116|1026928|33|CP034170|CRT matches to HG792105 (Escherichia phage P14437, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
616. spacer 1.116|1026928|33|CP034170|CRT matches to HG792103 (Escherichia phage P8983, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
617. spacer 1.116|1026928|33|CP034170|CRT matches to HG803182 (Escherichia phage P13363 complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
618. spacer 1.116|1026928|33|CP034170|CRT matches to HG803183 (Escherichia phage P13368 complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
619. spacer 1.116|1026928|33|CP034170|CRT matches to NC_018846 (Escherichia phage P13374, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
620. spacer 1.116|1026928|33|CP034170|CRT matches to NC_028685 (Shigella phage Ss-VASD, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
621. spacer 1.116|1026928|33|CP034170|CRT matches to NC_028660 (Escherichia phage phi191, complete genome) position: , mismatch: 9, identity: 0.727
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
tcggggccagcaggtccggctgggccgaggggc Protospacer
* *****.*************.**** *.
622. spacer 1.117|1026989|33|CP034170|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.727
cccaacgacgtattcgacgccaacggcaaccag CRISPR spacer
gaggtggacgtcttcgacgccaccggcaacctg Protospacer
. ***** ********** ******** *
623. spacer 1.117|1026989|33|CP034170|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 9, identity: 0.727
cccaacgacgtattcgacgccaacggcaaccag CRISPR spacer
cagaacgacgtattcgacgctgacggcggagcg Protospacer
* *****************..*****.. *
624. spacer 1.120|1027172|33|CP034170|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.727
aaggccatctcgtcgtcgtgcggcagcttgtag CRISPR spacer
tacgtggtctcgtcgtcgagcggcagctcgtcc Protospacer
* *. .*********** *********.**
625. spacer 1.123|1027355|34|CP034170|CRT matches to KY290950 (Aeromonas phage 59.1, complete genome) position: , mismatch: 9, identity: 0.735
gagttctttcaccgtcaccgacccgaacgtgccg CRISPR spacer
aaagtacgtcaccgtcaccgatccgaatgtgcct Protospacer
.*. * . *************.*****.*****
626. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
agcacgtgcgccgggtcgaggcggtcgtcggag Protospacer
* . ******* **********.***** *
627. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
atctgctgcgccgggtcgaggcgggcgaggatc Protospacer
*..********** ********** ** * .
628. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ccaccgtgcgccgcgtcgaggcggtcggcgcgt Protospacer
* . ******************.** ***
629. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
cggcgcgcggccgcgtcgaggcggccgacaccg Protospacer
.** ****************** *.***
630. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
631. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
632. spacer 1.133|1027967|33|CP034170|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
633. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
agggcgagtgcggcgtcgaggccgccgtcgccg Protospacer
* *.** ********** **********
634. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
635. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
636. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
637. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
638. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
639. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
640. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
641. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
642. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
643. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
644. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
645. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
646. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
647. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
648. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
649. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
650. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
651. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
652. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
653. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
654. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
655. spacer 1.133|1027967|33|CP034170|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
656. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
657. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
658. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
659. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
660. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
661. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
662. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
663. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
664. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
665. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
666. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
667. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
668. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
669. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
670. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
671. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
672. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
673. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
cggcgcgcggccgcgtcgaggcggccgacaccg Protospacer
.** ****************** *.***
674. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
675. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
676. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
677. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
678. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
679. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
680. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
681. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
682. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
683. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
684. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
685. spacer 1.133|1027967|33|CP034170|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
686. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
687. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
688. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
689. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
690. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
691. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
692. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
693. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
694. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
ggctgctgcgccgcggcgaggccgccggcccgt Protospacer
. .************ ****** **** * *
695. spacer 1.137|1028212|33|CP034170|CRT matches to MN602268 (Bacteriophage DSS3_MAL1, complete genome) position: , mismatch: 9, identity: 0.727
acagggaccgacaccaccgggtccgggaccgag CRISPR spacer
attctggtcgacaccatcggctccgggaccgac Protospacer
*. *..********.*** ***********
696. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 10, identity: 0.688
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggtgccgtcgtc Protospacer
. . * *************.* *******
697. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 10, identity: 0.688
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggtgccgtcgtc Protospacer
. . * *************.* *******
698. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_021910 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetNIM1c, complete sequence) position: , mismatch: 10, identity: 0.688
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
ttttggctctcggcgaacttggcgacgtcgtc Protospacer
* . ******.********.*******
699. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_009453 (Arthrobacter sp. Rue61a plasmid pAL1, complete sequence) position: , mismatch: 10, identity: 0.688
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctggaagtcggcggtcttggcggcgtaggt Protospacer
. ** ******** *********** * .
700. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 10, identity: 0.688
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcctttccttcggcggacttggtgccgtcgtc Protospacer
. . * *************.* *******
701. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gacacgacctcggccgacttggcggcgctatg Protospacer
.. .**** ***** ************...*
702. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
agcggcgcgggcggggtggccccggtgatctc Protospacer
***** * **************** .
703. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 10, identity: 0.688
gatgacaccccgcccggattcggcgctggccc CRISPR spacer
cccgcgaccccgcccagatccggcgctggtgg Protospacer
.* *********.***.*********.
704. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 10, identity: 0.688
gatgacaccccgcccggattcggcgctggccc CRISPR spacer
cccgcgaccccgcccagatccggcgctggtgg Protospacer
.* *********.***.*********.
705. spacer 1.12|1024900|32|CP034170|CRISPRCasFinder matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 10, identity: 0.688
gatgacaccccgcccggattcggcgctggccc CRISPR spacer
cccgcgaccccgcccagatccggcgctggtgg Protospacer
.* *********.***.*********.
706. spacer 1.13|1024961|30|CP034170|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
cacgagggccaccgggaaggtccgcaaccg CRISPR spacer
tcgctcggccacggggaaggtccgcaagtt Protospacer
. ****** ************** .
707. spacer 1.17|1025217|32|CP034170|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
gcattacctgcctgccgcacctgctcccgttt CRISPR spacer
aagtcgcctgcccgccgcgcctgctcccgacc Protospacer
. .*..******.*****.********** ..
708. spacer 1.25|1025707|32|CP034170|CRISPRCasFinder matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 10, identity: 0.688
ggcggaccgggccaggactcggcgaagatgct CRISPR spacer
ggcggaacgggccagaactcggcttttgcgac Protospacer
****** ********.******* ..* .
709. spacer 1.26|1025768|32|CP034170|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 10, identity: 0.688
cggcggctttcgctgcgggatgcttcgatggg CRISPR spacer
cggcggctttggctgccggatgcccggtcatc Protospacer
********** ***** ******.. * ..
710. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gatcttggcgtgcagccggtcgatctcggcgg Protospacer
.*. ** *************** ****.
711. spacer 1.36|1026379|32|CP034170|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 10, identity: 0.688
aacaagttcgggcagccggtcgatctgggcga CRISPR spacer
gaggtcgacgggcggccggtcgagctgggcgg Protospacer
.* . *****.********* *******.
712. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
713. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
714. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
tgatccgtcacgccgcccgcgccgaggccgtc Protospacer
**.*** **************** .. .*.
715. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
716. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
717. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
718. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
719. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
720. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
721. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
722. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
723. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
724. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
atcaccgccacgccgcccgcgccgcaaaccac Protospacer
* *** ****************.**..
725. spacer 1.37|1026440|32|CP034170|CRISPRCasFinder matches to JQ015307 (Pectobacterium phage phiTE, complete genome) position: , mismatch: 10, identity: 0.688
agacccgacacgccgcccgcgccgtaagtgcg CRISPR spacer
gtacccgtgacgccgcccgcgccgttgctaat Protospacer
. ***** **************** . *.
726. spacer 1.44|1026867|32|CP034170|CRISPRCasFinder matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 10, identity: 0.688
ccctacgccatcttcatgcagatggtccaaca CRISPR spacer
atccccgacatcttcatgcagaaggtccgctc Protospacer
.*. ** ************** *****. .
727. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcagggccaacaggtccggcgcgaccggaacg Protospacer
* **************** *****. .
728. spacer 1.45|1026928|32|CP034170|CRISPRCasFinder matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 10, identity: 0.688
tatcggccaacaggtccggctggaccgaccga CRISPR spacer
tcagggccaacaggtccggcgcgaccggaacg Protospacer
* **************** *****. .
729. spacer 1.46|1026989|32|CP034170|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 10, identity: 0.688
cccaacgacgtattcgacgccaacggcaacca CRISPR spacer
ttgtgcgaggtagtcgacgccaacggcaccag Protospacer
.. .*** *** *************** * .
730. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.688
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
tcggccatctcgccgtcctgcggcaagccctg Protospacer
**********.**** *******. .. *.
731. spacer 1.49|1027172|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 10, identity: 0.688
aaggccatctcgtcgtcgtgcggcagcttgta CRISPR spacer
cgcgccgtatcgtcgtcgtgcggcagatccgc Protospacer
. ***.* ***************** *.
732. spacer 1.52|1027355|33|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 10, identity: 0.697
gagttctttcaccgtcaccgacccgaacgtgcc CRISPR spacer
cccggctttcaccgtcgccgaccagaacgacct Protospacer
***********.****** ***** *.
733. spacer 1.52|1027355|33|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 10, identity: 0.697
gagttctttcaccgtcaccgacccgaacgtgcc CRISPR spacer
cccggctttcaccgtcgccgaccagaacgacct Protospacer
***********.****** ***** *.
734. spacer 1.52|1027355|33|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gagttctttcaccgtcaccgacccgaacgtgcc CRISPR spacer
cccaaccatcaccgtcaccgacccgaaactgct Protospacer
*. ******************* ***.
735. spacer 1.56|1027601|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_008341 (Nitrosomonas eutropha C91 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
ggatcaatagatgcgaccatgcgatccccgag CRISPR spacer
taataaatagatacgaccatgcgatcatgttt Protospacer
.** *******.************* .
736. spacer 1.57|1027662|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_KM406416 (Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence) position: , mismatch: 10, identity: 0.688
cgaccatcgtcgcggctccaacggcgagcgtg CRISPR spacer
tacccgtcgtcgcgggtccaacggcggatggc Protospacer
.. **.********* **********...*
737. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 10, identity: 0.688
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
gccacgcccgccgcggcgaggcggccgtggcg Protospacer
.*. . ******* ************ **
738. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
tgacgctgcgccgcctcgaggcggtcggcata Protospacer
.********** *********.** *..
739. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP016078 (Actinoalloteichus sp. GBA129-24 plasmid pGBA129-24a, complete sequence) position: , mismatch: 10, identity: 0.688
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
ccagtgcgcgccgcatcgaggaggccgtcgaa Protospacer
* .*******.****** ********
740. spacer 1.62|1027967|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 10, identity: 0.688
acttgctgcgccgcgtcgaggcggccgtcgcc CRISPR spacer
tggtgctgcgccgcttcgagccggcctggagc Protospacer
*********** ***** ***** . *
741. spacer 1.65|1028151|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP039699 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK234, complete sequence) position: , mismatch: 10, identity: 0.688
gcgccccgccgccatcgactggctcaggtgaa CRISPR spacer
gagcctcgccgacatcgactggctcctcctcg Protospacer
* ***.***** ************* . .
742. spacer 1.65|1028151|32|CP034170|CRISPRCasFinder,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 10, identity: 0.688
gcgccccgccgccatcgactggctcaggtgaa CRISPR spacer
ccgcgccgcggccatcgactggctgatcgagc Protospacer
*** **** ************** * ..
743. spacer 1.65|1028151|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 10, identity: 0.688
gcgccccgccgccatcgactggctcaggtgaa CRISPR spacer
cctccccgtcgccatcgacaggctcaaagcgg Protospacer
* *****.********** ******.. ..
744. spacer 1.65|1028151|32|CP034170|CRISPRCasFinder,PILER-CR matches to AP014300 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S28-C6, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
gcgccccgccgccatcgactggctcaggtgaa CRISPR spacer
catctgcgccgccatcgcctggctctggttgg Protospacer
*. *********** ******* *** ..
745. spacer 1.66|1028212|32|CP034170|CRISPRCasFinder,PILER-CR matches to NC_027348 (Delftia phage RG-2014, complete genome) position: , mismatch: 10, identity: 0.688
acagggaccgacaccaccgggtccgggaccga CRISPR spacer
gaggccaccgacaccaccgggtctggaacatc Protospacer
. .* *****************.**.**
746. spacer 1.69|1028395|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 10, identity: 0.688
gtgggcctggctccgaggttgttgacgtagtt CRISPR spacer
accggcgtggcgccgaggttgttgaccatgag Protospacer
.. *** **** ************** *
747. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
748. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
749. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
750. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
751. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
752. spacer 1.81|1024778|33|CP034170|CRT matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
753. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
754. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
755. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
756. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
757. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
758. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
759. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
760. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
761. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
762. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP026718 (Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
763. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 10, identity: 0.697
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
gcctgcgccgccggggtgcgcccggtgtagtcc Protospacer
. ************** ********.* .
764. spacer 1.91|1025400|33|CP034170|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.697
cactccgcagactcgcgggtcgggccaaacgtg CRISPR spacer
agcgaagcagagtcgcgggtcgggccgaacaaa Protospacer
.* ***** **************.***. .
765. spacer 1.99|1025890|33|CP034170|CRT matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgaactcagcggcgccaaggaaacggtttgtg CRISPR spacer
acgaagtcagcggcgacaaggaaaccgacgtcc Protospacer
.**** ********* ********* * . .
766. spacer 1.113|1026745|33|CP034170|CRT matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 10, identity: 0.697
gagccggttgagtttggcgagattgctttctgc CRISPR spacer
cagcgggttgaggttggcgagattggacgcctg Protospacer
*** ******* ************ . *.
767. spacer 1.116|1026928|33|CP034170|CRT matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
768. spacer 1.116|1026928|33|CP034170|CRT matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
769. spacer 1.116|1026928|33|CP034170|CRT matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
770. spacer 1.116|1026928|33|CP034170|CRT matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
771. spacer 1.116|1026928|33|CP034170|CRT matches to KP682374 (Escherichia phage PA8, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
772. spacer 1.116|1026928|33|CP034170|CRT matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
773. spacer 1.116|1026928|33|CP034170|CRT matches to NC_000924 (Enterobacteria phage 933W, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
774. spacer 1.116|1026928|33|CP034170|CRT matches to NC_049924 (Stx2-converting phage Stx2a_F451 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
775. spacer 1.116|1026928|33|CP034170|CRT matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
776. spacer 1.116|1026928|33|CP034170|CRT matches to KP682381 (Escherichia phage PA28, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
777. spacer 1.116|1026928|33|CP034170|CRT matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
778. spacer 1.116|1026928|33|CP034170|CRT matches to MG986485 (Escherichia phage SH2026Stx1, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
779. spacer 1.116|1026928|33|CP034170|CRT matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
780. spacer 1.116|1026928|33|CP034170|CRT matches to AF125520 (Bacteriophage 933W, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
781. spacer 1.116|1026928|33|CP034170|CRT matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
782. spacer 1.116|1026928|33|CP034170|CRT matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
783. spacer 1.116|1026928|33|CP034170|CRT matches to KU238070 (Stx converting phage vB_EcoS_ST2-8624, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
784. spacer 1.116|1026928|33|CP034170|CRT matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
785. spacer 1.116|1026928|33|CP034170|CRT matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
786. spacer 1.116|1026928|33|CP034170|CRT matches to AP012533 (Stx2-converting phage Stx2a_F723 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
787. spacer 1.116|1026928|33|CP034170|CRT matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
788. spacer 1.116|1026928|33|CP034170|CRT matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
789. spacer 1.116|1026928|33|CP034170|CRT matches to MT225101 (Escherichia phage Lys19259Vzw, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
790. spacer 1.116|1026928|33|CP034170|CRT matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
791. spacer 1.116|1026928|33|CP034170|CRT matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
792. spacer 1.116|1026928|33|CP034170|CRT matches to KU977419 (Stx1 converting phage AU5Stx1, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
793. spacer 1.116|1026928|33|CP034170|CRT matches to JQ011318 (Escherichia phage TL-2011c, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
794. spacer 1.116|1026928|33|CP034170|CRT matches to AP004402 (Stx2 converting phage I DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
795. spacer 1.116|1026928|33|CP034170|CRT matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
796. spacer 1.116|1026928|33|CP034170|CRT matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
797. spacer 1.116|1026928|33|CP034170|CRT matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
798. spacer 1.116|1026928|33|CP034170|CRT matches to HM208303 (Stx2 converting phage vB_EcoP_24B, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
799. spacer 1.116|1026928|33|CP034170|CRT matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
800. spacer 1.116|1026928|33|CP034170|CRT matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
801. spacer 1.116|1026928|33|CP034170|CRT matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
802. spacer 1.116|1026928|33|CP034170|CRT matches to AP012534 (Stx2-converting phage Stx2a_F765 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
803. spacer 1.116|1026928|33|CP034170|CRT matches to HQ424691 (Enterobacteria phage VT2phi_272, complete sequence) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
804. spacer 1.116|1026928|33|CP034170|CRT matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
805. spacer 1.116|1026928|33|CP034170|CRT matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
806. spacer 1.116|1026928|33|CP034170|CRT matches to NC_049923 (Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
807. spacer 1.116|1026928|33|CP034170|CRT matches to KU977420 (Stx1 converting phage AU6Stx1, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
808. spacer 1.116|1026928|33|CP034170|CRT matches to KP682371 (Escherichia phage PA2, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
809. spacer 1.116|1026928|33|CP034170|CRT matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
810. spacer 1.116|1026928|33|CP034170|CRT matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
811. spacer 1.116|1026928|33|CP034170|CRT matches to NC_049925 (Stx converting phage vB_EcoS_P27, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
812. spacer 1.116|1026928|33|CP034170|CRT matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
813. spacer 1.116|1026928|33|CP034170|CRT matches to NC_010237 (Enterobacteria phage Min27, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
814. spacer 1.116|1026928|33|CP034170|CRT matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
815. spacer 1.116|1026928|33|CP034170|CRT matches to AP012529 (Stx2-converting phage Stx2a_F403 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
816. spacer 1.116|1026928|33|CP034170|CRT matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
817. spacer 1.116|1026928|33|CP034170|CRT matches to NC_049917 (Escherichia phage Lys12581Vzw, complete genome) position: , mismatch: 10, identity: 0.697
tatcggccaacaggtccggctggaccgaccgag CRISPR spacer
acggggccagcaggtccggctgggccgaagggt Protospacer
*****.*************.**** *.
818. spacer 1.133|1027967|33|CP034170|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.697
acttgctgcgccgcgtcgaggcggccgtcgccg CRISPR spacer
gtctctggcgccgcggcgaggcggctgtcgcaa Protospacer
...* . ******** *********.***** .
819. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 11, identity: 0.656
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
cccgcgacggcggcggacctggcggccagcct Protospacer
****** ********.******* ..
820. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
cccgccacggcggcggacttggcggccagcct Protospacer
** *** **************** ..
821. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NC_016907 (Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence) position: , mismatch: 11, identity: 0.656
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
gcaccgacgtcggcggactcgccggcggtccg Protospacer
. . ***************.* ***** . .
822. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
cccgccacggcggcggacttggcggccagcct Protospacer
** *** **************** ..
823. spacer 1.5|1024474|32|CP034170|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656
agggcgacgtcggcggacttggcggcgtcgtc CRISPR spacer
cccgccacggcggcggacttggcggccagcct Protospacer
** *** **************** ..
824. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 11, identity: 0.656
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
accggcgccgccggggaggccgcggttcccac Protospacer
. ************* **** **** . ..
825. spacer 1.10|1024778|32|CP034170|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 11, identity: 0.656
ttgggcgccgccggggtggccccggtgtgggt CRISPR spacer
accggcgccgccggggaggccgcggttcccac Protospacer
. ************* **** **** . ..
826. spacer 1.42|1026745|32|CP034170|CRISPRCasFinder matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
gagccggttgagtttggcgagattgctttctg CRISPR spacer
cggcaggttgagtttggcgagcttggcaatga Protospacer
.** **************** *** . . .
827. spacer 1.51|1027294|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 11, identity: 0.656
tgaaatgagttcaccaccgaccaccaacacct CRISPR spacer
ctcccccgcttcaccaccgacctccagcacct Protospacer
. . . ************* ***.*****
828. spacer 1.51|1027294|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 11, identity: 0.656
tgaaatgagttcaccaccgaccaccaacacct CRISPR spacer
accccccgcttcaccaccgacctccagcacct Protospacer
. . ************* ***.*****
829. spacer 1.51|1027294|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 11, identity: 0.656
tgaaatgagttcaccaccgaccaccaacacct CRISPR spacer
ctcccccgcttcaccaccgacctccaccacct Protospacer
. . . ************* *** *****
830. spacer 1.51|1027294|32|CP034170|CRISPRCasFinder,PILER-CR matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 11, identity: 0.656
tgaaatgagttcaccaccgaccaccaacacct CRISPR spacer
ctcccccgcttcaccaccgacctccagcacct Protospacer
. . . ************* ***.*****
831. spacer 1.71|1028517|32|CP034170|CRISPRCasFinder,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 11, identity: 0.656
cattccgcagactcgcgggtcggcccgaaggt CRISPR spacer
agcgaagcagagtcgcgggtcgggccgaacaa Protospacer
.. ***** *********** ***** .
832. spacer 1.81|1024778|33|CP034170|CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 11, identity: 0.667
ttgggcgccgccggggtggccccggtgtgggta CRISPR spacer
agcggcgcgggcggggtggccccggtgatctcg Protospacer
***** * **************** ..
833. spacer 1.123|1027355|34|CP034170|CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 11, identity: 0.676
gagttctttcaccgtcaccgacccgaacgtgccg CRISPR spacer
cccggctttcaccgtcgccgaccagaacgacctt Protospacer
***********.****** ***** *.
834. spacer 1.123|1027355|34|CP034170|CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 11, identity: 0.676
gagttctttcaccgtcaccgacccgaacgtgccg CRISPR spacer
cccggctttcaccgtcgccgaccagaacgacctt Protospacer
***********.****** ***** *.
835. spacer 1.123|1027355|34|CP034170|CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
gagttctttcaccgtcaccgacccgaacgtgccg CRISPR spacer
cccaaccatcaccgtcaccgacccgaaactgctt Protospacer
*. ******************* ***.
836. spacer 1.127|1027601|33|CP034170|CRT matches to NC_008341 (Nitrosomonas eutropha C91 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.667
ggatcaatagatgcgaccatgcgatccccgagg CRISPR spacer
taataaatagatacgaccatgcgatcatgttta Protospacer
.** *******.************* . .
