Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034118 Thermoactinomycetaceae bacterium SCSIO 07575 chromosome, complete genome 17 crisprs NA 0 4 0 0
CP034119 Thermoactinomycetaceae bacterium SCSIO 07575 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP034118
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_1 614992-615543 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_2 2010970-2011148 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_3 2012977-2013079 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_4 2388714-2388815 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_5 2405654-2405886 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_6 2406140-2406714 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_8 2407490-2407589 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_7 2406956-2407391 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_10 2408728-2408825 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_11 2409014-2409111 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_9 2407843-2408474 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_12 2409365-2409600 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_13 2409926-2410294 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_15 2411296-2411393 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_14 2410548-2411041 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_16 2454616-2454708 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034118_17 2458989-2459152 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034118_14 14.5|2410846|31|CP034118|CRISPRCasFinder,PILER-CR 2410846-2410876 31 NZ_CP034119 Staphylospora marina strain SCSIO 07575 plasmid unnamed, complete sequence 4050-4080 4 0.871
CP034118_7 7.7|2407192|32|CP034118|PILER-CR 2407192-2407223 32 NZ_CP013914 Serratia fonticola strain GS2 plasmid pSF001, complete sequence 94146-94177 8 0.75
CP034118_9 9.3|2408011|32|CP034118|CRISPRCasFinder,CRT 2408011-2408042 32 NZ_CP021839 Anoxybacillus flavithermus strain 52-1A plasmid unnamed, complete sequence 5910-5941 8 0.75
CP034118_5 5.1|2405685|35|CP034118|CRISPRCasFinder 2405685-2405719 35 NC_015513 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence 36070-36104 9 0.743

1. spacer 14.5|2410846|31|CP034118|CRISPRCasFinder,PILER-CR matches to NZ_CP034119 (Staphylospora marina strain SCSIO 07575 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

cggcgccacgtccacctcatacgaaagctgt	CRISPR spacer
gagcgcaacgtccacctcatacgaaagctga	Protospacer
 .**** *********************** 

2. spacer 7.7|2407192|32|CP034118|PILER-CR matches to NZ_CP013914 (Serratia fonticola strain GS2 plasmid pSF001, complete sequence) position: , mismatch: 8, identity: 0.75

ccagccgatcagcattggtcatccagggcatt	CRISPR spacer
ccggccgaccagcattggtcatcaaacggacg	Protospacer
**.*****.************** *. * *. 

3. spacer 9.3|2408011|32|CP034118|CRISPRCasFinder,CRT matches to NZ_CP021839 (Anoxybacillus flavithermus strain 52-1A plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gattgagaaggccatggatcgtttgaagccgg	CRISPR spacer
catcgccaagcccagggatcgtttgaagccat	Protospacer
 **.*  *** *** ***************. 

4. spacer 5.1|2405685|35|CP034118|CRISPRCasFinder matches to NC_015513 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence) position: , mismatch: 9, identity: 0.743

caacccttcccgattccctaccaccatccagttaa	CRISPR spacer
aagaacgccccgattcccaaccatcatccagttga	Protospacer
 *.  * .********** ****.*********.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage