Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034057 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed4, complete sequence 0 crisprs DEDDh 0 0 1 0
CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1 crisprs RT,c2c9_V-U4,cas14j,DinG 0 10 1 0
CP034053 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 chromosome, complete genome 3 crisprs WYL,RT,csa3,cas3,DEDDh,DinG,cas8e,cse2gr11,cas6e,cas7,cas5,cas1,cas2 0 26 3 0
CP034055 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed2, complete sequence 0 crisprs DEDDh 0 0 2 0
CP034056 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. CP034056
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1796 : 48300 46 Escherichia_phage(31.25%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034054
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034054_1 188374-189005 Orphan NA
10 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034054_1 1.1|188397|38|CP034054|CRISPRCasFinder 188397-188434 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323395-323432 0 1.0
CP034054_1 1.1|188397|38|CP034054|CRISPRCasFinder 188397-188434 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33738-33775 0 1.0
CP034054_1 1.1|188397|38|CP034054|CRISPRCasFinder 188397-188434 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188397-188434 0 1.0
CP034054_1 1.1|188397|38|CP034054|CRISPRCasFinder 188397-188434 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283734-283771 0 1.0
CP034054_1 1.1|188397|38|CP034054|CRISPRCasFinder 188397-188434 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33739-33776 0 1.0
CP034054_1 1.2|188458|38|CP034054|CRISPRCasFinder 188458-188495 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188458-188495 0 1.0
CP034054_1 1.2|188458|38|CP034054|CRISPRCasFinder 188458-188495 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283795-283832 0 1.0
CP034054_1 1.3|188519|38|CP034054|CRISPRCasFinder 188519-188556 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323334-323371 0 1.0
CP034054_1 1.3|188519|38|CP034054|CRISPRCasFinder 188519-188556 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33677-33714 0 1.0
CP034054_1 1.3|188519|38|CP034054|CRISPRCasFinder 188519-188556 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33678-33715 0 1.0
CP034054_1 1.3|188519|38|CP034054|CRISPRCasFinder 188519-188556 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188519-188556 0 1.0
CP034054_1 1.3|188519|38|CP034054|CRISPRCasFinder 188519-188556 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283856-283893 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305346-305383 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148548-148585 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33238-33275 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7711-7748 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25558-25595 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 6001-6038 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323273-323310 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33616-33653 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16787-16824 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31069-31106 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8537-8574 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26219-26256 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34304-34341 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31126-31163 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33238-33275 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 137946-137983 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8721-8758 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30876-30913 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31187-31224 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141888-141925 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94797-94834 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264168-264205 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127146-127183 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38474-38511 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242619-242656 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116690-116727 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 31006-31043 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168963-169000 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188580-188617 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61500-61537 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253471-253508 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30876-30913 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283917-283954 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33238-33275 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103138-103175 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55656-55693 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49619-49656 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33617-33654 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43936-43973 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99477-99514 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84148-84185 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29486-29523 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33203-33240 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131230-131267 0 1.0
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131314-131351 0 1.0
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188641-188677 0 1.0
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283978-284014 0 1.0
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323213-323249 0 1.0
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33556-33592 0 1.0
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33557-33593 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305467-305504 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148669-148706 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7832-7869 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16908-16945 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138067-138104 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11077-11114 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277006-277043 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240159-240196 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142009-142046 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94918-94955 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127267-127304 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116811-116848 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188701-188738 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284038-284075 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99598-99635 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84269-84306 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29607-29644 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33117-33154 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25437-25474 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5880-5917 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323153-323190 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33496-33533 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30948-30985 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325824-325861 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8416-8453 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158902-158939 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26098-26135 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34183-34220 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31005-31042 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33117-33154 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8601-8638 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30755-30792 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115725-115762 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31066-31103 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264047-264084 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30885-30922 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168842-168879 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61379-61416 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30755-30792 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33117-33154 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103017-103054 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55535-55572 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49498-49535 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33497-33534 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43815-43852 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33082-33119 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131109-131146 0 1.0
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131193-131230 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148977-149014 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8140-8177 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25129-25166 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5572-5609 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322788-322825 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33131-33168 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17155-17192 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30640-30677 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8170-8207 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138376-138413 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8356-8393 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277314-277351 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30758-30795 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95226-95263 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127575-127612 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38109-38146 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242984-243021 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117119-117156 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188762-188799 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61071-61108 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253836-253873 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284099-284136 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102709-102746 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55227-55264 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49190-49227 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33132-33169 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43569-43606 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99967-100004 0 1.0
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84698-84735 0 1.0
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188823-188860 0 1.0
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284160-284197 0 1.0
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188884-188921 0 1.0
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284221-284258 0 1.0
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 144420-144457 0 1.0
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188945-188982 0 1.0
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284282-284319 0 1.0
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 321938-321975 0 1.0
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32281-32318 0 1.0
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32282-32319 0 1.0
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305407-305443 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148609-148645 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7772-7808 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16848-16884 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138007-138043 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141949-141985 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94858-94894 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127207-127243 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242680-242716 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116751-116787 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253531-253567 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99538-99574 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84209-84245 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29547-29583 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33178-33214 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25498-25534 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5941-5977 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31009-31045 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8477-8513 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26159-26195 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34244-34280 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31066-31102 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33178-33214 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8661-8697 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30816-30852 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31127-31163 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264108-264144 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38415-38451 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30946-30982 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168903-168939 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61440-61476 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30816-30852 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33178-33214 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103078-103114 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55596-55632 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49559-49595 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43876-43912 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33143-33179 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131170-131206 1 0.973
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131254-131290 1 0.973
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242740-242777 1 0.974
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253591-253628 1 0.974
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38354-38391 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305651-305688 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17216-17253 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142193-142230 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243045-243082 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253896-253933 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100028-100065 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32933-32970 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8109-8146 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25914-25951 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33999-34036 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30821-30858 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32933-32970 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8295-8332 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30571-30608 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38049-38086 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168658-168695 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30571-30608 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32933-32970 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43508-43545 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32898-32935 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130925-130962 1 0.974
CP034054_1 1.9|188884|38|CP034054|CRISPRCasFinder 188884-188921 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131009-131046 1 0.974
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 33860-33897 3 0.921
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 13799-13836 3 0.921
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 52974-53011 3 0.921
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 43336-43373 3 0.921
CP034054_1 1.2|188458|38|CP034054|CRISPRCasFinder 188458-188495 38 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 24877-24914 4 0.895
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 207770-207807 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 31240-31277 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 82660-82697 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 33172-33209 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 48421-48458 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 97843-97880 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 82461-82498 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 86901-86938 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 74839-74876 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 41811-41848 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 43589-43626 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 28133-28170 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 52589-52626 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 229833-229870 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 74657-74694 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 45895-45932 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 103950-103987 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 65165-65202 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 79869-79906 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 57571-57608 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 134255-134292 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 33815-33852 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 4456-4493 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 33294-33331 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 57579-57616 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 1753-1790 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 76827-76864 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 45896-45933 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 68479-68516 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 132006-132043 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 59490-59527 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 139155-139192 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 68664-68701 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 85827-85864 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 76959-76996 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 80664-80701 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 45896-45933 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 105428-105465 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 86845-86882 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 110468-110505 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 121518-121555 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 86333-86370 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 91348-91385 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 22644-22681 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 85420-85457 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 23116-23153 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 218554-218591 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 18286-18323 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 68688-68725 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 60878-60915 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 21451-21488 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 66898-66935 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 25993-26030 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 141757-141794 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 117454-117491 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 51464-51501 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 127976-128013 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 48637-48674 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 102977-103014 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 69755-69792 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 91986-92023 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MH909340 Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence 63426-63463 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 86747-86784 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 189340-189377 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MK413718 Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence 31103-31140 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 47665-47702 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 65622-65659 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 51252-51289 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 78979-79016 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 41740-41777 4 0.895
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 165583-165620 4 0.895
CP034054_1 1.3|188519|38|CP034054|CRISPRCasFinder 188519-188556 38 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 27502-27539 5 0.868
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 20779-20816 5 0.868
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 113092-113129 5 0.868
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 79296-79333 5 0.868
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 74602-74639 5 0.868
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 109297-109334 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 120858-120895 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 54839-54876 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 112789-112826 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 48330-48367 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 92255-92292 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 38869-38906 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 77735-77772 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 113916-113953 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 93024-93061 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 118773-118810 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 92715-92752 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 97289-97326 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 66363-66400 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 72589-72626 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 109754-109791 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 141100-141137 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 49988-50025 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 10389-10426 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 67056-67093 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 180768-180805 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 49664-49701 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 78618-78655 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 119470-119507 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 131827-131864 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 141723-141760 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 140481-140518 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 161768-161805 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 79073-79110 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 355222-355259 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 102815-102852 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 261218-261255 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 10389-10426 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 130743-130780 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 10971-11008 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 45963-46000 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 144078-144115 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 122289-122326 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 52690-52727 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 105524-105561 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 44169-44206 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 46427-46464 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 73070-73107 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 59573-59610 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 71764-71801 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 136640-136677 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 131827-131864 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 116359-116396 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 66895-66932 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 123788-123825 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 76952-76989 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 133687-133724 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 129473-129510 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 65168-65205 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 54818-54855 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 108020-108057 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 117897-117934 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 79807-79844 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 32727-32764 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 69268-69305 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 87769-87806 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP046943 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4 14308-14345 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 57455-57492 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 173223-173260 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 46427-46464 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 73069-73106 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 109759-109796 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 175127-175164 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 186301-186338 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 123796-123833 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 144306-144343 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 69268-69305 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 135791-135828 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 47419-47456 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 66816-66853 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 153292-153329 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 170314-170351 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 31259-31296 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015754 Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence 110669-110706 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 195824-195861 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 24046-24083 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 67843-67880 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 70561-70598 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 77517-77554 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 41407-41444 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 42973-43010 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026161 Klebsiella pneumoniae strain F93-1 plasmid pF93-1_1, complete sequence 164619-164656 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 153888-153925 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 122948-122985 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 46070-46107 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 7245-7282 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 63291-63328 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 66363-66400 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 47624-47661 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP016160 Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence 138557-138594 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 158011-158048 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 61637-61674 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 206572-206609 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 48918-48955 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 121836-121873 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 142462-142499 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 16615-16652 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 1277-1314 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 102591-102628 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 10671-10708 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 106756-106793 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 58453-58490 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 67150-67187 5 0.868
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 76315-76352 5 0.868
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 108001-108038 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 37094-37131 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 77872-77909 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 92501-92538 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 57431-57468 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 67176-67213 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 43631-43668 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP040995 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence 69076-69113 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 60370-60407 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 104966-105003 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 113808-113845 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 145888-145925 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 62268-62305 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 175980-176017 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 54452-54489 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 136615-136652 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 136935-136972 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 135693-135730 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 166556-166593 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 96524-96561 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 60377-60414 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 107603-107640 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 135531-135568 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 31523-31560 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 6183-6220 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 50751-50788 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 139290-139327 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 127077-127114 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 126275-126312 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 100194-100231 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 6517-6554 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 81589-81626 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 71048-71085 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 68282-68319 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 118313-118350 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 136615-136652 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 119000-119037 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 303963-304000 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 72164-72201 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 104599-104636 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 138475-138512 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 27939-27976 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 97820-97857 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 73595-73632 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 40221-40258 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 170380-170417 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 72171-72208 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 68281-68318 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 104971-105008 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 181513-181550 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 119008-119045 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 119635-119672 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 140579-140616 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 99780-99817 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 62028-62065 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 158080-158117 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 165526-165563 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 117959-117996 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 128459-128496 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 36047-36084 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 129929-129966 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032836 Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence 52308-52345 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 19258-19295 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 97201-97238 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 123087-123124 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 122056-122093 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 106260-106297 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 124308-124345 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 97595-97632 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 127736-127773 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 148951-148988 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 83350-83387 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 41476-41513 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 65666-65703 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 41282-41319 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 118818-118855 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 149483-149520 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 144010-144047 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 31523-31560 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 153223-153260 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 56849-56886 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 53706-53743 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 126624-126661 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 147250-147287 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 21403-21440 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 54492-54529 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 125604-125641 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 119156-119193 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MH909340 Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence 68214-68251 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK413718 Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence 35891-35928 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 56040-56077 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 74191-74228 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 171715-171752 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 170371-170408 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 120679-120716 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 92889-92926 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 81649-81686 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 63241-63278 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 62362-62399 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 81103-81140 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 7027-7064 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 36901-36938 6 0.842
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 115286-115322 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 177236-177272 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 90069-90105 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP042535 Citrobacter freundii strain E51 plasmid pE51_001, complete sequence 192274-192310 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 34184-34220 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 333135-333171 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 150840-150876 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 55456-55492 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 86401-86437 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP026720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence 73797-73833 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP018017 Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence 176079-176115 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 799-835 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 23252-23288 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 90712-90748 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 150302-150338 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 92587-92623 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 103804-103840 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 136785-136821 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 122973-123009 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 118750-118786 6 0.838
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 174398-174434 6 0.838
CP034054_1 1.6|188701|38|CP034054|CRISPRCasFinder 188701-188738 38 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 63077-63114 6 0.842
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 53913-53950 6 0.842
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 53975-54012 6 0.842
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 56243-56280 6 0.842
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 30261-30298 6 0.842
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 48467-48504 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 55680-55717 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 133504-133541 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 168936-168973 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 41192-41229 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 70366-70403 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 62189-62226 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 71934-71971 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 259546-259583 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 94135-94172 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 92421-92458 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 1431-1468 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 94135-94172 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 84609-84646 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 55612-55649 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 118566-118603 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 69638-69675 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 160080-160117 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 91777-91814 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 156086-156123 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 54509-54546 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 97947-97984 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 160979-161016 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 90517-90554 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 41214-41251 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 141314-141351 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 82492-82529 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 97281-97318 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 87472-87509 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 94136-94173 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 91766-91803 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 38944-38981 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 58373-58410 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 49378-49415 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 92735-92772 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MG700549 Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence 12667-12704 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MG700550 Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence 90401-90438 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 36281-36318 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 22123-22160 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 159442-159479 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 94961-94998 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 88318-88355 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 97945-97982 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 33903-33940 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 94136-94173 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 121517-121554 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 69731-69768 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 41186-41223 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 47764-47801 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 66290-66327 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 113555-113592 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 25632-25669 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 155978-156015 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 118260-118297 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 299205-299242 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 99841-99878 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 30810-30847 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 93479-93516 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 97947-97984 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 69878-69915 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 238707-238744 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 126422-126459 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 41383-41420 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 88466-88503 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 97947-97984 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 79639-79676 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 35463-35500 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 175138-175175 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 141966-142003 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 92774-92811 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028930 Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence 24439-24476 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 114877-114914 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 133617-133654 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP016922 Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence 6368-6405 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 135691-135728 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 70067-70104 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 104538-104575 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 102925-102962 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 248108-248145 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 158572-158609 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 133217-133254 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 125171-125208 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_AP018749 Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence 55259-55296 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 98160-98197 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 126843-126880 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 17759-17796 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 131805-131842 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 111018-111055 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 71836-71873 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_AP018751 Klebsiella pneumoniae strain KP64 plasmid pKP6401, complete sequence 54495-54532 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 74345-74382 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 126813-126850 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP006800 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p2, complete sequence 83438-83475 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 49581-49618 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 91782-91819 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 46264-46301 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 97950-97987 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 64637-64674 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 48395-48432 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 97930-97967 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 100355-100392 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 97948-97985 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 75500-75537 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 143949-143986 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 97948-97985 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 139252-139289 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 36281-36318 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 161242-161279 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 72015-72052 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 90867-90904 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 119652-119689 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018989 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_KPC, complete sequence 38200-38237 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 156016-156053 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 133466-133503 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 57151-57188 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 176473-176510 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 210061-210098 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY495890 Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence 21239-21276 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 183086-183123 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 125437-125474 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 145313-145350 6 0.842
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034407 Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence 57485-57522 6 0.842
CP034054_1 1.10|188945|38|CP034054|CRISPRCasFinder 188945-188982 38 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 11087-11124 6 0.842
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 97043-97080 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 79497-79534 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 34081-34118 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 72947-72984 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 173724-173761 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 109128-109165 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 88236-88273 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 113985-114022 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 45980-46017 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 65578-65615 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 28384-28421 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 264334-264371 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 89347-89384 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 87633-87670 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 7555-7592 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 89347-89384 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 102631-102668 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 98787-98824 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 77673-77710 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 91689-91726 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 30778-30815 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 61575-61612 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 70051-70088 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 45921-45958 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 37023-37060 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 67801-67838 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 165084-165121 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 48377-48414 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 23345-23382 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 121869-121906 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 168216-168253 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 74426-74463 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 196462-196499 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 155292-155329 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 86989-87026 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 54776-54813 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 5601-5638 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 160904-160941 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 93159-93196 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 165767-165804 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 47801-47838 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 225045-225082 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 79445-79482 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 60409-60446 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 195527-195564 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 41107-41144 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 71604-71641 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 108252-108289 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 73830-73867 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 114682-114719 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 39052-39089 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 7583-7620 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 93271-93308 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 85729-85766 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 46032-46069 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 53234-53271 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 136526-136563 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 77704-77741 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 92493-92530 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 82684-82721 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 128775-128812 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 99162-99199 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 31953-31990 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 195418-195455 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 81383-81420 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 89348-89385 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 83861-83898 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 135481-135518 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 360010-360047 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 121086-121123 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 63161-63198 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 70819-70856 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 44590-44627 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 87947-87984 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 266006-266043 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 5601-5638 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 226203-226240 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 45226-45263 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 47968-48005 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 26911-26948 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 75081-75118 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 90173-90210 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 93106-93143 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 62359-62396 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 39929-39966 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 139044-139081 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 153985-154022 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 93157-93194 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 70264-70301 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 29115-29152 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 38603-38640 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 89348-89385 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 47902-47939 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 9244-9281 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 38082-38119 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 74519-74556 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 62367-62404 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 45974-46011 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 233591-233628 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 42976-43013 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 39381-39418 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 41108-41145 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 41639-41676 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 64361-64398 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 71966-72003 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 66976-67013 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 179258-179295 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 41738-41775 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 131852-131889 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 20844-20881 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 123048-123085 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 121147-121184 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 71683-71720 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 200791-200828 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 189986-190023 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 63691-63728 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 26022-26059 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 88691-88728 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 93159-93196 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 206765-206802 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 127218-127255 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 64278-64315 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 98004-98041 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 124685-124722 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 37929-37966 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 132033-132070 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 65783-65820 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 60380-60417 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 114167-114204 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 50030-50067 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 1846-1883 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 74666-74703 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 233919-233956 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 102741-102778 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 190763-190800 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 131210-131247 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 194376-194413 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 112808-112845 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 64494-64531 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 63597-63634 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 78912-78949 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 46171-46208 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 149894-149931 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 73452-73489 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 94320-94357 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 93159-93196 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 149060-149097 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 74056-74093 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 92561-92598 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP046943 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4 9520-9557 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 42522-42559 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032181 Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence 53218-53255 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 62243-62280 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 74851-74888 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 126030-126067 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 90615-90652 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 137178-137215 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 61344-61381 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 178011-178048 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 73295-73332 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 85452-85489 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020064 Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence 41502-41539 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 41108-41145 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 41639-41676 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 189020-189057 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 170339-170376 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 138405-138442 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 82057-82094 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 195416-195453 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 111959-111996 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 105680-105717 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 194221-194258 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 140479-140516 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 41838-41875 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 149094-149131 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 74056-74093 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 52207-52244 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 153214-153251 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 107713-107750 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 116730-116767 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 145362-145399 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 252896-252933 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 163360-163397 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 121905-121942 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 50083-50120 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 202866-202903 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 217884-217921 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 15614-15651 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 102586-102623 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 204833-204870 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 155580-155617 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 126424-126461 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 191036-191073 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 81545-81582 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 93372-93409 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 189566-189603 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 73541-73578 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 72631-72668 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 17856-17893 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 90208-90245 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 18328-18365 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 216046-216083 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 153985-154022 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 131631-131668 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 12971-13008 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 67436-67473 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 75346-75383 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 223342-223379 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 72729-72766 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 199435-199472 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 131881-131918 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 109267-109304 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 33761-33798 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 38185-38222 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 76624-76661 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 79133-79170 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 122025-122062 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 192660-192697 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 199628-199665 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 149100-149137 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 179402-179439 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 44793-44830 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 86994-87031 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 114796-114833 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 93162-93199 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 101743-101780 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 84798-84835 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 49273-49310 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 23074-23111 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 194392-194429 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 51629-51666 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 63900-63937 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 16663-16700 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 204836-204873 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 71686-71723 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 43607-43644 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 93142-93179 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 95567-95604 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 93160-93197 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 45921-45958 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 2638-2675 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 30781-30818 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 136969-137006 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 81035-81072 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 93160-93197 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 28516-28553 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 2457-2494 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 58503-58540 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 61575-61612 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 52412-52449 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 207944-207981 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 122242-122279 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 99569-99606 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 211360-211397 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 156454-156491 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 76803-76840 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 86079-86116 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 46676-46713 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 234994-235031 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 71090-71127 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 124440-124477 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 151230-151267 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 283860-283897 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 6065-6102 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 132764-132801 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 107379-107416 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 184727-184764 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 138254-138291 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 5883-5920 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 98189-98226 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 117972-118009 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 127599-127636 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 64967-65004 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 96774-96811 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 38110-38147 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 61939-61976 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 215158-215195 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 81959-81996 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 194128-194165 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 42877-42914 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 70410-70447 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 101968-102005 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 178972-179009 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 36952-36989 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 95906-95943 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 206137-206174 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 156494-156531 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 67674-67711 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 205273-205310 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 55075-55112 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY495890 Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence 26027-26064 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 187874-187911 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG252894 Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence 121830-121867 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 232535-232572 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 89428-89465 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 183577-183614 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 55003-55040 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 140525-140562 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 59585-59622 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 53118-53155 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035637 Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence 56146-56183 7 0.816
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 57592-57629 7 0.816
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 84891-84928 7 0.816
CP034054_1 1.7|188762|38|CP034054|CRISPRCasFinder 188762-188799 38 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 28645-28682 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 150150-150187 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 113204-113241 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 127841-127878 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 72221-72258 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 126812-126849 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 129063-129100 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 102347-102384 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 123573-123610 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 160296-160333 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 127118-127155 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 173004-173041 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 191674-191711 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 190739-190776 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 34264-34301 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 190630-190667 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 125891-125928 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 221415-221452 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 44716-44753 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 149197-149234 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 65015-65052 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 228803-228840 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 67179-67216 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 174470-174507 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 196003-196040 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 185198-185235 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 201977-202014 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 92755-92792 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 42717-42754 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 180434-180471 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 97953-97990 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 185975-186012 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 189588-189625 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 69299-69336 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 83717-83754 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 93061-93098 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 121242-121279 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 66149-66186 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 78544-78581 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 184232-184269 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 200204-200241 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 189433-189470 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 46625-46662 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 147965-148002 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 198078-198115 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 213096-213133 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 200045-200082 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 150792-150829 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 184778-184815 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 78329-78366 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 220834-220871 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 149197-149234 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 194647-194684 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 39010-39047 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 197448-197485 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 194840-194877 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 174597-174634 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 144146-144183 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 110008-110045 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 89603-89640 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 189604-189641 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 111401-111438 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 200048-200085 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 7426-7463 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 33321-33358 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 203156-203193 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 104357-104394 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 230206-230243 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 75878-75915 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 69797-69834 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 289109-289146 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 179939-179976 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 13318-13355 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 114397-114434 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 210370-210407 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 183760-183797 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 114102-114139 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 101154-101191 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 201349-201386 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 72462-72499 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 50511-50548 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MG252894 Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence 117042-117079 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 227747-227784 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 94216-94253 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 188365-188402 7 0.816
CP034054_1 1.8|188823|38|CP034054|CRISPRCasFinder 188823-188860 38 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 59808-59845 7 0.816
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 326884-326921 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 97474-97511 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 75048-75085 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP015754 Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence 115428-115465 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 36620-36657 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 106868-106905 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP016160 Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence 143316-143353 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 6896-6933 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 179746-179783 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 46182-46219 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 89397-89434 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 44879-44916 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 95873-95910 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 140537-140574 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 123880-123917 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 16736-16773 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 105162-105199 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 59297-59334 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 104314-104351 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 193235-193272 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 139855-139892 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 172528-172565 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 275721-275758 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 143314-143351 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 14339-14376 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 143345-143382 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 12424-12461 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 138494-138531 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 34156-34193 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 104952-104989 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 107224-107261 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 19158-19195 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 138897-138934 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 156378-156415 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 102024-102061 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 140537-140574 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 164230-164267 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 136615-136652 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 11685-11722 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 115015-115052 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 143858-143895 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 151425-151462 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 11756-11793 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 163719-163756 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 72645-72682 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 108514-108551 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 170007-170044 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 103154-103191 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 151190-151227 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 165823-165860 8 0.789
CP034054_1 1.4|188580|38|CP034054|CRISPRCasFinder 188580-188617 38 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 190864-190901 8 0.789
CP034054_1 1.5|188641|37|CP034054|CRISPRCasFinder 188641-188677 37 NC_025028 Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence 41081-41117 12 0.676

1. spacer 1.1|188397|38|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccaatcctgcatcatcccctttggactgggcga	CRISPR spacer
gaataccaatcctgcatcatcccctttggactgggcga	Protospacer
**************************************

2. spacer 1.1|188397|38|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccaatcctgcatcatcccctttggactgggcga	CRISPR spacer
gaataccaatcctgcatcatcccctttggactgggcga	Protospacer
**************************************

3. spacer 1.1|188397|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccaatcctgcatcatcccctttggactgggcga	CRISPR spacer
gaataccaatcctgcatcatcccctttggactgggcga	Protospacer
**************************************

4. spacer 1.1|188397|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccaatcctgcatcatcccctttggactgggcga	CRISPR spacer
gaataccaatcctgcatcatcccctttggactgggcga	Protospacer
**************************************

5. spacer 1.1|188397|38|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccaatcctgcatcatcccctttggactgggcga	CRISPR spacer
gaataccaatcctgcatcatcccctttggactgggcga	Protospacer
**************************************

6. spacer 1.2|188458|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

taatactcctccaggccggtgcactgcctgtcaccatt	CRISPR spacer
taatactcctccaggccggtgcactgcctgtcaccatt	Protospacer
**************************************

7. spacer 1.2|188458|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

taatactcctccaggccggtgcactgcctgtcaccatt	CRISPR spacer
taatactcctccaggccggtgcactgcctgtcaccatt	Protospacer
**************************************

8. spacer 1.3|188519|38|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgtctgaagcgaatcctgatcacaatgcgtaa	CRISPR spacer
gaataccgtctgaagcgaatcctgatcacaatgcgtaa	Protospacer
**************************************

9. spacer 1.3|188519|38|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgtctgaagcgaatcctgatcacaatgcgtaa	CRISPR spacer
gaataccgtctgaagcgaatcctgatcacaatgcgtaa	Protospacer
**************************************

10. spacer 1.3|188519|38|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgtctgaagcgaatcctgatcacaatgcgtaa	CRISPR spacer
gaataccgtctgaagcgaatcctgatcacaatgcgtaa	Protospacer
**************************************

11. spacer 1.3|188519|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgtctgaagcgaatcctgatcacaatgcgtaa	CRISPR spacer
gaataccgtctgaagcgaatcctgatcacaatgcgtaa	Protospacer
**************************************

12. spacer 1.3|188519|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgtctgaagcgaatcctgatcacaatgcgtaa	CRISPR spacer
gaataccgtctgaagcgaatcctgatcacaatgcgtaa	Protospacer
**************************************

13. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

14. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

15. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

16. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

17. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

18. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

19. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

20. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

21. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

22. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

23. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

24. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

25. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

26. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

27. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

28. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

29. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

30. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

31. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

32. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

33. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

34. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

35. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

36. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

37. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

38. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

39. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

40. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

41. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

42. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

43. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

44. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

45. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

46. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

47. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

48. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

49. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

50. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

51. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

52. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

53. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

54. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

55. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

56. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

57. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gaatacgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
**************************************

58. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gaatacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
*************************************

59. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gaatacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
*************************************

60. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gaatacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
*************************************

61. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gaatacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
*************************************

62. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gaatacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
*************************************

63. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

64. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

65. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

66. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

67. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

68. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

69. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

70. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

71. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

72. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

73. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

74. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

75. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

76. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

77. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

78. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

79. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

80. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

81. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

82. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

83. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

84. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

85. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

86. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

87. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

88. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

89. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

90. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

91. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

92. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

93. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

94. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

95. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

96. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

97. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

98. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

99. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

100. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

101. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

102. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

103. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

104. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

105. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

106. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

107. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

108. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

109. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

110. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcctgggcaccgggtcgg	Protospacer
**************************************

111. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

112. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

113. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

114. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

115. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

116. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

117. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

118. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

119. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

120. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

121. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

122. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

123. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

124. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

125. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

126. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

127. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

128. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

129. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

130. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

131. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

132. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

133. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

134. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

135. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

136. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

137. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

138. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

139. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gaatacctgcactgcctgtcactattcctcgaactgct	Protospacer
**************************************

140. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
aaatacgccgccgacgtgaatggcgacatgaataactt	Protospacer
**************************************

141. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
aaatacgccgccgacgtgaatggcgacatgaataactt	Protospacer
**************************************

142. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaagatttgctgattta	Protospacer
**************************************

143. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaagatttgctgattta	Protospacer
**************************************

144. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
gaatacccctccggcatcacactgcccggcggagagaa	Protospacer
**************************************

145. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
gaatacccctccggcatcacactgcccggcggagagaa	Protospacer
**************************************

146. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
gaatacccctccggcatcacactgcccggcggagagaa	Protospacer
**************************************

147. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
gaatacccctccggcatcacactgcccggcggagagaa	Protospacer
**************************************

148. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
gaatacccctccggcatcacactgcccggcggagagaa	Protospacer
**************************************

149. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
gaatacccctccggcatcacactgcccggcggagagaa	Protospacer
**************************************

150. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

151. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

152. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

153. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

154. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

155. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

156. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

157. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

158. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

159. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

160. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

161. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

162. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

163. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

164. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

165. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

166. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

167. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

168. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

169. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

170. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

171. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

172. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

173. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

174. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

175. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

176. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

177. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

178. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

179. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

180. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

181. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

182. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

183. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

184. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

185. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

186. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

187. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

188. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

189. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.973

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
gagtacgtggcgaccaccagcgtcttagtgcagggaa	Protospacer
**.**********************************

190. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcccgggcaccgggtcgg	Protospacer
***********************.**************

191. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.974

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcccgggcaccgggtcgg	Protospacer
***********************.**************

192. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.974

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
gaatactattcagccagttctcccgggcaccgggtcgg	Protospacer
***********************.**************

193. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

194. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

195. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

196. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

197. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

198. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

199. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

200. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

201. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

202. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

203. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

204. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

205. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

206. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

207. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

208. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

209. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

210. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

211. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

212. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

213. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

214. spacer 1.9|188884|38|CP034054|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.974

gaataccgacacggtagacaacaagatttgctgattta	CRISPR spacer
gaataccgacacggtagacaacaatatttgctgattta	Protospacer
************************ *************

215. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 3, identity: 0.921

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
aaaaatccctccggcatcacactgcccggcggagagaa	Protospacer
.** *.********************************

216. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.921

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
aaaaatccctccggcatcacactgcccggcggagagaa	Protospacer
.** *.********************************

217. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 3, identity: 0.921

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
aaaaatccctccggcatcacactgcccggcggagagaa	Protospacer
.** *.********************************

218. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.921

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
aaaaatccctccggcatcacactgcccggcggagagaa	Protospacer
.** *.********************************

219. spacer 1.2|188458|38|CP034054|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 4, identity: 0.895

taatactcctccaggccggtgcactgcctgtcaccatt	CRISPR spacer
gcaaaatcctccaggccggtgcactgcctgtcaccatt	Protospacer
  * * ********************************

220. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.895

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
agatggtattcagccagttctcctgggcaccgggtcgg	Protospacer
..**. ********************************

221. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

222. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

223. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

224. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

225. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

226. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

227. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

228. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

229. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

230. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

231. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

232. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

233. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

234. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

235. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

236. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

237. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

238. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

239. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

240. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

241. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

242. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

243. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

244. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

245. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

246. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

247. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

248. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

249. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

250. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

251. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

252. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

253. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

254. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

255. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

256. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

257. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

258. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

259. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

260. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

261. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

262. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

263. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

264. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

265. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

266. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

267. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

268. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

269. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

270. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

271. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

272. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

273. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

274. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

275. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

276. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

277. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

278. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

279. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

280. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

281. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

282. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

283. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

284. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

285. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

286. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

287. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

288. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

289. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

290. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 4, identity: 0.895

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
*.   *********************************

291. spacer 1.3|188519|38|CP034054|CRISPRCasFinder matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 5, identity: 0.868

gaataccgtctgaagcgaatcctgatcacaatgcgtaa	CRISPR spacer
ggccagcgtctgaagcgaatcccgatcacaatgcgtaa	Protospacer
*. .* ****************.***************

292. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.868

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
*    .********************************

293. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.868

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
*    .********************************

294. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 5, identity: 0.868

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
*    .********************************

295. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
*    .********************************

296. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 5, identity: 0.868

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
*    .********************************

297. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
gctgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
.    *********************************

298. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
gctgccgccgccgacgtgaatggcgacatgaataactt	Protospacer
.    *********************************

299. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

300. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

301. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

302. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

303. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

304. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

305. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

306. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

307. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

308. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

309. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

310. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

311. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

312. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

313. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

314. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

315. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

316. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

317. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

318. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

319. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

320. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

321. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

322. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

323. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

324. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

325. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

326. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

327. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

328. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

329. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

330. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

331. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

332. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

333. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

334. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

335. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
accaccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*    *********.***********************

336. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

337. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

338. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

339. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

340. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

341. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

342. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

343. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

344. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

345. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

346. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

347. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

348. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

349. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

350. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

351. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

352. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

353. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

354. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

355. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

356. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

357. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP046943 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

358. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

359. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

360. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

361. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

362. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

363. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

364. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

365. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

366. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

367. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

368. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

369. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

370. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

371. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

372. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

373. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

374. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015754 (Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

375. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

376. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

377. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

378. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

379. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

380. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

381. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

382. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026161 (Klebsiella pneumoniae strain F93-1 plasmid pF93-1_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

383. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

384. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

385. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

386. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

387. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

388. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

389. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

390. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP016160 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

391. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

392. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

393. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

394. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

395. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

396. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

397. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

398. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

399. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

400. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

401. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

402. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

403. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

404. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgatgtgaatggcgacatgaataactt	Protospacer
*.   *********.***********************

405. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

406. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

407. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

408. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

409. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

410. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

411. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

412. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

413. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

414. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

415. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

416. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

417. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

418. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

419. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

420. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

421. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

422. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

423. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

424. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

425. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

426. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

427. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

428. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

429. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

430. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

431. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

432. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

433. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

434. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

435. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

436. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

437. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

438. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

439. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

440. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

441. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

442. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

443. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

444. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

445. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

446. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

447. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

448. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

449. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

450. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

451. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

452. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

453. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

454. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

455. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

456. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

457. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

458. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

459. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

460. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

461. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

462. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

463. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

464. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

465. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

466. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

467. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

468. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

469. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

470. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

471. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

472. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

473. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

474. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

475. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

476. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

477. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

478. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

479. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

480. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

481. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

482. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

483. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

484. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

485. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

486. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

487. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

488. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

489. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

490. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

491. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

492. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

493. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

494. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

495. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

496. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

497. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

498. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

499. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

500. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

501. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

502. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

503. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

504. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccgg	Protospacer
.    .********************************

505. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
*    .***************************.****

506. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
*    .***************************.****

507. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

508. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

509. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

510. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP042535 (Citrobacter freundii strain E51 plasmid pE51_001, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

511. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

512. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

513. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

514. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

515. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

516. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP026720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

517. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP018017 (Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

518. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

519. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

520. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

521. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

522. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

523. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

524. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

525. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

526. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

527. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.838

---gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tcggtat---tggcgatcaccagcgtcttagtgcaaggaa	Protospacer
   * **   ******.******************.****

528. spacer 1.6|188701|38|CP034054|CRISPRCasFinder matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatactattcagccagttctcctgggcaccgggtcgg	CRISPR spacer
agatggtgttcagccagttctcctgggcaccgggtcga	Protospacer
..**. *.*****************************.

529. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
*...  **************************** ***

530. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
*...  **************************** ***

531. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
*...  **************************** ***

532. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
*...  **************************** ***

533. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
gggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
*...  **************************** ***

534. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
gctgccgccgccgacgtgaatgtcgacatgaataactt	Protospacer
.    ***************** ***************

535. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
gctgccgccgccgacgtgaatgtcgacatgaataactt	Protospacer
.    ***************** ***************

536. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

537. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

538. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

539. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

540. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

541. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

542. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

543. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

544. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

545. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

546. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

547. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

548. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

549. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

550. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

551. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

552. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

553. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

554. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

555. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

556. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

557. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

558. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

559. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

560. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

561. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

562. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

563. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

564. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

565. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

566. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

567. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

568. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

569. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

570. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

571. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

572. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

573. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

574. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

575. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

576. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

577. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

578. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

579. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

580. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

581. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

582. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

583. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

584. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

585. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

586. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

587. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

588. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

589. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

590. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

591. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

592. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

593. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

594. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

595. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

596. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

597. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

598. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

599. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

600. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

601. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

602. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

603. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

604. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

605. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

606. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

607. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

608. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

609. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

610. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

611. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

612. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

613. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

614. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

615. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_AP018749 (Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

616. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

617. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

618. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

619. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

620. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

621. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

622. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_AP018751 (Klebsiella pneumoniae strain KP64 plasmid pKP6401, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

623. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

624. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

625. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP006800 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

626. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

627. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

628. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

629. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

630. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

631. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

632. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

633. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

634. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

635. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

636. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

637. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

638. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

639. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

640. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

641. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

642. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

643. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

644. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018989 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

645. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

646. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

647. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

648. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

649. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

650. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

651. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

652. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

653. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

654. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 6, identity: 0.842

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgccgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   *********************.*****.*****

655. spacer 1.10|188945|38|CP034054|CRISPRCasFinder matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gaatacccctccggcatcacactgcccggcggagagaa	CRISPR spacer
aagaatccctccggcatcacactacccggcggggagaa	Protospacer
.*. *.*****************.********.*****

656. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

657. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

658. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

659. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

660. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

661. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

662. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

663. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

664. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

665. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

666. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

667. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

668. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

669. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

670. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

671. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

672. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

673. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

674. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

675. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

676. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

677. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

678. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

679. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

680. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

681. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

682. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

683. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

684. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

685. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

686. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

687. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

688. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

689. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

690. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

691. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

692. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

693. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

694. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

695. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

696. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

697. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

698. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

699. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

700. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

701. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

702. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

703. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

704. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

705. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

706. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

707. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

708. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

709. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

710. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

711. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

712. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

713. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

714. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

715. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

716. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

717. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

718. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

719. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

720. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

721. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

722. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

723. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

724. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

725. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

726. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

727. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

728. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

729. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

730. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

731. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

732. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

733. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

734. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

735. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

736. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

737. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

738. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

739. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

740. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

741. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

742. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

743. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

744. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

745. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

746. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

747. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

748. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

749. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

750. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

751. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

752. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

753. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

754. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

755. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

756. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

757. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

758. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

759. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

760. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

761. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

762. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

763. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

764. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

765. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

766. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

767. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

768. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

769. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

770. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

771. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

772. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

773. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

774. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

775. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

776. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

777. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

778. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

779. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

780. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

781. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

782. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

783. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

784. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

785. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

786. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

787. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

788. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

789. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

790. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

791. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

792. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

793. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

794. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

795. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

796. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

797. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

798. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

799. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

800. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

801. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

802. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

803. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

804. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

805. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP046943 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

806. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

807. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032181 (Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

808. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

809. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

810. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

811. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

812. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

813. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

814. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

815. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

816. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

817. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

818. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

819. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

820. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

821. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

822. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

823. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

824. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

825. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

826. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

827. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

828. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

829. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

830. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

831. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

832. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

833. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

834. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

835. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

836. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

837. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

838. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

839. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

840. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

841. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

842. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

843. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

844. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

845. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

846. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

847. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

848. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

849. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

850. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

851. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

852. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

853. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

854. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

855. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

856. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

857. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

858. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

859. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

860. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

861. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

862. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

863. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

864. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

865. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

866. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

867. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

868. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

869. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

870. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

871. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

872. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

873. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

874. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

875. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

876. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

877. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

878. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

879. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

880. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

881. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

882. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

883. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

884. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

885. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

886. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

887. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

888. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

889. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

890. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

891. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

892. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

893. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

894. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

895. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

896. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

897. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

898. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

899. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

900. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

901. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

902. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

903. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

904. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

905. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

906. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

907. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

908. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

909. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

910. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

911. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

912. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

913. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

914. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

915. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

916. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

917. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

918. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

919. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

920. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

921. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

922. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

923. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

924. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

925. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

926. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

927. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

928. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

929. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

930. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

931. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

932. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

933. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

934. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

935. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

936. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

937. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

938. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

939. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

940. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

941. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

942. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

943. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

944. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

945. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

946. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

947. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

948. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

949. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

950. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

951. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

952. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgagccgg	Protospacer
.    .***************************.****

953. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .******************************.*

954. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgccctgcacctgtttcgcaaaatacgaaccgg	Protospacer
.    .*********************** ********

955. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
gccatttccctgcacctgtttcgcaaaatccgaaccag	Protospacer
*    . *****************************.*

956. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
tcccccgccctggacctgtttcgcaaagtccgaaccgg	Protospacer
   . ******* **************.**********

957. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
aggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
....  **************************** ***

958. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
aggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
....  **************************** ***

959. spacer 1.7|188762|38|CP034054|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.816

gaatacctgcactgcctgtcactattcctcgaactgct	CRISPR spacer
aggctgctgcactgcctgtcactattcctcgaacagct	Protospacer
....  **************************** ***

960. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

961. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

962. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

963. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

964. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

965. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

966. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

967. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agcgctgccgccgacgtgaatggcgatatgaacaactt	Protospacer
*.   .********************.*****.*****

968. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

969. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

970. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

971. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

972. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

973. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

974. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

975. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

976. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

977. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

978. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

979. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

980. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

981. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

982. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

983. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

984. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

985. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

986. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

987. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

988. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

989. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

990. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

991. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

992. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

993. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

994. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

995. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

996. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

997. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

998. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

999. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1000. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1001. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1002. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1003. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1004. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1005. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1006. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1007. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1008. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1009. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1010. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1011. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1012. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1013. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1014. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1015. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1016. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1017. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1018. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1019. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1020. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1021. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1022. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1023. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1024. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1025. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1026. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1027. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1028. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1029. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1030. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1031. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1032. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1033. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1034. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1035. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1036. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1037. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1038. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1039. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1040. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1041. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1042. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1043. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1044. spacer 1.8|188823|38|CP034054|CRISPRCasFinder matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

aaatacgccgccgacgtgaatggcgacatgaataactt	CRISPR spacer
agtgccgccgccgacgtgaatggcgacatgaaccaatt	Protospacer
*.   ***************************. * **

1045. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1046. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accatttccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    . *****************************.*

1047. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accatttccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    . *****************************.*

1048. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP015754 (Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accatttccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    . *****************************.*

1049. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accatttccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    . *****************************.*

1050. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accatttccctgcatctgtttcgcaaaatccgaaccgg	Protospacer
.    . *******.***********************

1051. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP016160 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accatttccctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    . *****************************.*

1052. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1053. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1054. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
cccgctgccctgcacctgcttcgcaaaatccgacccgg	Protospacer
     .************.************** ****

1055. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1056. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1057. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1058. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1059. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1060. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1061. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1062. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1063. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1064. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1065. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1066. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1067. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1068. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1069. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1070. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1071. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1072. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1073. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1074. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1075. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1076. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1077. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1078. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1079. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1080. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1081. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1082. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1083. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1084. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1085. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1086. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1087. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1088. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1089. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1090. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
cccgctgccctgcacctgcttcgcaaaatccgacccgg	Protospacer
     .************.************** ****

1091. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1092. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1093. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1094. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1095. spacer 1.4|188580|38|CP034054|CRISPRCasFinder matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.789

gaatacgccctgcacctgtttcgcaaaatccgaaccgg	CRISPR spacer
accattgctctgcacctgtttcgcaaaatccgaaccag	Protospacer
.    .**.***************************.*

1096. spacer 1.5|188641|37|CP034054|CRISPRCasFinder matches to NC_025028 (Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence) position: , mismatch: 12, identity: 0.676

gaatacgtggcgaccaccagcgtcttagtgcagggaa	CRISPR spacer
tgggttatggcgaacaccagcgtgttagtgcagtaca	Protospacer
 ..  ..****** ********* ********* . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 130093 : 198043 73 Salmonella_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP034053
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034053_1 2220604-2221182 TypeI-E I-E,II-B
9 spacers
cas3,cas8e,cse2gr11,cas6e,cas7,cas5,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034053_2 2229935-2230642 TypeI-E I-B,III-A,III-B
11 spacers
cas2,cas1,cas5,cas7,cas6e,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034053_3 4226941-4227069 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034053_1 1.1|2220632|33|CP034053|PILER-CR,CRT 2220632-2220664 33 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 6591-6623 0 1.0
CP034053_1 1.7|2220633|32|CP034053|CRISPRCasFinder 2220633-2220664 32 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 6592-6623 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 70972-71003 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 191811-191842 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 115598-115629 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 41428-41459 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 112519-112550 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 100122-100153 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 94728-94759 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 123392-123423 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 101968-101999 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 123389-123420 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 143302-143333 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 184263-184294 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 52170-52201 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 51054-51085 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 57512-57543 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 48996-49027 0 1.0
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 32224-32255 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 70971-71003 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 191811-191843 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 115598-115630 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 41428-41460 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 112519-112551 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 100121-100153 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 94728-94760 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 123392-123424 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 101968-102000 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 123389-123421 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 143301-143333 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 184263-184295 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 52169-52201 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 51053-51085 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 57511-57543 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 48995-49027 0 1.0
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 32224-32256 0 1.0
CP034053_2 2.6|2230268|33|CP034053|PILER-CR 2230268-2230300 33 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 32824-32856 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 2184-2216 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 42688-42720 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 78940-78972 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 55786-55818 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 81535-81567 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 72357-72389 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 75225-75257 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 127997-128029 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 47179-47211 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 24251-24283 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 299334-299366 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 62972-63004 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 61258-61290 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 112497-112529 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 62973-63005 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 527-559 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 120934-120966 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 40811-40843 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 8039-8071 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 73215-73247 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 88106-88138 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 76511-76543 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 95680-95712 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 63926-63958 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 200193-200225 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 149792-149824 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP037444 Klebsiella sp. PO552 plasmid p3, complete sequence 64510-64542 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 108499-108531 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 214886-214918 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 60614-60646 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 80627-80659 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 86141-86173 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 227070-227102 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 121184-121216 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 19673-19705 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 196917-196949 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 111389-111421 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 120356-120388 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 135162-135194 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 77979-78011 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 213951-213983 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 42745-42777 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 67528-67560 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 128123-128155 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 190927-190959 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 78671-78703 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 85395-85427 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 84579-84611 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 66118-66150 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 59743-59775 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 111211-111243 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 220861-220893 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 213842-213874 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 62973-63005 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 24535-24567 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 98161-98193 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 40835-40867 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 194151-194183 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 76181-76213 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 161908-161940 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 18216-18248 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 61572-61604 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 86141-86173 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 76530-76562 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MG700549 Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence 96323-96355 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MG700550 Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence 7325-7357 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MG700550 Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence 104716-104748 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 244627-244659 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 190405-190437 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 72165-72197 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 110211-110243 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 45599-45631 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 63799-63831 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 90492-90524 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 171879-171911 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 25802-25834 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 165393-165425 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 172414-172446 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 63409-63441 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 67592-67624 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 106205-106237 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 122838-122870 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 136787-136819 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 84990-85022 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 62973-63005 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 175556-175588 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 156306-156338 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 67327-67359 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 100484-100516 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 90500-90532 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 77772-77804 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 242289-242321 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 76383-76415 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 252015-252047 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 1094-1126 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 132375-132407 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 16601-16633 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 12503-12535 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 124757-124789 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 98547-98579 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 16294-16326 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 13646-13678 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 167247-167279 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 72715-72747 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 81361-81393 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 197700-197732 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 77555-77587 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 114590-114622 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 9242-9274 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 190927-190959 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 12093-12125 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 13773-13805 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 144644-144676 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 219215-219247 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 117855-117887 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 132051-132083 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 208410-208442 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 14591-14623 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 52171-52203 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 193563-193595 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 117550-117582 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 62315-62347 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 225189-225221 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 92411-92443 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 103508-103540 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 34510-34542 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 101046-101078 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 25976-26008 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 202126-202158 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 209187-209219 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 149926-149958 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 212800-212832 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 36861-36893 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 102697-102729 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 130386-130418 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 183774-183806 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 100364-100396 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 140235-140267 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 5805-5837 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 31223-31255 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 80468-80500 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 48477-48509 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 202027-202059 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 144444-144476 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 116533-116565 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 92275-92307 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 102183-102215 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 219238-219270 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 116144-116176 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 54844-54876 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 36235-36267 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP038279 Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence 33252-33284 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 16294-16326 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 13646-13678 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 207449-207481 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 126146-126178 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 148473-148505 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 173405-173437 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 53929-53961 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 176979-177011 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 221969-222001 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 212645-212677 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 175479-175511 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 183797-183829 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 100362-100394 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 148976-149008 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 170309-170341 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 37561-37593 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 20454-20486 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 68782-68814 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 287894-287926 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP023725 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence 26389-26421 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 1130-1162 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 212385-212417 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 111300-111332 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 90843-90875 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 82250-82282 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 30640-30672 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 221295-221327 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 236308-236340 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 108285-108317 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 90352-90384 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 67397-67429 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 223262-223294 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 48789-48821 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 5495-5527 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 17503-17535 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN824001 Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence 45585-45617 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 53417-53449 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 127644-127676 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011630 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence 22614-22646 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 66997-67029 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 207995-208027 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 167331-167363 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 97982-98014 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 97541-97573 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 10416-10448 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 98018-98050 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 197627-197659 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 172414-172446 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 166634-166666 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 181096-181128 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 80350-80382 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 35044-35076 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 80417-80449 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 15112-15144 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 36315-36347 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 42745-42777 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 217859-217891 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 160357-160389 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 56378-56410 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 1812-1844 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 103004-103036 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 82665-82697 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 55960-55992 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 105513-105545 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 90232-90264 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 172292-172324 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 174223-174255 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 118954-118986 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 218052-218084 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP023947 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence 110634-110666 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 182041-182073 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 217570-217602 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 137662-137694 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 135134-135166 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 173006-173038 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 86923-86955 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 52319-52351 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 212821-212853 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 35982-36014 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 66958-66990 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 223265-223297 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 100931-100963 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 207156-207188 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 66766-66798 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 51606-51638 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 77182-77214 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 60026-60058 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 107729-107761 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 185403-185435 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 66784-66816 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 122096-122128 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 226373-226405 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 151487-151519 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 97775-97807 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 81826-81858 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 154743-154775 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 175370-175402 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 119292-119324 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 105280-105312 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 66097-66129 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP037930 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence 90111-90143 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 75708-75740 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP019904 Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence 93152-93184 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 16335-16367 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 253418-253450 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 40834-40866 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 103679-103711 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 162009-162041 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 213894-213926 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 173254-173286 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 91136-91168 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 35726-35758 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 126019-126051 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 88319-88351 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 233582-233614 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 53831-53863 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 222042-222074 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 13637-13669 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 99655-99687 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MH745929 Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence 134387-134419 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 121553-121585 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 234487-234519 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 6949-6981 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 41325-41357 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052489 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence 135191-135223 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 186851-186883 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 73473-73505 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY495890 Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence 58239-58271 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 250959-250991 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 155106-155138 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 120441-120473 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 35294-35326 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 108732-108764 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 190792-190824 0 1.0
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 95111-95143 0 1.0
CP034053_2 2.16|2230269|32|CP034053|CRISPRCasFinder,CRT 2230269-2230300 32 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 32824-32855 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 2184-2215 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 42689-42720 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 78941-78972 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 55787-55818 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 81536-81567 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 72357-72388 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 75225-75256 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 127998-128029 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 47180-47211 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 24252-24283 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 299334-299365 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 62973-63004 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 61259-61290 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 112497-112528 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 62974-63005 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 527-558 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 120934-120965 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 40812-40843 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 8040-8071 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 73215-73246 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 88106-88137 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 36507-36538 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 40427-40458 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 76511-76542 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 95681-95712 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 63927-63958 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 200193-200224 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 149793-149824 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP037444 Klebsiella sp. PO552 plasmid p3, complete sequence 64511-64542 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 108499-108530 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 214886-214917 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 60615-60646 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 80627-80658 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 86142-86173 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 227070-227101 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 121184-121215 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 19674-19705 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 196918-196949 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 111389-111420 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 120357-120388 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 135162-135193 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 77979-78010 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 213951-213982 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 42746-42777 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 67528-67559 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 128124-128155 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 190927-190958 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 78671-78702 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 85396-85427 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 84580-84611 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 66119-66150 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 59744-59775 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 111212-111243 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 220861-220892 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 213842-213873 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 62974-63005 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 24535-24566 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 98161-98192 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 40836-40867 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 194151-194182 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 19327-19358 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 76182-76213 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 161908-161939 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 18217-18248 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 61573-61604 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 86142-86173 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 76531-76562 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MG700549 Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence 96324-96355 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MG700550 Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence 7325-7356 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MG700550 Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence 104716-104747 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 244627-244658 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 190405-190436 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 72165-72196 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 110211-110242 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 45600-45631 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 63800-63831 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 90492-90523 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 171880-171911 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 25803-25834 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 165393-165424 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 172414-172445 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 63410-63441 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 67592-67623 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 106205-106236 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 122838-122869 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 136787-136818 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 84991-85022 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 62974-63005 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 175556-175587 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 156306-156337 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 67327-67358 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 100484-100515 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 90500-90531 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 77772-77803 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 242290-242321 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 76383-76414 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 252015-252046 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 1095-1126 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 132376-132407 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 16602-16633 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 12504-12535 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 124757-124788 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 98547-98578 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 16295-16326 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 13647-13678 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 167247-167278 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 72715-72746 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 81361-81392 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 197700-197731 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 77556-77587 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 114591-114622 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 9243-9274 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 190927-190958 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 12093-12124 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 13773-13804 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 144644-144675 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 219215-219246 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 117855-117886 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 132051-132082 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 208410-208441 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 14591-14622 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 52172-52203 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 193563-193594 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 117551-117582 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 62316-62347 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 225189-225220 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 92411-92442 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 103509-103540 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 34511-34542 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 101046-101077 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 25976-26007 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 202127-202158 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 209187-209218 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 149926-149957 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 212800-212831 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 36862-36893 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 102697-102728 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 130386-130417 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 183774-183805 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 100364-100395 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 140236-140267 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 5805-5836 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 31224-31255 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 80468-80499 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 48478-48509 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 202028-202059 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 144444-144475 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 116533-116564 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 92275-92306 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 102184-102215 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 219238-219269 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 116144-116175 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 54845-54876 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 36236-36267 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP038279 Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence 33253-33284 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 16295-16326 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 13647-13678 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 207449-207480 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 126147-126178 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 148473-148504 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 173405-173436 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 53930-53961 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 176980-177011 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 221969-222000 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 212645-212676 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 175479-175510 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 183797-183828 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 100362-100393 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 148977-149008 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 170309-170340 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 37562-37593 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 20454-20485 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 68783-68814 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 287894-287925 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP023725 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence 26389-26420 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 1130-1161 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 212385-212416 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 111301-111332 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 90844-90875 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 82250-82281 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 30640-30671 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 221295-221326 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 236308-236339 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 108286-108317 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 90352-90383 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 67398-67429 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 223262-223293 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 48790-48821 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 5495-5526 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 17504-17535 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN824001 Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence 45585-45616 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 53418-53449 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 127644-127675 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011630 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence 22614-22645 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 66998-67029 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 207995-208026 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 167332-167363 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 97982-98013 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 97542-97573 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 10416-10447 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 98019-98050 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 197628-197659 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 172414-172445 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 166634-166665 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 181096-181127 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 80351-80382 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 35045-35076 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 80418-80449 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 15112-15143 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 36315-36346 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 42545-42576 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 42746-42777 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 217859-217890 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 160357-160388 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 56379-56410 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 1813-1844 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 103004-103035 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 82666-82697 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 55961-55992 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 105513-105544 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 90233-90264 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 172292-172323 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 174224-174255 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 118954-118985 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 218052-218083 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP023947 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence 110635-110666 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 182041-182072 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 217570-217601 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 137662-137693 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 135134-135165 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 173006-173037 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 86924-86955 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 52319-52350 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 212821-212852 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 21524-21555 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 35983-36014 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 66959-66990 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 223265-223296 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 100931-100962 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 207157-207188 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 66767-66798 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 51606-51637 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 77183-77214 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 60026-60057 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 107730-107761 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 116948-116979 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 185403-185434 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 66785-66816 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 122097-122128 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 226373-226404 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 151487-151518 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 97776-97807 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 81826-81857 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 154743-154774 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 175370-175401 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 88832-88863 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 119293-119324 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 105280-105311 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 66098-66129 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP037930 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence 90111-90142 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 75708-75739 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP019904 Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence 93153-93184 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 16336-16367 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 253418-253449 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 40835-40866 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 103679-103710 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 162009-162040 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 213894-213925 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 52348-52379 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 173254-173285 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 91137-91168 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 35727-35758 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 126019-126050 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 88319-88350 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 233582-233613 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 53832-53863 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 222042-222073 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 13638-13669 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 99655-99686 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MH745929 Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence 134387-134418 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 121553-121584 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 234487-234518 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 6950-6981 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 41326-41357 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052489 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence 135191-135222 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 186852-186883 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 73473-73504 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY495890 Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence 58239-58270 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 250959-250990 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 13572-13603 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 155107-155138 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 120441-120472 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 35295-35326 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 108733-108764 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 190792-190823 0 1.0
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 95111-95142 0 1.0
CP034053_1 1.1|2220632|33|CP034053|PILER-CR,CRT 2220632-2220664 33 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 40357-40389 1 0.97
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 7672-7704 1 0.97
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 KY271395 Klebsiella phage 2b LV-2017, complete genome 40460-40492 1 0.97
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 39234-39266 1 0.97
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 39234-39266 1 0.97
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 41680-41712 1 0.97
CP034053_1 1.7|2220633|32|CP034053|CRISPRCasFinder 2220633-2220664 32 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 40358-40389 1 0.969
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 LR134212 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3 7672-7703 1 0.969
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KY271395 Klebsiella phage 2b LV-2017, complete genome 40460-40491 1 0.969
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 39234-39265 1 0.969
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 39234-39265 1 0.969
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 41680-41711 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 233926-233957 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 226378-226409 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 24053-24084 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 79683-79714 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 89125-89156 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 77072-77103 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 48747-48778 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 94336-94367 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 20288-20319 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 33889-33920 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 59646-59677 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 56858-56889 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 119804-119835 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 18091-18122 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 31315-31346 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 42196-42227 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 189347-189378 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KP987215 Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence 38873-38904 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 139837-139868 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 82339-82370 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 120371-120402 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 9181-9212 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 49570-49601 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 129903-129934 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 182803-182834 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 114109-114140 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 12618-12649 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 45583-45614 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 64785-64816 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 9183-9214 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 15961-15992 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 106390-106421 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 34213-34244 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 134203-134234 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 4247-4278 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 47386-47417 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 67410-67441 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 78101-78132 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 58214-58245 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 159062-159093 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 39578-39609 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 119162-119193 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 77729-77760 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 97083-97114 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 28555-28586 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 54883-54914 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 44902-44933 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 51933-51964 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 221353-221384 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 298-329 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029733 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence 69537-69568 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035635 Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence 30225-30256 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035637 Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence 13781-13812 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 163971-164002 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 180767-180798 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP051433 Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence 31390-31421 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 20289-20320 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024882 Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence 61271-61302 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 139135-139166 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 28524-28555 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 49991-50022 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 104015-104046 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 23803-23834 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 21026-21057 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 21027-21058 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020526 Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence 92421-92452 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 48392-48423 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 186609-186640 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 108808-108839 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025042 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence 23044-23075 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 102097-102128 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011987 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence 14478-14509 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 18933-18964 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 63403-63434 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 146022-146053 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 43020-43051 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 69514-69545 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 14168-14199 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 20289-20320 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 45506-45537 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 202183-202214 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 129887-129918 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 48848-48879 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 61425-61456 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 66412-66443 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 41280-41311 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 89651-89682 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 40769-40800 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 45583-45614 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 50084-50115 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 4914-4945 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 188795-188826 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 267006-267037 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP010385 Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence 53629-53660 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 107915-107946 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 48848-48879 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 92285-92316 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 122210-122241 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP030079 Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence 13208-13239 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 51325-51356 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 142863-142894 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 38171-38202 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 172255-172286 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 21026-21057 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 57857-57888 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 65963-65994 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 98892-98923 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 52545-52576 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MK648236 Klebsiella sp. strain TR5 plasmid pYK5, complete sequence 5523-5554 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 106705-106736 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 16634-16665 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 170597-170628 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 45409-45440 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 163486-163517 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 41170-41201 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 2631-2662 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 170019-170050 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 61193-61224 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 75054-75085 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 15133-15164 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 39578-39609 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 39578-39609 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 180677-180708 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 8495-8526 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 13413-13444 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 92641-92672 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 116652-116683 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 51246-51277 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 60990-61021 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 78276-78307 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 204494-204525 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 51329-51360 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 18015-18046 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 118784-118815 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 42040-42071 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 121235-121266 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 2014-2045 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 159755-159786 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 51967-51998 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 85084-85115 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 191861-191892 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 134644-134675 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 76261-76292 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 KY930324 Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence 10911-10942 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 53604-53635 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 19082-19113 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 40192-40223 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 29726-29757 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 106178-106209 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031572 Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence 98365-98396 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP010383 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence 71307-71338 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 97667-97698 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 42040-42071 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036176 Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence 37064-37095 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 46341-46372 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 21812-21843 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 54273-54304 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 35412-35443 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 69816-69847 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP009774 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence 9223-9254 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 40035-40066 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 74323-74354 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 51329-51360 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 68634-68665 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP006925 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence 9223-9254 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 39365-39396 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 84923-84954 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 1253-1284 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 86783-86814 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP006921 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence 2046-2077 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 20772-20803 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032180 Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence 69628-69659 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 39579-39610 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029143 Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence 65382-65413 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 16263-16294 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 136584-136615 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 49140-49171 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 59811-59842 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 71843-71874 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 11239-11270 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 168144-168175 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 53460-53491 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 201055-201086 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 146207-146238 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 82255-82286 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 9201-9232 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 62004-62035 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 117106-117137 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 52990-53021 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 14733-14764 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 70187-70218 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 40734-40765 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP023571 Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence 18443-18474 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 51329-51360 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 141594-141625 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 38348-38379 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 52405-52436 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 54527-54558 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 7752-7783 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 143147-143178 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 9179-9210 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 189840-189871 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 6924-6955 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 73836-73867 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 132562-132593 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 145666-145697 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 50536-50567 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 38540-38571 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 101119-101150 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 51329-51360 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 64835-64866 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 47158-47189 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 73165-73196 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 50670-50701 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 226584-226615 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 26926-26957 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 154495-154526 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 34683-34714 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP045019 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence 25565-25596 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021856 Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence 40681-40712 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 39681-39712 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 77102-77133 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 40158-40189 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021898 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence 27577-27608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 120435-120466 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 22888-22919 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 73581-73612 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 36120-36151 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 117701-117732 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 103189-103220 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 196828-196859 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 56665-56696 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 137779-137810 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 41999-42030 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 24730-24761 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 102225-102256 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP043319 Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence 29195-29226 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 20289-20320 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 52681-52712 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 78023-78054 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 44759-44790 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 44206-44237 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 20346-20377 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 9213-9244 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP023186 Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence 4333-4364 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 86836-86867 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 88702-88733 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 273665-273696 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025009 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence 51378-51409 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 243985-244016 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 114350-114381 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP023947 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence 36612-36643 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 5582-5613 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 55377-55408 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052437 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence 5329-5360 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP050812 Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence 51576-51607 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052353 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence 5329-5360 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 140495-140526 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 4782-4813 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 16487-16518 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026852 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence 18761-18792 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 143014-143045 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 153806-153837 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 109789-109820 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 129903-129934 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 182803-182834 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 124363-124394 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP030350 Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence 67344-67375 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025006 Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence 51376-51407 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 117299-117330 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 130127-130158 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026716 Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence 126777-126808 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 66411-66442 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 31736-31767 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 160692-160723 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 56156-56187 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 98449-98480 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 65029-65060 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052469 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence 44169-44200 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 65145-65176 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 177111-177142 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 271167-271198 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 36120-36151 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 51328-51359 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 139851-139882 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 20289-20320 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 17908-17939 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015396 Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence 28767-28798 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 57767-57798 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 232515-232546 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 51324-51355 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 28747-28778 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MN268580 Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence 134703-134734 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP028274 Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence 25971-26002 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 9983-10014 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 42040-42071 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MH745929 Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence 51335-51366 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 306094-306125 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 41379-41410 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 39527-39558 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MG764554 Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence 22527-22558 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 10688-10719 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 83129-83160 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 61092-61123 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052489 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence 51327-51358 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 115166-115197 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 144729-144760 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 53445-53476 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 39577-39608 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 84062-84093 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026370 Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence 34040-34071 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 15908-15939 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 92865-92896 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 52397-52428 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 11849-11880 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP033774 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence 126366-126397 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 18918-18949 1 0.969
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 167868-167899 1 0.969
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 233926-233958 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 226378-226410 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 24052-24084 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 79682-79714 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 89124-89156 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 77071-77103 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 48746-48778 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 94335-94367 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 20288-20320 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 33889-33921 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 59646-59678 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KY271405 Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence 56858-56890 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 119804-119836 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 18090-18122 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052485 Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 31314-31346 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 42196-42228 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 189346-189378 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KP987215 Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence 38873-38905 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 139836-139868 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 82339-82371 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 120371-120403 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 9181-9213 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 49570-49602 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 129903-129935 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 182803-182835 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 114109-114141 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 12618-12650 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 45583-45615 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 64784-64816 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 9182-9214 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 15961-15993 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 106389-106421 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 34212-34244 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 134203-134235 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 4247-4279 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 47385-47417 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 67410-67442 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 78101-78133 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 58214-58246 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 159061-159093 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 39577-39609 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 119161-119193 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 77729-77761 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 97083-97115 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052572 Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 28554-28586 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 54883-54915 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 44902-44934 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 51932-51964 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 221352-221384 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 297-329 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029733 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence 69536-69568 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035635 Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence 30225-30257 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035637 Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence 13780-13812 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 163971-164003 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 180767-180799 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP051433 Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence 31390-31422 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 20289-20321 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024882 Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence 61271-61303 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 139134-139166 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 28523-28555 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 49990-50022 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 104015-104047 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 23803-23835 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 21026-21058 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 21027-21059 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020526 Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence 92420-92452 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 48392-48424 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 186609-186641 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 108808-108840 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025042 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence 23043-23075 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 102097-102129 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011987 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence 14477-14509 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 18932-18964 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 63402-63434 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 146022-146054 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 43019-43051 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 69514-69546 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 14167-14199 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 20289-20321 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 45506-45538 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 202182-202214 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 129887-129919 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 48847-48879 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 61425-61457 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 66412-66444 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 41279-41311 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 89651-89683 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 40768-40800 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 45583-45615 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 50083-50115 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 4914-4946 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 188794-188826 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 267006-267038 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP010385 Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence 53629-53661 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 107915-107947 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 48847-48879 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 92284-92316 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 122210-122242 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP030079 Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence 13208-13240 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 51324-51356 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 142863-142895 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 38171-38203 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 172254-172286 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052559 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052270 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 21026-21058 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 57856-57888 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 65962-65994 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 98892-98924 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 52544-52576 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK648236 Klebsiella sp. strain TR5 plasmid pYK5, complete sequence 5523-5555 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 106704-106736 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 16633-16665 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 170597-170629 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 45408-45440 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 163485-163517 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 41169-41201 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 2630-2662 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 170018-170050 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 61193-61225 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 75054-75086 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 15133-15165 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 39577-39609 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 39577-39609 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 180676-180708 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 8495-8527 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 13413-13445 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 92641-92673 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 116651-116683 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 51246-51278 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 60989-61021 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 78275-78307 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 204493-204525 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 51328-51360 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 18014-18046 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052561 Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052209 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence 118784-118816 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 42039-42071 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 121235-121267 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 2014-2046 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 159754-159786 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 51966-51998 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 85084-85116 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 191861-191893 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 134643-134675 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 76260-76292 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 KY930324 Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence 10910-10942 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 53604-53636 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 19081-19113 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 40192-40224 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 29725-29757 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 106178-106210 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031572 Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence 98365-98397 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP010383 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence 71306-71338 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 97666-97698 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 42039-42071 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036176 Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence 37063-37095 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 46341-46373 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 21812-21844 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 54273-54305 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 35411-35443 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 69816-69848 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP009774 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence 9222-9254 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 40035-40067 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 74323-74355 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 51328-51360 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP046940 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1 68634-68666 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP006925 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence 9222-9254 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 39365-39397 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 84923-84955 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 1253-1285 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 86783-86815 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP006921 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence 2046-2078 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 20771-20803 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032180 Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence 69627-69659 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 39578-39610 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029143 Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence 65382-65414 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 16262-16294 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 136583-136615 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 49139-49171 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 59811-59843 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 71843-71875 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 11238-11270 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 168144-168176 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 53459-53491 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 201055-201087 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 146207-146239 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 82255-82287 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 9200-9232 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 62004-62036 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 117106-117138 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 52989-53021 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 14733-14765 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 70187-70219 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 40733-40765 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP023571 Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence 18443-18475 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 51328-51360 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 141593-141625 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 38347-38379 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 52405-52437 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 54526-54558 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 7751-7783 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 143146-143178 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 9179-9211 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 189840-189872 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 6924-6956 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 73835-73867 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 132562-132594 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 145665-145697 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 50536-50568 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 38540-38572 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026151 Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence 101118-101150 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 51328-51360 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 64835-64867 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 47158-47190 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 73164-73196 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 50670-50702 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 226583-226615 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 26926-26958 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 154494-154526 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 34682-34714 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP045019 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence 25565-25597 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021856 Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence 40681-40713 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 39680-39712 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 77101-77133 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 40158-40190 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021898 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence 27576-27608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 120435-120467 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 22888-22920 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052370 Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 73580-73612 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 36120-36152 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 117700-117732 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 103189-103221 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 196828-196860 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 56664-56696 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 137779-137811 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 41998-42030 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 24729-24761 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 102224-102256 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP043319 Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence 29195-29227 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 20289-20321 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 52680-52712 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 78023-78055 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 44759-44791 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 44206-44238 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 20346-20378 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 9212-9244 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP023186 Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence 4332-4364 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 86836-86868 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027161 Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence 88701-88733 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 273665-273697 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025009 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence 51377-51409 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 243984-244016 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 114350-114382 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052237 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP023947 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence 36612-36644 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 5582-5614 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 55376-55408 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052437 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence 5329-5361 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP050812 Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence 51576-51608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052353 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence 5329-5361 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 140495-140527 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 4782-4814 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028543 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 16487-16519 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026852 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence 18761-18793 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 143014-143046 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 153806-153838 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 109789-109821 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 129903-129935 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 182803-182835 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027425 Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence 124362-124394 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP030350 Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence 67343-67375 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052477 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025006 Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence 51375-51407 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 117299-117331 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 130127-130159 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026716 Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence 126776-126808 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 66411-66443 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 31736-31768 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 160691-160723 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 56155-56187 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 98449-98481 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 65028-65060 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052469 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence 44169-44201 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 65145-65177 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 177110-177142 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 271166-271198 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 36120-36152 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 51327-51359 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 139850-139882 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 20289-20321 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 17907-17939 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015396 Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence 28767-28799 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 57767-57799 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 232515-232547 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 51323-51355 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 28746-28778 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MN268580 Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence 134702-134734 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028274 Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence 25971-26003 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 9983-10015 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 42039-42071 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MH745929 Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence 51334-51366 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 306093-306125 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 41379-41411 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 39526-39558 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MG764554 Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence 22526-22558 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 10688-10720 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 83129-83161 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 61091-61123 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052489 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence 51326-51358 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 115166-115198 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 144728-144760 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 53444-53476 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 39576-39608 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 84062-84094 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026370 Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence 34040-34072 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 15907-15939 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 92865-92897 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 52397-52429 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 11848-11880 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP033774 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence 126365-126397 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 18917-18949 1 0.97
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 167867-167899 1 0.97
CP034053_2 2.3|2230085|33|CP034053|PILER-CR 2230085-2230117 33 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 16418-16450 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 36506-36538 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 40426-40458 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 19326-19358 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 42544-42576 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 21523-21555 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 116948-116980 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 88832-88864 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 52347-52379 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 13572-13604 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 32965-32997 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 163062-163094 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 27089-27121 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 202926-202958 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY689238 Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence 18273-18305 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 55174-55206 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 50594-50626 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 75492-75524 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 124249-124281 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 29932-29964 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 16351-16383 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 36642-36674 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 18359-18391 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 125023-125055 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 118164-118196 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 73656-73688 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 34584-34616 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 17903-17935 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 111764-111796 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 7066-7098 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 146859-146891 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 200383-200415 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 70383-70415 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 84807-84839 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 133940-133972 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_020893 Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence 18321-18353 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 126509-126541 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_009651 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence 1909-1941 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 41539-41571 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 97981-98013 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 88064-88096 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 33889-33921 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 13210-13242 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 133092-133124 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 164463-164495 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 194972-195004 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 82908-82940 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 111082-111114 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 29507-29539 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033395 Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence 52486-52518 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 201306-201338 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 111802-111834 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 81735-81767 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 43587-43619 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 246948-246980 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 80234-80266 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 172171-172203 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 116163-116195 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 102071-102103 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 118029-118061 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 77207-77239 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 187526-187558 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 25216-25248 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 53558-53590 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 130535-130567 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 114572-114604 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 169385-169417 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 119503-119535 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 169477-169509 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 50651-50683 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 124028-124060 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 167257-167289 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 5396-5428 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 217200-217232 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 83848-83880 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 84006-84038 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 84400-84432 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 82288-82320 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 84334-84366 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 84053-84085 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 95779-95811 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 130146-130178 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891681 Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence 71670-71702 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 31998-32030 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891684 Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence 92919-92951 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN891686 Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence 95832-95864 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 136002-136034 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 152918-152950 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 167674-167706 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 127605-127637 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 94994-95026 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 92045-92077 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 84747-84779 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 90223-90255 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 111764-111796 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 192997-193029 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 4109-4141 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 92526-92558 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 147446-147478 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 163880-163912 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 228019-228051 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 143758-143790 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 172638-172670 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 96099-96131 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 180187-180219 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 113002-113034 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 40524-40556 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 153778-153810 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 192498-192530 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 36655-36687 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 97323-97355 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 160553-160585 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 68933-68965 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 119480-119512 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 141234-141266 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 35678-35710 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 74397-74429 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 44939-44971 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 122428-122460 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 194601-194633 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 115002-115034 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 128307-128339 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 91724-91756 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 135472-135504 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 136880-136912 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP007736 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence 20248-20280 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 21813-21845 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 174628-174660 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 89677-89709 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 137962-137994 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 116430-116462 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 35674-35706 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 50498-50530 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 68470-68502 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 154106-154138 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 7888-7920 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 10080-10112 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 201801-201833 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 161124-161156 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 165419-165451 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 23149-23181 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 30446-30478 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 130024-130056 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 136881-136913 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 144105-144137 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 72284-72316 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 89149-89181 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 106215-106247 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 140503-140535 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 3892-3924 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 151102-151134 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 192734-192766 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 128812-128844 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 4880-4912 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 69326-69358 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 44893-44925 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 125478-125510 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 134599-134631 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 154482-154514 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 66772-66804 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 11748-11780 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 184644-184676 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 59224-59256 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 8073-8105 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 133079-133111 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028930 Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence 57994-58026 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 77693-77725 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 145517-145549 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 139388-139420 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP050168 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence 104607-104639 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 91731-91763 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 24458-24490 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 106725-106757 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP016922 Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence 39924-39956 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 83941-83973 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 77666-77698 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 192345-192377 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 75423-75455 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 168183-168215 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 36518-36550 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 45870-45902 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 82193-82225 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 76969-77001 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 72290-72322 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 121809-121841 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 198531-198563 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 79485-79517 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 116719-116751 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 107088-107120 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 133772-133804 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 133556-133588 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 121339-121371 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 117543-117575 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 115967-115999 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 160401-160433 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 157432-157464 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 98177-98209 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 98406-98438 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 106338-106370 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 14206-14238 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 95999-96031 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP018749 Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence 88808-88840 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 110702-110734 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 133079-133111 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 51520-51552 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 54159-54191 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP036367 Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence 52486-52518 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 125544-125576 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 68219-68251 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 169279-169311 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 16533-16565 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 87009-87041 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 167661-167693 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 16726-16758 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 278892-278924 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 152228-152260 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 81249-81281 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 110939-110971 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 110214-110246 1 0.97
CP034053_2 2.10|2230512|33|CP034053|PILER-CR 2230512-2230544 33 NZ_CP011577 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence 83799-83831 1 0.97
CP034053_2 2.13|2230086|32|CP034053|CRISPRCasFinder,CRT 2230086-2230117 32 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 16419-16450 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 32965-32996 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 163063-163094 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 27089-27120 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 202926-202957 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY689238 Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence 18274-18305 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 55174-55205 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 50595-50626 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 75493-75524 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 124250-124281 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 29933-29964 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 16352-16383 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 36642-36673 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 18360-18391 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 125024-125055 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 118164-118195 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 73656-73687 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 34585-34616 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 17904-17935 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 111765-111796 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 7066-7097 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 146859-146890 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 200384-200415 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 70384-70415 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 84808-84839 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 133940-133971 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_020893 Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence 18322-18353 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 126510-126541 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_009651 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence 1909-1940 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 41539-41570 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 97982-98013 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 88064-88095 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 33890-33921 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 13210-13241 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 133092-133123 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 164464-164495 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 194972-195003 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 82909-82940 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 111083-111114 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 29507-29538 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033395 Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence 52486-52517 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 201306-201337 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 111803-111834 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 81735-81766 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 43588-43619 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 246949-246980 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 80235-80266 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 59628-59659 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 172172-172203 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 116163-116194 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 102072-102103 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 118029-118060 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 77207-77238 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 187526-187557 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 25217-25248 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 53559-53590 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 130535-130566 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 114573-114604 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 169386-169417 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 119504-119535 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 169478-169509 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 50652-50683 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 124028-124059 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 167257-167288 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 5397-5428 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 217201-217232 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 83849-83880 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 84007-84038 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 84401-84432 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 82289-82320 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 84335-84366 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 84054-84085 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 95780-95811 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 130146-130177 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891681 Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence 71670-71701 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 31999-32030 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891684 Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence 92920-92951 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN891686 Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence 95833-95864 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 136002-136033 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 152919-152950 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 167674-167705 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 127606-127637 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 94995-95026 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 92046-92077 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 84748-84779 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 90224-90255 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 111765-111796 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 192997-193028 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 4109-4140 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 92526-92557 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 147446-147477 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 163880-163911 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 228020-228051 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 143758-143789 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 172638-172669 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 96100-96131 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 180187-180218 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 113003-113034 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 40524-40555 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 153778-153809 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 192498-192529 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 36655-36686 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 97323-97354 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 160553-160584 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 68934-68965 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 119481-119512 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 141235-141266 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 35679-35710 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 74398-74429 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 44940-44971 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 122429-122460 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 194601-194632 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 115002-115033 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 128307-128338 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 91725-91756 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 135472-135503 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 136880-136911 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP007736 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence 20248-20279 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 21814-21845 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 174628-174659 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 89677-89708 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 137962-137993 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 116430-116461 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 35675-35706 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 50499-50530 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 68470-68501 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 154107-154138 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 7889-7920 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 10080-10111 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 201802-201833 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 161124-161155 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 165419-165450 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 23150-23181 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 30446-30477 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 130024-130055 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 136881-136912 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 144105-144136 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 72285-72316 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 89150-89181 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 106216-106247 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 140504-140535 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 3893-3924 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 151103-151134 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 192735-192766 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 128812-128843 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 4881-4912 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 69326-69357 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 44894-44925 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 125478-125509 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 134599-134630 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 154482-154513 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 66773-66804 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 11748-11779 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 184644-184675 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 59225-59256 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 8074-8105 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 133079-133110 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028930 Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence 57994-58025 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 77694-77725 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 145518-145549 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 139388-139419 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP050168 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence 104607-104638 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 91732-91763 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 24459-24490 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 106726-106757 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP016922 Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence 39924-39955 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 83942-83973 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 77667-77698 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 192345-192376 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 75423-75454 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 168183-168214 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 36519-36550 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 45871-45902 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 82193-82224 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 76969-77000 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 72291-72322 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 121810-121841 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 198532-198563 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021713 Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence 79485-79516 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 116720-116751 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 107088-107119 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040030 Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence 133772-133803 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 133557-133588 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 121340-121371 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 117543-117574 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 115968-115999 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028181 Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence 160401-160432 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 157432-157463 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 98178-98209 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 98407-98438 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 106339-106370 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 14207-14238 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 96000-96031 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP018749 Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence 88808-88839 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 110702-110733 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP024551 Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence 133079-133110 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP032209 Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence 51520-51551 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 54160-54191 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP036367 Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence 52486-52517 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 125544-125575 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 68219-68250 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 169279-169310 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 16534-16565 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 87010-87041 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP021710 Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence 167661-167692 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 16727-16758 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 278893-278924 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 152229-152260 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 81250-81281 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 110940-110971 1 0.969
CP034053_2 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT 2230513-2230544 32 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 110215-110246 1 0.969
CP034053_1 1.3|2220754|33|CP034053|PILER-CR,CRT 2220754-2220786 33 KC139649 Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds 21082-21114 2 0.939
CP034053_1 1.3|2220754|33|CP034053|PILER-CR,CRT 2220754-2220786 33 KC139634 Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds 805-837 2 0.939
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 37838-37870 2 0.939
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 3840-3872 2 0.939
CP034053_1 1.9|2220755|32|CP034053|CRISPRCasFinder 2220755-2220786 32 KC139649 Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds 21082-21113 2 0.938
CP034053_1 1.9|2220755|32|CP034053|CRISPRCasFinder 2220755-2220786 32 KC139634 Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds 805-836 2 0.938
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 37838-37869 2 0.938
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 3841-3872 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 61090-61121 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 234000-234031 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 74199-74230 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 177083-177114 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 177049-177080 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 29067-29098 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 20022-20053 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 75596-75627 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 22231-22262 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 28908-28939 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP045692 Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence 52976-53007 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 6260-6291 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 20194-20225 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041050 Citrobacter sp. CF971 plasmid pBM527-4, complete sequence 35066-35097 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 162513-162544 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 14938-14969 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP025625 Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence 7309-7340 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MF679144 Escherichia coli plasmid pBJ114-78, complete sequence 37427-37458 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 58581-58612 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 16197-16228 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KX808482 Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence 25126-25157 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 55650-55681 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 52326-52357 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KU043116 Escherichia coli strain Y5 plasmid pECY56, complete sequence 26415-26446 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 93002-93033 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KX276657 Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence 134644-134675 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032991 Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence 30927-30958 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 137726-137757 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 65941-65972 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 99362-99393 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 85605-85636 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 63603-63634 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 20372-20403 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 20823-20854 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 12867-12898 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 7761-7792 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 13795-13826 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 21965-21996 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 78222-78253 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP023192 Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence 27458-27489 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP032799 Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence 3666-3697 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP045742 Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence 154709-154740 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 70564-70595 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 61524-61555 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 131771-131802 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP017618 Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence 93055-93086 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP013191 Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence 89191-89222 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 32667-32698 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP018110 Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence 33739-33770 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 260786-260817 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 KY075659 Escherichia coli strain GD80 plasmid pGD80-2, complete sequence 93363-93394 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 169179-169210 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP042500 Enterobacter sp. E76 plasmid pE76_001, complete sequence 36760-36791 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 53134-53165 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024468 Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence 6873-6904 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 65940-65971 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP053733 Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence 21123-21154 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 12501-12532 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_025106 Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence 80331-80362 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP033963 Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence 6794-6825 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP009105 Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence 63602-63633 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP017848 Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence 5459-5490 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP017848 Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence 97249-97280 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020547 Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence 25084-25115 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP010317 Escherichia coli strain 789 plasmid pAPEC-O78-2 65872-65903 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 30857-30888 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 300170-300201 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_KJ020575 Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence 9845-9876 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP054315 Escherichia coli strain SCU-483 plasmid pSCU-483-2 16991-17022 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP054316 Escherichia coli strain SCU-483 plasmid pSCU-483-1 84143-84174 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 48062-48093 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_010488 Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence 112508-112539 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024277 Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence 86766-86797 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP047091 Salmonella sp. S13 plasmid pS13-2, complete sequence 9204-9235 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP012835 Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence 29978-30009 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_009786 Escherichia coli O139:H28 str. E24377A plasmid pETEC_80, complete sequence 39585-39616 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 KX023259 Escherichia coli plasmid pSCE516-4, complete sequence 81905-81936 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP051431 Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence 126754-126785 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 42788-42819 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 42034-42065 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_AP023150 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence 12494-12525 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP044402 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence 5779-5810 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_025198 Escherichia coli plasmid pJIE512b, complete sequence 13891-13922 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 8212-8243 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 31268-31299 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 12444-12475 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN158992 Escherichia coli strain TREC9 plasmid pTREC9, complete sequence 38458-38489 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 203374-203405 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN915012 Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence 93218-93249 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 130492-130523 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 229228-229259 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 68993-69024 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP054943 Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence 24473-24504 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP024287 Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence 70227-70258 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP019248 Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence 75227-75258 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP019269 Escherichia coli strain 13C1079T plasmid p13C1079T-2, complete sequence 9198-9229 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP019269 Escherichia coli strain 13C1079T plasmid p13C1079T-2, complete sequence 58387-58418 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029244 Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence 89394-89425 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP031549 Escherichia coli strain cq9 plasmid unnamed3, complete sequence 109815-109846 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 54670-54701 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052784 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-2, complete sequence 10597-10628 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 190863-190894 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP029748 Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence 268715-268746 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 52578-52609 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN061455 Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence 5804-5835 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 26748-26779 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN891682 Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence 11312-11343 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP038392 Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-4, complete sequence 74224-74255 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 113224-113255 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 6355-6386 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MH579767 Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence 90167-90198 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN641485 Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence 43417-43448 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 23414-23445 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 121950-121981 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP038417 Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence 10962-10993 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP038388 Escherichia coli O157:H7 strain DEC5D plasmid pDEC5D-3, complete sequence 34726-34757 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP040923 Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence 9118-9149 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NC_009425 Enterobacter sp. 638 plasmid pENTE01, complete sequence 26797-26828 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP044137 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence 68073-68104 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 17024-17055 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 MN158991 Escherichia coli strain TREC8 plasmid pTREC8, complete sequence 28222-28253 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 21971-22002 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 136577-136608 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 127878-127909 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP034252 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence 18179-18210 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 9757-9788 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 128076-128107 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 22993-23024 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP044347 Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence 109145-109176 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041438 Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence 13322-13353 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 631-662 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 7177-7208 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 294286-294317 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP038298 Escherichia coli O157:H7 strain TB182A plasmid pTB182A-4, complete sequence 57510-57541 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP042618 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence 114502-114533 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP042619 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence 98937-98968 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041436 Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence 69221-69252 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 92731-92762 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP038397 Escherichia coli O157:H7 strain DEC5A plasmid pDEC5A-4, complete sequence 57578-57609 2 0.938
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_LT985283 Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI 5973-6004 2 0.938
CP034053_1 1.15|2221122|32|CP034053|CRISPRCasFinder 2221122-2221153 32 MN098327 Klebsiella phage Mulock, complete genome 25514-25545 2 0.938
CP034053_1 1.15|2221122|32|CP034053|CRISPRCasFinder 2221122-2221153 32 KY271400 Klebsiella phage 6 LV-2017, complete genome 17605-17636 2 0.938
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 61090-61122 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 233999-234031 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 74199-74231 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 177083-177115 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 177049-177081 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 29066-29098 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 20021-20053 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 75595-75627 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 22231-22263 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041050 Citrobacter sp. CF971 plasmid pBM527-4, complete sequence 35066-35098 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 162513-162545 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 58580-58612 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 20371-20403 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 12866-12898 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 13795-13827 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 78222-78254 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 70564-70596 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 28907-28939 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP042500 Enterobacter sp. E76 plasmid pE76_001, complete sequence 36759-36791 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 12500-12532 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 48061-48093 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012835 Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence 29978-30010 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP023150 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence 12493-12525 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 8212-8244 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 31267-31299 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 12443-12475 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 52578-52610 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 113223-113255 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 6354-6386 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_009425 Enterobacter sp. 638 plasmid pENTE01, complete sequence 26796-26828 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 17023-17055 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 9757-9789 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 128076-128108 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 631-663 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 92730-92762 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 96813-96845 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 103405-103437 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 106885-106917 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024835 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence 5000-5032 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 47722-47754 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 89077-89109 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP007736 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence 42758-42790 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 6710-6742 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 138139-138171 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021688 Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence 5471-5503 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 210739-210771 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 18483-18515 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 31272-31304 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 12509-12541 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 7737-7769 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024839 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence 53086-53118 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 20805-20837 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 53750-53782 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 10295-10327 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 12493-12525 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 114561-114593 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 95952-95984 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 107712-107744 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 47732-47764 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 122418-122450 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 48710-48742 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 45645-45677 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN792917 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence 22461-22493 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP050361 Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence 22798-22830 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 20776-20808 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 41929-41961 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN824001 Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence 8631-8663 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 77165-77197 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024509 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence 71233-71265 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 6969-7001 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 22486-22518 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 107780-107812 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 88100-88132 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 9231-9263 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 104315-104347 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 61752-61784 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 79367-79399 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 10883-10915 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 854-886 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 12517-12549 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 87082-87114 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 82606-82638 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 36561-36593 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 105007-105039 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 12509-12541 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021758 Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence 51215-51247 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 132168-132200 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 17313-17345 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 82924-82956 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 117305-117337 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP021777 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence 68290-68322 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 35082-35114 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 60311-60343 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MK773538 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-D, complete sequence 24443-24475 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 8648-8680 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 12485-12517 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 109405-109437 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 19537-19569 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 6260-6292 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MH909329 Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence 5283-5315 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 123480-123512 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MG764547 Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence 25612-25644 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 124770-124802 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MN688131 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence 15718-15750 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 29813-29845 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 26620-26652 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 97150-97182 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 84702-84734 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 157579-157611 2 0.939
CP034053_1 1.18|2221121|33|CP034053|CRT 2221121-2221153 33 MN098327 Klebsiella phage Mulock, complete genome 25513-25545 2 0.939
CP034053_1 1.18|2221121|33|CP034053|CRT 2221121-2221153 33 KY271400 Klebsiella phage 6 LV-2017, complete genome 17605-17637 2 0.939
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP045692 Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence 52975-53007 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 20193-20225 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 14937-14969 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP025625 Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence 7309-7341 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 MF679144 Escherichia coli plasmid pBJ114-78, complete sequence 37427-37459 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 16197-16229 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KX808482 Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence 25126-25158 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 55649-55681 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 52326-52358 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KU043116 Escherichia coli strain Y5 plasmid pECY56, complete sequence 26414-26446 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 93001-93033 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KX276657 Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence 134644-134676 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032991 Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence 30927-30959 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 137725-137757 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 65940-65972 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 99362-99394 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 85605-85637 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 63602-63634 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 20822-20854 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 7760-7792 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 21964-21996 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP023192 Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence 27457-27489 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP032799 Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence 3666-3698 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP045742 Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence 154709-154741 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 61524-61556 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 131771-131803 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_AP017618 Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence 93054-93086 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP013191 Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence 89191-89223 3 0.909
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 32667-32699 3 0.909
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 MH153804 Rhodococcus phage Jace, complete genome 35884-35916 5 0.848
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 MH153804 Rhodococcus phage Jace, complete genome 35884-35915 5 0.844
CP034053_1 1.14|2221061|32|CP034053|CRISPRCasFinder 2221061-2221092 32 NZ_CP041050 Citrobacter sp. CF971 plasmid pBM527-4, complete sequence 48414-48445 5 0.844
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP022194 Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence 74061-74092 5 0.844
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 251016-251047 5 0.844
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 305970-306001 5 0.844
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP026110 Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence 23271-23302 6 0.812
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 6213-6244 6 0.812
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 85058-85089 6 0.812
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 19060-19091 6 0.812
CP034053_1 1.9|2220755|32|CP034053|CRISPRCasFinder 2220755-2220786 32 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 18529-18560 6 0.812
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_030917 Gordonia phage OneUp, complete genome 47114-47145 6 0.812
CP034053_1 1.17|2221060|33|CP034053|CRT 2221060-2221092 33 NZ_CP041050 Citrobacter sp. CF971 plasmid pBM527-4, complete sequence 48414-48446 6 0.818
CP034053_2 2.1|2229963|33|CP034053|PILER-CR 2229963-2229995 33 NZ_CP022194 Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence 74060-74092 6 0.818
CP034053_2 2.1|2229963|33|CP034053|PILER-CR 2229963-2229995 33 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 251016-251048 6 0.818
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 981668-981699 6 0.812
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MT522001 Microbacterium phage Karate, complete genome 14878-14909 6 0.812
CP034053_2 2.12|2230025|32|CP034053|CRISPRCasFinder,CRT 2230025-2230056 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 390700-390731 6 0.812
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 639515-639547 7 0.788
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 85057-85089 7 0.788
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 6213-6245 7 0.788
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 19059-19091 7 0.788
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 NZ_CP026110 Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence 23271-23303 7 0.788
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 NC_030917 Gordonia phage OneUp, complete genome 47114-47146 7 0.788
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 639516-639547 7 0.781
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_048169 Gordonia phage BrutonGaster, complete genome 45344-45375 7 0.781
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 360344-360376 7 0.788
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 360343-360376 7 0.794
CP034053_2 2.2|2230024|33|CP034053|PILER-CR 2230024-2230056 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 390700-390732 7 0.788
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 222347-222378 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 394255-394286 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 145701-145732 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MT639643 Microbacterium phage FreddieHg, complete genome 14643-14674 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MH825699 Streptomyces phage Darolandstone, complete genome 19629-19660 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MK737941 Microbacterium phage Rachella, complete genome 15468-15499 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MK801732 Microbacterium phage NarutoRun, complete genome 15465-15496 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NC_047986 Microbacterium phage Krampus, complete genome 15472-15503 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MK801731 Microbacterium phage Anakin, complete genome 15465-15496 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MN497954 Microbacterium phage Hiddenleaf, complete genome 14627-14658 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MH271292 Microbacterium phage AnnaSerena, complete genome 15474-15505 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MT684591 Microbacterium phage Chivey, complete genome 14627-14658 7 0.781
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 MT684592 Microbacterium phage Aesir, complete genome 15211-15242 7 0.781
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 NC_048169 Gordonia phage BrutonGaster, complete genome 45344-45376 8 0.758
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 MT684587 Microbacterium phage Fede, complete genome 12339-12370 8 0.75
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 79048-79079 8 0.75
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 664010-664041 8 0.75
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 24737-24768 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KT373978 Mycobacterium phage Ukulele, complete genome 70076-70107 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MF668277 Mycobacterium phage MadamMonkfish, complete genome 70456-70487 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK433262 Mycobacterium phage Nimrod, complete genome 71568-71599 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MG872843 Mycobacterium phage Sotrice96, complete genome 71813-71844 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH651174 Mycobacterium phage Easy2Say, complete genome 70981-71012 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH000607 Mycobacterium phage RiverMonster, complete genome 70696-70727 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MT723943 Mycobacterium phage Cactus, complete genome 71069-71100 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MT114165 Mycobacterium phage BadStone, complete genome 71475-71506 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MG872831 Mycobacterium phage Asriel, complete genome 69232-69263 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK757445 Mycobacterium phage Lilizi, complete genome 70743-70774 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH576953 Mycobacterium phage Hopey, complete genome 71015-71046 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KX834009 Mycobacterium phage Goldilocks, complete genome 71111-71142 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MG099953 Mycobacterium phage Youngblood, complete genome 71151-71182 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MF919506 Mycobacterium phage FireRed, complete genome 71097-71128 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 AY129331 Mycobacterium virus Cjw1, complete genome 71650-71681 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586043 Mycobacterium phage Buck, complete genome 71473-71504 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH536829 Mycobacterium phage TBrady12, complete genome 70745-70776 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN096364 Mycobacterium phage Tomaszewski, complete genome 70192-70223 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH590587 Mycobacterium phage xkcd, complete genome 71336-71367 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH371112 Mycobacterium phage Adnama, complete genome 70591-70622 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KX611831 Mycobacterium phage Pharsalus, complete genome 70871-70902 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_042027 Mycobacterium phage Pumpkin, complete genome 70077-70108 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KF493883 Mycobacterium phage Mosby, complete genome 70018-70049 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH513978 Mycobacterium phage Phaja, complete genome 70956-70987 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN428059 Mycobacterium phage Kanye, complete genome 70530-70561 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KY549152 Mycobacterium phage Maxxinista, complete genome 70409-70440 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH399778 Mycobacterium phage Icee, complete genome 70827-70858 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MF919529 Mycobacterium phage Sassay, complete genome 68980-69011 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH513972 Mycobacterium phage IHOP, complete genome 70951-70982 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586051 Mycobacterium phage Myrale, complete genome 71296-71327 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK359309 Mycobacterium phage Czyszczon1, complete genome 70012-70043 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KU865303 Mycobacterium phage TeardropMSU, complete genome 70681-70712 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586041 Mycobacterium phage Elite2014, complete genome 70447-70478 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MF919524 Mycobacterium phage MISSy, complete genome 71362-71393 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 EU816588 Mycobacterium phage Porky, complete genome 70950-70981 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MT952854 Mycobacterium phage Miniwave, complete genome 70053-70084 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK016502 Mycobacterium phage Pat3, complete genome 70268-70299 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH536827 Mycobacterium phage Simpliphy, complete genome 70267-70298 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH669002 Mycobacterium phage Emmina, complete genome 69933-69964 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586035 Mycobacterium phage ChosenOne, complete genome 70448-70479 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KR080204 Mycobacterium phage Mindy, complete genome 70805-70836 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 DQ398041 Mycobacterium virus 244, complete genome 70379-70410 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MG872832 Mycobacterium phage Barbarian, complete genome 69232-69263 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_029079 Mycobacterium phage Dusk, complete genome 71135-71166 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586032 Mycobacterium phage Command613, complete genome 71014-71045 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KC661277 Mycobacterium phage Phrux, complete genome 69801-69832 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 JF937096 Mycobacterium phage Henry, complete genome 71377-71408 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_022065 Mycobacterium phage Contagion, complete genome 70018-70049 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KX817173 Mycobacterium phage Tuco, complete genome 72740-72771 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK937593 Mycobacterium phage Flypotenuse, complete genome 69886-69917 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MG757160 Mycobacterium phage Kimchi, complete genome 71236-71267 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN096361 Mycobacterium phage Gator, complete genome 71426-71457 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586013 Mycobacterium phage Traaww1, complete genome 70061-70092 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH020247 Mycobacterium phage MPhalcon, complete genome 70780-70811 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 JN391441 Mycobacterium phage Elph10, complete genome 69766-69797 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KF306380 Mycobacterium phage DrDrey, complete genome 72708-72739 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH576956 Mycobacterium phage Inca, complete genome 68971-69002 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK620893 Mycobacterium phage HanKaySha, complete genome 70469-70500 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH779503 Mycobacterium phage Gemini, complete genome 71032-71063 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_022969 Mycobacterium phage PhatBacter, complete genome 71097-71128 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586019 Mycobacterium phage Stark, complete genome 70515-70546 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586050 Mycobacterium phage Lilpickle, complete genome 70447-70478 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_041850 Mycobacterium phage Eureka, complete genome 70861-70892 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KF562099 Mycobacterium phage Bruin, complete genome 69656-69687 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK016491 Mycobacterium phage BaboJay, complete genome 71546-71577 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_028906 Mycobacterium phage Toto, complete genome 71513-71544 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KY319168 Mycobacterium phage CrystalP, complete genome 71512-71543 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH536820 Mycobacterium phage Glexan, complete genome 71576-71607 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_008194 Mycobacterium phage 244, complete genome 70379-70410 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 JF937091 Mycobacterium phage Bask21, complete genome 70398-70429 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KF188414 Mycobacterium phage ABCat, complete genome 71927-71958 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 JN006062 Mycobacterium phage Rakim, complete genome 70635-70666 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK801726 Mycobacterium phage ChotaBhai, complete genome 71234-71265 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH727557 Mycobacterium phage Paperbeatsrock, complete genome 70731-70762 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KF279417 Mycobacterium phage Quink, complete genome 71176-71207 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH399774 Mycobacterium phage DoctorDiddles, complete genome 69971-70002 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_028785 Mycobacterium phage NelitzaMV, complete genome 69112-69143 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586044 Mycobacterium phage Rimmer, complete genome 70536-70567 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586017 Mycobacterium phage OrionPax, complete genome 70014-70045 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KT020852 Mycobacterium phage NoSleep, complete genome 69882-69913 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MK559429 Mycobacterium phage Moldemort, complete genome 70623-70654 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MF919535 Mycobacterium phage Terminus, complete genome 71654-71685 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_022976 Mycobacterium phage Nala, complete genome 71069-71100 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_021305 Mycobacterium phage Murphy, complete genome 70783-70814 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MT522005 Mycobacterium phage Misfit, complete genome 71654-71685 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586037 Mycobacterium phage GooberAzure, complete genome 70515-70546 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 KC691255 Mycobacterium phage Dumbo, complete genome 70659-70690 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 EU816591 Mycobacterium phage Kostya, complete genome 71053-71084 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MN586034 Mycobacterium phage Hoonter, complete genome 71008-71039 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_022085 Mycobacterium phage Goku, complete genome 71170-71201 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_004681 Mycobacterium phage Cjw1, complete genome 71650-71681 8 0.75
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 MH513983 Mycobacterium phage ShereKhan, complete genome 71455-71486 8 0.75
CP034053_2 2.7|2230329|33|CP034053|PILER-CR 2230329-2230361 33 NC_048198 Erwinia phage vB_EhrS_59, complete genome 21191-21223 8 0.758
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 30683-30714 8 0.75
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 8086-8117 8 0.75
CP034053_2 2.12|2230025|32|CP034053|CRISPRCasFinder,CRT 2230025-2230056 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1856646-1856677 8 0.75
CP034053_1 1.2|2220693|33|CP034053|PILER-CR,CRT 2220693-2220725 33 MT684587 Microbacterium phage Fede, complete genome 12338-12370 9 0.727
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 442669-442700 9 0.719
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 413398-413429 9 0.719
CP034053_1 1.8|2220694|32|CP034053|CRISPRCasFinder 2220694-2220725 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 167606-167637 9 0.719
CP034053_1 1.9|2220755|32|CP034053|CRISPRCasFinder 2220755-2220786 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 103739-103770 9 0.719
CP034053_1 1.10|2220816|32|CP034053|CRISPRCasFinder 2220816-2220847 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 9002-9033 9 0.719
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1379088-1379120 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1595178-1595210 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 684826-684858 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 136899-136931 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1044208-1044240 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 585083-585115 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 39178-39210 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 47993-48025 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 368207-368239 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 523974-524006 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 400235-400267 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1323450-1323482 9 0.727
CP034053_1 1.13|2220999|33|CP034053|CRISPRCasFinder 2220999-2221031 33 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 39180-39212 9 0.727
CP034053_2 2.12|2230025|32|CP034053|CRISPRCasFinder,CRT 2230025-2230056 32 NC_022590 Brevibacterium sp. Ap13 plasmid pAP13, complete sequence 56617-56648 9 0.719
CP034053_2 2.17|2230330|32|CP034053|CRISPRCasFinder,CRT 2230330-2230361 32 NC_048198 Erwinia phage vB_EhrS_59, complete genome 21191-21222 9 0.719
CP034053_1 1.4|2220815|33|CP034053|PILER-CR,CRT 2220815-2220847 33 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 9002-9034 10 0.697
CP034053_1 1.9|2220755|32|CP034053|CRISPRCasFinder 2220755-2220786 32 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 217049-217080 10 0.688
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1379087-1379120 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 39178-39211 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 47993-48026 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1595177-1595210 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 684825-684858 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 368207-368240 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 136898-136931 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1044207-1044240 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 523974-524007 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 585082-585115 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 400235-400268 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1323450-1323483 10 0.706
CP034053_1 1.16|2220998|34|CP034053|CRT 2220998-2221031 34 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 39180-39213 10 0.706
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NZ_CP016458 Blastomonas sp. RAC04 plasmid pBSY18_2, complete sequence 87127-87158 10 0.688
CP034053_2 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT 2229964-2229995 32 NC_021347 Rhodococcus phage E3, complete genome 14650-14681 11 0.656

1. spacer 1.1|2220632|33|CP034053|PILER-CR,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

tgcctccaatgcaatcaccggcctgctaaccgg	CRISPR spacer
tgcctccaatgcaatcaccggcctgctaaccgg	Protospacer
*********************************

2. spacer 1.7|2220633|32|CP034053|CRISPRCasFinder matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

gcctccaatgcaatcaccggcctgctaaccgg	CRISPR spacer
gcctccaatgcaatcaccggcctgctaaccgg	Protospacer
********************************

3. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

4. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

5. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

6. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

7. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

8. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

9. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

10. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

11. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

12. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

13. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

14. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

15. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

16. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

17. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

18. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

19. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg	Protospacer
********************************

20. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

21. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

22. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

23. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

24. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

25. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

26. spacer 1.17|2221060|33|CP034053|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

27. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

28. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

29. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

30. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

31. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

32. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

33. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

34. spacer 1.17|2221060|33|CP034053|CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

35. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

36. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg	Protospacer
*********************************

37. spacer 2.6|2230268|33|CP034053|PILER-CR matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 0, identity: 1.0

tacactgagcatgtacgccgtggatgcagtagc	CRISPR spacer
tacactgagcatgtacgccgtggatgcagtagc	Protospacer
*********************************

38. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

39. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

40. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

41. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

42. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

43. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

44. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

45. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

46. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

47. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

48. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

49. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

50. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

51. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

52. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

53. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

54. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

55. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

56. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

57. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

58. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

59. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

60. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

61. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

62. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

63. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

64. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

65. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

66. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

67. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

68. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

69. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

70. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

71. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

72. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

73. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

74. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

75. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

76. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

77. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

78. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

79. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

80. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

81. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

82. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

83. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

84. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

85. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

86. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

87. spacer 2.10|2230512|33|CP034053|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

88. spacer 2.10|2230512|33|CP034053|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

89. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

90. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

91. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

92. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

93. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

94. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

95. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

96. spacer 2.10|2230512|33|CP034053|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

97. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

98. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

99. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

100. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

101. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

102. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

103. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

104. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

105. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

106. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

107. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

108. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

109. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

110. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

111. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

112. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

113. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

114. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

115. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

116. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

117. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

118. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

119. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

120. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

121. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

122. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

123. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

124. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

125. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

126. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

127. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

128. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

129. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

130. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

131. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

132. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

133. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

134. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

135. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

136. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

137. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

138. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

139. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

140. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

141. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

142. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

143. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

144. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

145. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

146. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

147. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

148. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

149. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

150. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

151. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

152. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

153. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

154. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

155. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

156. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

157. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

158. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

159. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

160. spacer 2.10|2230512|33|CP034053|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

161. spacer 2.10|2230512|33|CP034053|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

162. spacer 2.10|2230512|33|CP034053|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

163. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

164. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

165. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

166. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

167. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

168. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

169. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

170. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

171. spacer 2.10|2230512|33|CP034053|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

172. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

173. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

174. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

175. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

176. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

177. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

178. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

179. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

180. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

181. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

182. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

183. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

184. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

185. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

186. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

187. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

188. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

189. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

190. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

191. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

192. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

193. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

194. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

195. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

196. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

197. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

198. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

199. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

200. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

201. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

202. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

203. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

204. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

205. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

206. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

207. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

208. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

209. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

210. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

211. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

212. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

213. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

214. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

215. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

216. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

217. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

218. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

219. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

220. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

221. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

222. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

223. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

224. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

225. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

226. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

227. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

228. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

229. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

230. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

231. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

232. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011630 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

233. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

234. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

235. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

236. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

237. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

238. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

239. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

240. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

241. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

242. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

243. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

244. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

245. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

246. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

247. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

248. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

249. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

250. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

251. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

252. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

253. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

254. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

255. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

256. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

257. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

258. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

259. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

260. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

261. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

262. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

263. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

264. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

265. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

266. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

267. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

268. spacer 2.10|2230512|33|CP034053|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

269. spacer 2.10|2230512|33|CP034053|PILER-CR matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

270. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

271. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

272. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

273. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

274. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

275. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

276. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

277. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

278. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

279. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

280. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

281. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

282. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

283. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

284. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

285. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

286. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

287. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

288. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

289. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

290. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

291. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

292. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

293. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

294. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

295. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

296. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

297. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

298. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

299. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

300. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

301. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

302. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

303. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

304. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

305. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

306. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

307. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

308. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

309. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

310. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

311. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

312. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

313. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

314. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

315. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

316. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

317. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

318. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

319. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

320. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

321. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

322. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

323. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

324. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

325. spacer 2.10|2230512|33|CP034053|PILER-CR matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

326. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

327. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

328. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

329. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

330. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca	Protospacer
*********************************

331. spacer 2.16|2230269|32|CP034053|CRISPRCasFinder,CRT matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 0, identity: 1.0

acactgagcatgtacgccgtggatgcagtagc	CRISPR spacer
acactgagcatgtacgccgtggatgcagtagc	Protospacer
********************************

332. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

333. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

334. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

335. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

336. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

337. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

338. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

339. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

340. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

341. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

342. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

343. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

344. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

345. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

346. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

347. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

348. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

349. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

350. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

351. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

352. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

353. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

354. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

355. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

356. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

357. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

358. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

359. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

360. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

361. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

362. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

363. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

364. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

365. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

366. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

367. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

368. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

369. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

370. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

371. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

372. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

373. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

374. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

375. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

376. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

377. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

378. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

379. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

380. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

381. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

382. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

383. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

384. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

385. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

386. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

387. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

388. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

389. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

390. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

391. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

392. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

393. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

394. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

395. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

396. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

397. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

398. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

399. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

400. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

401. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

402. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

403. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

404. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

405. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

406. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

407. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

408. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

409. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

410. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

411. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

412. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

413. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

414. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

415. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

416. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

417. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

418. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

419. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

420. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

421. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

422. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

423. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

424. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

425. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

426. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

427. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

428. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

429. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

430. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

431. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

432. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

433. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

434. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

435. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

436. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

437. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

438. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

439. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

440. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

441. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

442. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

443. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

444. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

445. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

446. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

447. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

448. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

449. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

450. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

451. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

452. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

453. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

454. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

455. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

456. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

457. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

458. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

459. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

460. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

461. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

462. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

463. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

464. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

465. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

466. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

467. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

468. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

469. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

470. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

471. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

472. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

473. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

474. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

475. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

476. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

477. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

478. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

479. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

480. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

481. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

482. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

483. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

484. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

485. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

486. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

487. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

488. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

489. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

490. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

491. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

492. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

493. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

494. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

495. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

496. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

497. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

498. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

499. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

500. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

501. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

502. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

503. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

504. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

505. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

506. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

507. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

508. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

509. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

510. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

511. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

512. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

513. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

514. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

515. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

516. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

517. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

518. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

519. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

520. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

521. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

522. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

523. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

524. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

525. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

526. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

527. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

528. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

529. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011630 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

530. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

531. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

532. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

533. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

534. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

535. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

536. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

537. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

538. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

539. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

540. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

541. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

542. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

543. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

544. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

545. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

546. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

547. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

548. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

549. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

550. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

551. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

552. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

553. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

554. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

555. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

556. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

557. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

558. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

559. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

560. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

561. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

562. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

563. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

564. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

565. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

566. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

567. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

568. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

569. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

570. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

571. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

572. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

573. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

574. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

575. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

576. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

577. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

578. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

579. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

580. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

581. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

582. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

583. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

584. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

585. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

586. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

587. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

588. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

589. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

590. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

591. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

592. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

593. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

594. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

595. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

596. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

597. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

598. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

599. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

600. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

601. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

602. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

603. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

604. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

605. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

606. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

607. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

608. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

609. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

610. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

611. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

612. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

613. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

614. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

615. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

616. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

617. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

618. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

619. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

620. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

621. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

622. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

623. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

624. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

625. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

626. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

627. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

628. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

629. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

630. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

631. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

632. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

633. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca	Protospacer
********************************

634. spacer 1.1|2220632|33|CP034053|PILER-CR,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.97

tgcctccaatgcaatcaccggcctgctaaccgg	CRISPR spacer
tgcttccaatgcaatcaccggcctgctaaccgg	Protospacer
***.*****************************

635. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.97

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagtcgtcgtagtcctcagtaatgtcctcga	Protospacer
*******************.*************

636. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.97

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
**********.**********************

637. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.97

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
**********.**********************

638. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.97

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
**********.**********************

639. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.97

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
**********.**********************

640. spacer 1.7|2220633|32|CP034053|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.969

gcctccaatgcaatcaccggcctgctaaccgg	CRISPR spacer
gcttccaatgcaatcaccggcctgctaaccgg	Protospacer
**.*****************************

641. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.969

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagtcgtcgtagtcctcagtaatgtcctcga	Protospacer
******************.*************

642. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.969

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
*********.**********************

643. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.969

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
*********.**********************

644. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.969

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
*********.**********************

645. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.969

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga	Protospacer
*********.**********************

646. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

647. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

648. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

649. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

650. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

651. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

652. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

653. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

654. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

655. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

656. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

657. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

658. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

659. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

660. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

661. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

662. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

663. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

664. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

665. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

666. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

667. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

668. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

669. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

670. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

671. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

672. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

673. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

674. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

675. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

676. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

677. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

678. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

679. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

680. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

681. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

682. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

683. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

684. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

685. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

686. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

687. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

688. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

689. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

690. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

691. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

692. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

693. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

694. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

695. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

696. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

697. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

698. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

699. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

700. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

701. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

702. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

703. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

704. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

705. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

706. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

707. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

708. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

709. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

710. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP051433 (Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

711. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

712. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

713. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

714. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

715. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

716. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

717. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

718. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

719. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

720. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

721. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

722. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020526 (Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

723. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

724. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

725. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

726. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025042 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

727. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

728. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

729. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

730. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011987 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

731. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

732. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

733. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

734. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

735. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

736. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

737. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

738. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

739. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

740. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

741. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

742. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

743. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

744. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

745. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

746. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

747. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

748. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

749. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

750. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

751. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

752. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

753. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

754. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP010385 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

755. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

756. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

757. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

758. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

759. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

760. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

761. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

762. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

763. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

764. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

765. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

766. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

767. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

768. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

769. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

770. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

771. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

772. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

773. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MK648236 (Klebsiella sp. strain TR5 plasmid pYK5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

774. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

775. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

776. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

777. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

778. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

779. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

780. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

781. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

782. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

783. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

784. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

785. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

786. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

787. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

788. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

789. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

790. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

791. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

792. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

793. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

794. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

795. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

796. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

797. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

798. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

799. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

800. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

801. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

802. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

803. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

804. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

805. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

806. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

807. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

808. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

809. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

810. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

811. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

812. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

813. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

814. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to KY930324 (Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

815. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

816. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

817. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

818. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

819. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

820. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031572 (Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

821. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP010383 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

822. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

823. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

824. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

825. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

826. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

827. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

828. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

829. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

830. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

831. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP009774 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

832. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

833. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

834. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

835. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

836. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP006925 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

837. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

838. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

839. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

840. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

841. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP006921 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

842. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cttcagctggccgtcgagctgacggatgccgg	Protospacer
** *****************************

843. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032180 (Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

844. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

845. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

846. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

847. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

848. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

849. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

850. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

851. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

852. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

853. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

854. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

855. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

856. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

857. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

858. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

859. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

860. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

861. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

862. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

863. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

864. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

865. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

866. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

867. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP023571 (Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

868. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

869. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

870. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

871. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

872. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

873. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

874. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

875. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

876. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

877. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

878. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

879. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

880. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

881. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

882. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

883. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

884. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

885. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

886. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

887. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

888. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

889. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

890. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

891. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

892. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

893. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

894. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

895. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

896. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP045019 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

897. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

898. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

899. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

900. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

901. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021898 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

902. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

903. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

904. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

905. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

906. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

907. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

908. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

909. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

910. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

911. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

912. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

913. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

914. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

915. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

916. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

917. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP043319 (Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

918. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

919. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

920. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

921. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

922. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

923. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

924. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

925. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

926. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP023186 (Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

927. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

928. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

929. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagatgacggatgccgg	Protospacer
****************** *************

930. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

931. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

932. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

933. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

934. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

935. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

936. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

937. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

938. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

939. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

940. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

941. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

942. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP050812 (Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

943. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

944. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

945. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

946. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

947. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

948. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

949. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

950. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

951. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

952. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

953. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

954. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

955. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

956. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

957. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP030350 (Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg	Protospacer
**************************.*****

958. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

959. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

960. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

961. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

962. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

963. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

964. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

965. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

966. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

967. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

968. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

969. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

970. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

971. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

972. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

973. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

974. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

975. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

976. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

977. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

978. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

979. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

980. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

981. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

982. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

983. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

984. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

985. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

986. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MN268580 (Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

987. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP028274 (Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcggctggccgtcgagctgacggatgccgg	Protospacer
****.***************************

988. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

989. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

990. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

991. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

992. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

993. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

994. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

995. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MG764554 (Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

996. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

997. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

998. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

999. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1000. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1001. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1002. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1003. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1004. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1005. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1006. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1007. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1008. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1009. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1010. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1011. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1012. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 1, identity: 0.969

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg	Protospacer
************************** *****

1013. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1014. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1015. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1016. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1017. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1018. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1019. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1020. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1021. spacer 1.17|2221060|33|CP034053|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1022. spacer 1.17|2221060|33|CP034053|CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1023. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1024. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1025. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1026. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1027. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1028. spacer 1.17|2221060|33|CP034053|CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1029. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1030. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1031. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1032. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1033. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1034. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1035. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1036. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1037. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1038. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1039. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1040. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1041. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1042. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1043. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1044. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1045. spacer 1.17|2221060|33|CP034053|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1046. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1047. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1048. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1049. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1050. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1051. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1052. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1053. spacer 1.17|2221060|33|CP034053|CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1054. spacer 1.17|2221060|33|CP034053|CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1055. spacer 1.17|2221060|33|CP034053|CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1056. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1057. spacer 1.17|2221060|33|CP034053|CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1058. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1059. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1060. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1061. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1062. spacer 1.17|2221060|33|CP034053|CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1063. spacer 1.17|2221060|33|CP034053|CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1064. spacer 1.17|2221060|33|CP034053|CRT matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1065. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1066. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1067. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1068. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1069. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1070. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1071. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1072. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1073. spacer 1.17|2221060|33|CP034053|CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1074. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1075. spacer 1.17|2221060|33|CP034053|CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1076. spacer 1.17|2221060|33|CP034053|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1077. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP051433 (Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1078. spacer 1.17|2221060|33|CP034053|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1079. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1080. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1081. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1082. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1083. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1084. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1085. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1086. spacer 1.17|2221060|33|CP034053|CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1087. spacer 1.17|2221060|33|CP034053|CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1088. spacer 1.17|2221060|33|CP034053|CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1089. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020526 (Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1090. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1091. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1092. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1093. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025042 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1094. spacer 1.17|2221060|33|CP034053|CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1095. spacer 1.17|2221060|33|CP034053|CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1096. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1097. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011987 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1098. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1099. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1100. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1101. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1102. spacer 1.17|2221060|33|CP034053|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1103. spacer 1.17|2221060|33|CP034053|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1104. spacer 1.17|2221060|33|CP034053|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1105. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1106. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1107. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1108. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1109. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1110. spacer 1.17|2221060|33|CP034053|CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1111. spacer 1.17|2221060|33|CP034053|CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1112. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1113. spacer 1.17|2221060|33|CP034053|CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1114. spacer 1.17|2221060|33|CP034053|CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1115. spacer 1.17|2221060|33|CP034053|CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1116. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1117. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1118. spacer 1.17|2221060|33|CP034053|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1119. spacer 1.17|2221060|33|CP034053|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1120. spacer 1.17|2221060|33|CP034053|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1121. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP010385 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1122. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1123. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1124. spacer 1.17|2221060|33|CP034053|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1125. spacer 1.17|2221060|33|CP034053|CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1126. spacer 1.17|2221060|33|CP034053|CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1127. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1128. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1129. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1130. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1131. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1132. spacer 1.17|2221060|33|CP034053|CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1133. spacer 1.17|2221060|33|CP034053|CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1134. spacer 1.17|2221060|33|CP034053|CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1135. spacer 1.17|2221060|33|CP034053|CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1136. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1137. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1138. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1139. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1140. spacer 1.17|2221060|33|CP034053|CRT matches to MK648236 (Klebsiella sp. strain TR5 plasmid pYK5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1141. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1142. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1143. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1144. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1145. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1146. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1147. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1148. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1149. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1150. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1151. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1152. spacer 1.17|2221060|33|CP034053|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1153. spacer 1.17|2221060|33|CP034053|CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1154. spacer 1.17|2221060|33|CP034053|CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1155. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1156. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1157. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1158. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1159. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1160. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1161. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1162. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1163. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1164. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1165. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1166. spacer 1.17|2221060|33|CP034053|CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1167. spacer 1.17|2221060|33|CP034053|CRT matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1168. spacer 1.17|2221060|33|CP034053|CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1169. spacer 1.17|2221060|33|CP034053|CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1170. spacer 1.17|2221060|33|CP034053|CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1171. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1172. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1173. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1174. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1175. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1176. spacer 1.17|2221060|33|CP034053|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1177. spacer 1.17|2221060|33|CP034053|CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1178. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1179. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1180. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1181. spacer 1.17|2221060|33|CP034053|CRT matches to KY930324 (Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1182. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1183. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1184. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1185. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1186. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1187. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031572 (Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1188. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP010383 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1189. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1190. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1191. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1192. spacer 1.17|2221060|33|CP034053|CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1193. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1194. spacer 1.17|2221060|33|CP034053|CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1195. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1196. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1197. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1198. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP009774 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1199. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1200. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1201. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1202. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1203. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP006925 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1204. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1205. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1206. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1207. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1208. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP006921 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1209. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ccttcagctggccgtcgagctgacggatgccgg	Protospacer
*** *****************************

1210. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032180 (Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1211. spacer 1.17|2221060|33|CP034053|CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1212. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1213. spacer 1.17|2221060|33|CP034053|CRT matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1214. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1215. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1216. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1217. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1218. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1219. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1220. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1221. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1222. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1223. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1224. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1225. spacer 1.17|2221060|33|CP034053|CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1226. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1227. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1228. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1229. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1230. spacer 1.17|2221060|33|CP034053|CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1231. spacer 1.17|2221060|33|CP034053|CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1232. spacer 1.17|2221060|33|CP034053|CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1233. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1234. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP023571 (Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1235. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1236. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1237. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1238. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1239. spacer 1.17|2221060|33|CP034053|CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1240. spacer 1.17|2221060|33|CP034053|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1241. spacer 1.17|2221060|33|CP034053|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1242. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1243. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1244. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1245. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1246. spacer 1.17|2221060|33|CP034053|CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1247. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1248. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1249. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1250. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1251. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1252. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1253. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1254. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1255. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1256. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1257. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1258. spacer 1.17|2221060|33|CP034053|CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1259. spacer 1.17|2221060|33|CP034053|CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1260. spacer 1.17|2221060|33|CP034053|CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1261. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1262. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1263. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP045019 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1264. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1265. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1266. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1267. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1268. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021898 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1269. spacer 1.17|2221060|33|CP034053|CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1270. spacer 1.17|2221060|33|CP034053|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1271. spacer 1.17|2221060|33|CP034053|CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1272. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1273. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1274. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1275. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1276. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1277. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1278. spacer 1.17|2221060|33|CP034053|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1279. spacer 1.17|2221060|33|CP034053|CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1280. spacer 1.17|2221060|33|CP034053|CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1281. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1282. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1283. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1284. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP043319 (Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1285. spacer 1.17|2221060|33|CP034053|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1286. spacer 1.17|2221060|33|CP034053|CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1287. spacer 1.17|2221060|33|CP034053|CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1288. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1289. spacer 1.17|2221060|33|CP034053|CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1290. spacer 1.17|2221060|33|CP034053|CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1291. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1292. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1293. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP023186 (Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1294. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1295. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1296. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagatgacggatgccgg	Protospacer
******************* *************

1297. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1298. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1299. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1300. spacer 1.17|2221060|33|CP034053|CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1301. spacer 1.17|2221060|33|CP034053|CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1302. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1303. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1304. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1305. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1306. spacer 1.17|2221060|33|CP034053|CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1307. spacer 1.17|2221060|33|CP034053|CRT matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1308. spacer 1.17|2221060|33|CP034053|CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1309. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP050812 (Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1310. spacer 1.17|2221060|33|CP034053|CRT matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1311. spacer 1.17|2221060|33|CP034053|CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1312. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1313. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1314. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1315. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1316. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1317. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1318. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1319. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1320. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1321. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1322. spacer 1.17|2221060|33|CP034053|CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1323. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1324. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP030350 (Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg	Protospacer
***************************.*****

1325. spacer 1.17|2221060|33|CP034053|CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1326. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1327. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1328. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1329. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1330. spacer 1.17|2221060|33|CP034053|CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1331. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1332. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1333. spacer 1.17|2221060|33|CP034053|CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1334. spacer 1.17|2221060|33|CP034053|CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1335. spacer 1.17|2221060|33|CP034053|CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1336. spacer 1.17|2221060|33|CP034053|CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1337. spacer 1.17|2221060|33|CP034053|CRT matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1338. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1339. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1340. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1341. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1342. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1343. spacer 1.17|2221060|33|CP034053|CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1344. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1345. spacer 1.17|2221060|33|CP034053|CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1346. spacer 1.17|2221060|33|CP034053|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1347. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1348. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1349. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1350. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1351. spacer 1.17|2221060|33|CP034053|CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1352. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1353. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MN268580 (Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1354. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028274 (Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcggctggccgtcgagctgacggatgccgg	Protospacer
*****.***************************

1355. spacer 1.17|2221060|33|CP034053|CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1356. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1357. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1358. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1359. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1360. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1361. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1362. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MG764554 (Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1363. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1364. spacer 1.17|2221060|33|CP034053|CRT matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1365. spacer 1.17|2221060|33|CP034053|CRT matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1366. spacer 1.17|2221060|33|CP034053|CRT matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1367. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1368. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1369. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1370. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1371. spacer 1.17|2221060|33|CP034053|CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1372. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1373. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1374. spacer 1.17|2221060|33|CP034053|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1375. spacer 1.17|2221060|33|CP034053|CRT matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1376. spacer 1.17|2221060|33|CP034053|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1377. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1378. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1379. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 1, identity: 0.97

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg	Protospacer
*************************** *****

1380. spacer 2.3|2230085|33|CP034053|PILER-CR matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 1, identity: 0.97

ccgttggcgggacagttttttcactgacaggta	CRISPR spacer
ccgttggcgggacagttttttcactgaccggta	Protospacer
**************************** ****

1381. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1382. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1383. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1384. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1385. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1386. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1387. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1388. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1389. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca	Protospacer
.********************************

1390. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1391. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1392. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1393. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1394. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1395. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1396. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1397. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1398. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1399. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1400. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1401. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1402. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1403. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1404. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1405. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1406. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1407. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1408. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1409. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1410. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1411. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1412. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1413. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca	Protospacer
*** *****************************

1414. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1415. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1416. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1417. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1418. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1419. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1420. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1421. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1422. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1423. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1424. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1425. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1426. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1427. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1428. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1429. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1430. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1431. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1432. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1433. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1434. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1435. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1436. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1437. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1438. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1439. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1440. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1441. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1442. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1443. spacer 2.10|2230512|33|CP034053|PILER-CR matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1444. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1445. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1446. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1447. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1448. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1449. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1450. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1451. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1452. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1453. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1454. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1455. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1456. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1457. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1458. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1459. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1460. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca	Protospacer
*** *****************************

1461. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca	Protospacer
*** *****************************

1462. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1463. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1464. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1465. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1466. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1467. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1468. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1469. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1470. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1471. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1472. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1473. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1474. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1475. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1476. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1477. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1478. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccaccgtttaatcgcggtgatgatatccggca	Protospacer
***.*****************************

1479. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccaccgtttaatcgcggtgatgatatccggca	Protospacer
***.*****************************

1480. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1481. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1482. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1483. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1484. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1485. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1486. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1487. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1488. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1489. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1490. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1491. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1492. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1493. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1494. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1495. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1496. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1497. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1498. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1499. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1500. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1501. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1502. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1503. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1504. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1505. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1506. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1507. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1508. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1509. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1510. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1511. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1512. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1513. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1514. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1515. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1516. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1517. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1518. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1519. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1520. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1521. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1522. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1523. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1524. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1525. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1526. spacer 2.10|2230512|33|CP034053|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1527. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1528. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1529. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca	Protospacer
*** *****************************

1530. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1531. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1532. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1533. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1534. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1535. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1536. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1537. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1538. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1539. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1540. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1541. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1542. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1543. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1544. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1545. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1546. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1547. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1548. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1549. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1550. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1551. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1552. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1553. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1554. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1555. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1556. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1557. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1558. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1559. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1560. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1561. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1562. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1563. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1564. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1565. spacer 2.10|2230512|33|CP034053|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1566. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1567. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1568. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1569. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1570. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1571. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1572. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1573. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1574. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1575. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1576. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1577. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1578. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1579. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1580. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1581. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP018749 (Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1582. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1583. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1584. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1585. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1586. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP036367 (Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1587. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1588. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1589. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1590. spacer 2.10|2230512|33|CP034053|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1591. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1592. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1593. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1594. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1595. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1596. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca	Protospacer
******************************.**

1597. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1598. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1599. spacer 2.10|2230512|33|CP034053|PILER-CR matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.97

tccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca	Protospacer
********** **********************

1600. spacer 2.13|2230086|32|CP034053|CRISPRCasFinder,CRT matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 1, identity: 0.969

cgttggcgggacagttttttcactgacaggta	CRISPR spacer
cgttggcgggacagttttttcactgaccggta	Protospacer
*************************** ****

1601. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1602. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1603. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1604. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1605. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1606. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1607. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1608. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1609. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1610. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1611. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1612. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1613. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1614. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1615. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1616. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1617. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1618. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1619. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1620. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1621. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1622. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1623. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1624. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca	Protospacer
** *****************************

1625. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1626. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1627. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1628. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1629. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1630. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1631. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1632. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1633. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1634. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1635. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1636. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1637. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1638. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1639. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1640. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1641. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1642. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1643. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1644. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1645. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1646. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1647. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggta	Protospacer
******************************.*

1648. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1649. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1650. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1651. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1652. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1653. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1654. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1655. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1656. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1657. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1658. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1659. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1660. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1661. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1662. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1663. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1664. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1665. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1666. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1667. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1668. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1669. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1670. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1671. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1672. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca	Protospacer
** *****************************

1673. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca	Protospacer
** *****************************

1674. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1675. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1676. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1677. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1678. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1679. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1680. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1681. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1682. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1683. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1684. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1685. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1686. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1687. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1688. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1689. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1690. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccaccgtttaatcgcggtgatgatatccggca	Protospacer
**.*****************************

1691. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccaccgtttaatcgcggtgatgatatccggca	Protospacer
**.*****************************

1692. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1693. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1694. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1695. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1696. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1697. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1698. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1699. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1700. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1701. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1702. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1703. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1704. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1705. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1706. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1707. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1708. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1709. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1710. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1711. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1712. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1713. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1714. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1715. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1716. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1717. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1718. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1719. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1720. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1721. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1722. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1723. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1724. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1725. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1726. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1727. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1728. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1729. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1730. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1731. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1732. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1733. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1734. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1735. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1736. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1737. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1738. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1739. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1740. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1741. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca	Protospacer
** *****************************

1742. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1743. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1744. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1745. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1746. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1747. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1748. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1749. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1750. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1751. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1752. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1753. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1754. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1755. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1756. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1757. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1758. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1759. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1760. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1761. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1762. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1763. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1764. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1765. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1766. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1767. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1768. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1769. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1770. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1771. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1772. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1773. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1774. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1775. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1776. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1777. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1778. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1779. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1780. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1781. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1782. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1783. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1784. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1785. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1786. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1787. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1788. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1789. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1790. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1791. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1792. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1793. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP018749 (Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1794. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1795. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1796. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1797. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1798. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP036367 (Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1799. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1800. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1801. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1802. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1803. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1804. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1805. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1806. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1807. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1808. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca	Protospacer
*****************************.**

1809. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1810. spacer 2.20|2230513|32|CP034053|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccgtttaatcgcggtgatgatatccggca	CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca	Protospacer
********* **********************

1811. spacer 1.3|2220754|33|CP034053|PILER-CR,CRT matches to KC139649 (Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.939

cgtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
cgtcatcagtgccttgttccagcgacgaccacc	Protospacer
*********.**************.********

1812. spacer 1.3|2220754|33|CP034053|PILER-CR,CRT matches to KC139634 (Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.939

cgtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
cgtcatcagtgccttgttccagcgacgaccacc	Protospacer
*********.**************.********

1813. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 2, identity: 0.939

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagttgtcatagtcctcggtaatgtcctcga	Protospacer
******.***.**********************

1814. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
tccagtcatcgtagtcctcagtaatgtcctcga	Protospacer
*******.***********.*************

1815. spacer 1.9|2220755|32|CP034053|CRISPRCasFinder matches to KC139649 (Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.938

gtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
gtcatcagtgccttgttccagcgacgaccacc	Protospacer
********.**************.********

1816. spacer 1.9|2220755|32|CP034053|CRISPRCasFinder matches to KC139634 (Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.938

gtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
gtcatcagtgccttgttccagcgacgaccacc	Protospacer
********.**************.********

1817. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 2, identity: 0.938

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagttgtcatagtcctcggtaatgtcctcga	Protospacer
*****.***.**********************

1818. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 2, identity: 0.938

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ccagtcatcgtagtcctcagtaatgtcctcga	Protospacer
******.***********.*************

1819. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1820. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg	Protospacer
************** *********** *****

1821. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgatggaggccgg	Protospacer
**********************.*** *****

1822. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg	Protospacer
************** *********** *****

1823. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg	Protospacer
************** *********** *****

1824. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg	Protospacer
************** *********** *****

1825. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1826. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgatggaggccgg	Protospacer
**********************.*** *****

1827. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgaaggccgg	Protospacer
************************.* *****

1828. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
atgcagctggccgttgagctgacggatgccgg	Protospacer
 *************.*****************

1829. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ttgcagctggccgtcgagctgacggaggccgg	Protospacer
.************************* *****

1830. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
atgcagctggccgtggagctgacggatgccgg	Protospacer
 ************* *****************

1831. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1832. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagcttacggacgccgg	Protospacer
******************** *****.*****

1833. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1834. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1835. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1836. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1837. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg	Protospacer
************** *********** *****

1838. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1839. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KX808482 (Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1840. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1841. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1842. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1843. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1844. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1845. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1846. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1847. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1848. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1849. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1850. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1851. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1852. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1853. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1854. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1855. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1856. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1857. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1858. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1859. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1860. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1861. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1862. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1863. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1864. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1865. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP013191 (Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1866. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1867. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1868. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1869. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to KY075659 (Escherichia coli strain GD80 plasmid pGD80-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1870. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1871. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP042500 (Enterobacter sp. E76 plasmid pE76_001, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtggagctgacggacgccgg	Protospacer
************** ***********.*****

1872. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1873. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024468 (Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1874. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1875. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP053733 (Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1876. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1877. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1878. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1879. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1880. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP017848 (Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1881. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP017848 (Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1882. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1883. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1884. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1885. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1886. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1887. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP054315 (Escherichia coli strain SCU-483 plasmid pSCU-483-2) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1888. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1889. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1890. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_010488 (Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1891. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024277 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1892. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP047091 (Salmonella sp. S13 plasmid pS13-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1893. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1894. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_009786 (Escherichia coli O139:H28 str. E24377A plasmid pETEC_80, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg	Protospacer
*********** ** *****************

1895. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1896. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1897. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1898. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1899. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1900. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP044402 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1901. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_025198 (Escherichia coli plasmid pJIE512b, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1902. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgttgagctgacggacgccgg	Protospacer
**************.***********.*****

1903. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1904. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1905. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1906. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1907. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1908. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1909. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1910. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1911. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP054943 (Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1912. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP024287 (Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1913. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP019248 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1914. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP019269 (Escherichia coli strain 13C1079T plasmid p13C1079T-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1915. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP019269 (Escherichia coli strain 13C1079T plasmid p13C1079T-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1916. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029244 (Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1917. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP031549 (Escherichia coli strain cq9 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1918. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1919. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052784 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1920. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1921. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1922. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1923. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1924. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1925. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1926. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP038392 (Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1927. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1928. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1929. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MH579767 (Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1930. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1931. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1932. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1933. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP038417 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1934. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP038388 (Escherichia coli O157:H7 strain DEC5D plasmid pDEC5D-3, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1935. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP040923 (Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1936. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NC_009425 (Enterobacter sp. 638 plasmid pENTE01, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtggaactgacggatgccgg	Protospacer
************** **.**************

1937. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP044137 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1938. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg	Protospacer
************** *********** *****

1939. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1940. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1941. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1942. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1943. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1944. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1945. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************ * *****

1946. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1947. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1948. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041438 (Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1949. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1950. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1951. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1952. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP038298 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1953. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP042618 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1954. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1955. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1956. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg	Protospacer
************************** * ***

1957. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP038397 (Escherichia coli O157:H7 strain DEC5A plasmid pDEC5A-4, complete sequence) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1958. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_LT985283 (Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI) position: , mismatch: 2, identity: 0.938

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg	Protospacer
***********.**************.*****

1959. spacer 1.15|2221122|32|CP034053|CRISPRCasFinder matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 2, identity: 0.938

tcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
tcatcacgtgtgagcggatctggttctatcct	Protospacer
*******************.***.********

1960. spacer 1.15|2221122|32|CP034053|CRISPRCasFinder matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.938

tcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
tcatcacgtgtgagcggatctggttctatcct	Protospacer
*******************.***.********

1961. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1962. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

1963. spacer 1.17|2221060|33|CP034053|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgatggaggccgg	Protospacer
***********************.*** *****

1964. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

1965. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

1966. spacer 1.17|2221060|33|CP034053|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

1967. spacer 1.17|2221060|33|CP034053|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1968. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgatggaggccgg	Protospacer
***********************.*** *****

1969. spacer 1.17|2221060|33|CP034053|CRT matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgaaggccgg	Protospacer
*************************.* *****

1970. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagcttacggacgccgg	Protospacer
********************* *****.*****

1971. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1972. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

1973. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1974. spacer 1.17|2221060|33|CP034053|CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1975. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1976. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1977. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1978. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
catgcagctggccgttgagctgacggatgccgg	Protospacer
* *************.*****************

1979. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP042500 (Enterobacter sp. E76 plasmid pE76_001, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtggagctgacggacgccgg	Protospacer
*************** ***********.*****

1980. spacer 1.17|2221060|33|CP034053|CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1981. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1982. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggctgtcgagctgacggacgccgg	Protospacer
************.**************.*****

1983. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1984. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgttgagctgacggacgccgg	Protospacer
***************.***********.*****

1985. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1986. spacer 1.17|2221060|33|CP034053|CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1987. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1988. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1989. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1990. spacer 1.17|2221060|33|CP034053|CRT matches to NC_009425 (Enterobacter sp. 638 plasmid pENTE01, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtggaactgacggatgccgg	Protospacer
*************** **.**************

1991. spacer 1.17|2221060|33|CP034053|CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

1992. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1993. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1994. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1995. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1996. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1997. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

1998. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

1999. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2000. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2001. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2002. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2003. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2004. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2005. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021688 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2006. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2007. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2008. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2009. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2010. spacer 1.17|2221060|33|CP034053|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2011. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2012. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2013. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgccgagctgacggaggccgg	Protospacer
**************.************ *****

2014. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2015. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2016. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2017. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2018. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2019. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2020. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2021. spacer 1.17|2221060|33|CP034053|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2022. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2023. spacer 1.17|2221060|33|CP034053|CRT matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2024. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2025. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2026. spacer 1.17|2221060|33|CP034053|CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2027. spacer 1.17|2221060|33|CP034053|CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2028. spacer 1.17|2221060|33|CP034053|CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2029. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2030. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2031. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2032. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2033. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2034. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2035. spacer 1.17|2221060|33|CP034053|CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2036. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2037. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2038. spacer 1.17|2221060|33|CP034053|CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2039. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2040. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2041. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2042. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2043. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2044. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2045. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2046. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2047. spacer 1.17|2221060|33|CP034053|CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2048. spacer 1.17|2221060|33|CP034053|CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2049. spacer 1.17|2221060|33|CP034053|CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2050. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2051. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP021777 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggatgttgg	Protospacer
*****************************..**

2052. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2053. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2054. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MK773538 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-D, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2055. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2056. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2057. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2058. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgaactgacggaggccgg	Protospacer
******************.******** *****

2059. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
catgcagctggccgtggagctgacggatgccgg	Protospacer
* ************* *****************

2060. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MH909329 (Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggcagg	Protospacer
*************************** ** **

2061. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2062. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MG764547 (Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2063. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2064. spacer 1.17|2221060|33|CP034053|CRT matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2065. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2066. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg	Protospacer
*************************** * ***

2067. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2068. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg	Protospacer
************************* * *****

2069. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg	Protospacer
*************** *********** *****

2070. spacer 1.18|2221121|33|CP034053|CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 2, identity: 0.939

ttcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct	Protospacer
********************.***.********

2071. spacer 1.18|2221121|33|CP034053|CRT matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939

ttcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct	Protospacer
********************.***.********

2072. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tttgcagctggccgtcgagctgacggaggccgg	Protospacer
..************************* *****

2073. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2074. spacer 1.17|2221060|33|CP034053|CRT matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggcagtggagctgacggatgccgg	Protospacer
.*********** ** *****************

2075. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2076. spacer 1.17|2221060|33|CP034053|CRT matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2077. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2078. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KX808482 (Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2079. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2080. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2081. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2082. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2083. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2084. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2085. spacer 1.17|2221060|33|CP034053|CRT matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2086. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2087. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2088. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2089. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2090. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2091. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2092. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2093. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2094. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2095. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2096. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2097. spacer 1.17|2221060|33|CP034053|CRT matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2098. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2099. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP013191 (Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggcagtggagctgacggatgccgg	Protospacer
.*********** ** *****************

2100. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 3, identity: 0.909

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg	Protospacer
.***********.**************.*****

2101. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 5, identity: 0.848

---cgtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
cttcgtgtc---gcgcagctcgtagccgagcgagtc	Protospacer
   ******   ***** ************* ****

2102. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 5, identity: 0.844

---gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
ttcgtgtc---gcgcagctcgtagccgagcgagtc	Protospacer
   *****   ***** ************* ****

2103. spacer 1.14|2221061|32|CP034053|CRISPRCasFinder matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 5, identity: 0.844

ctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
ctgcagctggctgtcgagctgacggacagtgg	Protospacer
***********.**************.. .**

2104. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

tcgcat-ggcccgatctcggcgccgccggtggc	CRISPR spacer
-gacatcggcccgatctcggcgctggcggtggc	Protospacer
  .*** ****************.* *******

2105. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.844

tcgcatggcccgatctcggcgccgccggtggc-	CRISPR spacer
ccgcctggcccgatctcggcgccacc-ctggcg	Protospacer
.*** ******************.**  **** 

2106. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.844

-tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
ttcgcgc-gcccgatctcggcgctgccggtgcc	Protospacer
 ****.. ***************.******* *

2107. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 6, identity: 0.812

gtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
****************.*.*****  * ***  

2108. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812

gtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
****************.*.*****  * ***  

2109. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812

gtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
****************.*.*****  * ***  

2110. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

gtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
****************.*.*****  * ***  

2111. spacer 1.9|2220755|32|CP034053|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 6, identity: 0.812

gtcatcagcgccttgttccagcggcgaccacc-	CRISPR spacer
gagatcagcgcgttgttccatcggcg-cgaccg	Protospacer
*  ******** ******** ***** * *** 

2112. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_030917 (Gordonia phage OneUp, complete genome) position: , mismatch: 6, identity: 0.812

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ctcgccgtcgtaggcctcggtgatgtcctcgg	Protospacer
*. *.******** *******.*********.

2113. spacer 1.17|2221060|33|CP034053|CRT matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 6, identity: 0.818

cctgcagctggccgtcgagctgacggatgccgg	CRISPR spacer
tctgcagctggctgtcgagctgacggacagtgg	Protospacer
.***********.**************.. .**

2114. spacer 2.1|2229963|33|CP034053|PILER-CR matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818

ttcgcat-ggcccgatctcggcgccgccggtggc	CRISPR spacer
-ggacatcggcccgatctcggcgctggcggtggc	Protospacer
   .*** ****************.* *******

2115. spacer 2.1|2229963|33|CP034053|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.818

ttcgcatggcccgatctcggcgccgccggtggc-	CRISPR spacer
gccgcctggcccgatctcggcgccacc-ctggcg	Protospacer
 .*** ******************.**  **** 

2116. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.812

tcgcatggc-ccgatctcggcgccgccggtggc	CRISPR spacer
-tccatgacgccgatctcggcgaggccggtggc	Protospacer
 . ****.* ************  *********

2117. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MT522001 (Microbacterium phage Karate, complete genome) position: , mismatch: 6, identity: 0.812

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agtgccatg--ccgatctcggagacgccggtggc	Protospacer
  *  ****  ********** * **********

2118. spacer 2.12|2230025|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gacggacataccgcgctgcccggtctgcggca	CRISPR spacer
gccggacataccgcgccgcccggtcttgcgct	Protospacer
* **************.*********   ** 

2119. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.788

---cgtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
ttccgtctt---gcgcgcctcgtagccgatccagtc	Protospacer
   *** *.   ****.************ ******

2120. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.788

cgtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
.****************.*.*****  * ***  

2121. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.788

cgtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
.****************.*.*****  * ***  

2122. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788

cgtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
.****************.*.*****  * ***  

2123. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 7, identity: 0.788

cgtgtcgaagcgcacctcgtagccgagccagtc-	CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc	Protospacer
.****************.*.*****  * ***  

2124. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to NC_030917 (Gordonia phage OneUp, complete genome) position: , mismatch: 7, identity: 0.788

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
cctcgccgtcgtaggcctcggtgatgtcctcgg	Protospacer
.*. *.******** *******.*********.

2125. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781

---gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
tccgtctt---gcgcgcctcgtagccgatccagtc	Protospacer
   ** *.   ****.************ ******

2126. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 7, identity: 0.781

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ctcgccctcgtaggcctcggtgatgtcctcgg	Protospacer
*. *.* ****** *******.*********.

2127. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.788

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
tccgatcggcgtccgcgccagggcaatcacgac	Protospacer
 **  .******************.******  

2128. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.794

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ttccgatcggcgtccgcgccagggcaatcacgac	Protospacer
* **  .******************.******  

2129. spacer 2.2|2230024|33|CP034053|PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tgacggacataccgcgctgcccggtctgcggca	CRISPR spacer
cgccggacataccgcgccgcccggtcttgcgct	Protospacer
.* **************.*********   ** 

2130. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.781

-tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
aacaaattg-ccgatctcggcgccgtgggtggc	Protospacer
  *. ** * ***************. ******

2131. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcatggc----ccgatctcggcgccgccggtggc	CRISPR spacer
----aaggcttttccgatctcggcgccggtggtggc	Protospacer
    * ***    *************** .******

2132. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.781

-tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
aacaaattg-ccgatctcggcgccgtgggtggc	Protospacer
  *. ** * ***************. ******

2133. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2134. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MH825699 (Streptomyces phage Darolandstone, complete genome) position: , mismatch: 7, identity: 0.781

tcgcatggc--ccgatctcggcgccgccggtggc	CRISPR spacer
--gggtcgccgccggtctcgccgccgccggtggc	Protospacer
  * .* **  ***.***** *************

2135. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MK737941 (Microbacterium phage Rachella, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2136. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MK801732 (Microbacterium phage NarutoRun, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2137. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NC_047986 (Microbacterium phage Krampus, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2138. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MK801731 (Microbacterium phage Anakin, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2139. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2140. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MH271292 (Microbacterium phage AnnaSerena, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2141. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2142. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 7, identity: 0.781

--tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc	Protospacer
  .  ****  ********** * **********

2143. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 8, identity: 0.758

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
cctcgccctcgtaggcctcggtgatgtcctcgg	Protospacer
.*. *.* ****** *******.*********.

2144. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to MT684587 (Microbacterium phage Fede, complete genome) position: , mismatch: 8, identity: 0.75

gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
ttgtcgatgcggacctcgtagccgaactgcac	Protospacer
 ****** *** *************.*..  *

2145. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.75

gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
agctcgacgcgcacctcgaagccgaggtagac	Protospacer
.  **** ********** ******* .** *

2146. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

-gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
cgcgac-cagcgcacctcgtcgccgtgccagcg	Protospacer
 *.* *  ************ **** *****. 

2147. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 8, identity: 0.75

gtgtcgaagcgcacctcgtagccgagccagtc---	CRISPR spacer
ttgtcgaagcgcacctcgacgccg---caattctg	Protospacer
 *****************  ****   **.*.   

2148. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KT373978 (Mycobacterium phage Ukulele, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2149. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MF668277 (Mycobacterium phage MadamMonkfish, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2150. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK433262 (Mycobacterium phage Nimrod, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2151. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2152. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH651174 (Mycobacterium phage Easy2Say, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2153. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH000607 (Mycobacterium phage RiverMonster, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2154. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2155. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MT114165 (Mycobacterium phage BadStone, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2156. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MG872831 (Mycobacterium phage Asriel, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2157. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK757445 (Mycobacterium phage Lilizi, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2158. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH576953 (Mycobacterium phage Hopey, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2159. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KX834009 (Mycobacterium phage Goldilocks, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2160. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MG099953 (Mycobacterium phage Youngblood, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2161. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2162. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to AY129331 (Mycobacterium virus Cjw1, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2163. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586043 (Mycobacterium phage Buck, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2164. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH536829 (Mycobacterium phage TBrady12, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2165. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN096364 (Mycobacterium phage Tomaszewski, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2166. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH590587 (Mycobacterium phage xkcd, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2167. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH371112 (Mycobacterium phage Adnama, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2168. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KX611831 (Mycobacterium phage Pharsalus, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2169. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_042027 (Mycobacterium phage Pumpkin, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2170. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KF493883 (Mycobacterium phage Mosby, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2171. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH513978 (Mycobacterium phage Phaja, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2172. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN428059 (Mycobacterium phage Kanye, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2173. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KY549152 (Mycobacterium phage Maxxinista, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2174. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH399778 (Mycobacterium phage Icee, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2175. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MF919529 (Mycobacterium phage Sassay, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2176. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH513972 (Mycobacterium phage IHOP, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2177. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586051 (Mycobacterium phage Myrale, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2178. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK359309 (Mycobacterium phage Czyszczon1, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2179. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KU865303 (Mycobacterium phage TeardropMSU, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2180. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586041 (Mycobacterium phage Elite2014, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2181. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MF919524 (Mycobacterium phage MISSy, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2182. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2183. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MT952854 (Mycobacterium phage Miniwave, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2184. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2185. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH536827 (Mycobacterium phage Simpliphy, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2186. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2187. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586035 (Mycobacterium phage ChosenOne, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2188. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KR080204 (Mycobacterium phage Mindy, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2189. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to DQ398041 (Mycobacterium virus 244, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2190. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MG872832 (Mycobacterium phage Barbarian, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2191. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_029079 (Mycobacterium phage Dusk, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2192. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586032 (Mycobacterium phage Command613, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2193. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2194. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2195. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_022065 (Mycobacterium phage Contagion, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2196. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KX817173 (Mycobacterium phage Tuco, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2197. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2198. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MG757160 (Mycobacterium phage Kimchi, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2199. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN096361 (Mycobacterium phage Gator, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2200. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586013 (Mycobacterium phage Traaww1, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2201. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH020247 (Mycobacterium phage MPhalcon, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2202. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to JN391441 (Mycobacterium phage Elph10, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2203. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KF306380 (Mycobacterium phage DrDrey, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2204. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH576956 (Mycobacterium phage Inca, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2205. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK620893 (Mycobacterium phage HanKaySha, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2206. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH779503 (Mycobacterium phage Gemini, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2207. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2208. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586019 (Mycobacterium phage Stark, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2209. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586050 (Mycobacterium phage Lilpickle, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2210. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_041850 (Mycobacterium phage Eureka, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2211. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KF562099 (Mycobacterium phage Bruin, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2212. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2213. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2214. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2215. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2216. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_008194 (Mycobacterium phage 244, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2217. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to JF937091 (Mycobacterium phage Bask21, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2218. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KF188414 (Mycobacterium phage ABCat, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2219. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to JN006062 (Mycobacterium phage Rakim, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2220. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK801726 (Mycobacterium phage ChotaBhai, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2221. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH727557 (Mycobacterium phage Paperbeatsrock, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2222. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KF279417 (Mycobacterium phage Quink, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2223. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH399774 (Mycobacterium phage DoctorDiddles, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2224. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_028785 (Mycobacterium phage NelitzaMV, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2225. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586044 (Mycobacterium phage Rimmer, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2226. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2227. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KT020852 (Mycobacterium phage NoSleep, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2228. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MK559429 (Mycobacterium phage Moldemort, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2229. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MF919535 (Mycobacterium phage Terminus, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2230. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2231. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_021305 (Mycobacterium phage Murphy, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2232. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MT522005 (Mycobacterium phage Misfit, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2233. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586037 (Mycobacterium phage GooberAzure, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2234. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to KC691255 (Mycobacterium phage Dumbo, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2235. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to EU816591 (Mycobacterium phage Kostya, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2236. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MN586034 (Mycobacterium phage Hoonter, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2237. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_022085 (Mycobacterium phage Goku, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2238. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_004681 (Mycobacterium phage Cjw1, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2239. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to MH513983 (Mycobacterium phage ShereKhan, complete genome) position: , mismatch: 8, identity: 0.75

ccagtcgt--cgtagtcctcggtaatgtcctcga	CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc	Protospacer
  .*.**.  ********** *.********** 

2240. spacer 2.7|2230329|33|CP034053|PILER-CR matches to NC_048198 (Erwinia phage vB_EhrS_59, complete genome) position: , mismatch: 8, identity: 0.758

tgtcgtcac-atagtgctctatccactggttagc	CRISPR spacer
-gcagccctgatagtgctcgatccaccggttagc	Protospacer
 *. *.* . ********* ******.*******

2241. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
aggaagcggccgatctcggcgtcgccgttggc	Protospacer
  * *  * ************.***** ****

2242. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
ttgaagcgcacgatctcggcgccgacggtgaa	Protospacer
*.* *  ** ************** *****. 

2243. spacer 2.12|2230025|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gacggacataccgcgctgcccggtctgcggca	CRISPR spacer
gacaccaataccgcgctgcccgcactgcggtg	Protospacer
***.   ***************  ******..

2244. spacer 1.2|2220693|33|CP034053|PILER-CR,CRT matches to MT684587 (Microbacterium phage Fede, complete genome) position: , mismatch: 9, identity: 0.727

cgtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
gttgtcgatgcggacctcgtagccgaactgcac	Protospacer
  ****** *** *************.*..  *

2245. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
cacgcgcagcgcacctcgcagccgagcacggc	Protospacer
    ** ***********.********  * *

2246. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 9, identity: 0.719

gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
aagtcgaagcgcatctggtagccgaacacgct	Protospacer
. ***********.** ********.*  *..

2247. spacer 1.8|2220694|32|CP034053|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtcgaagcgcacctcgtagccgagccagtc	CRISPR spacer
aaggcgaagcgcggctcgtagccgagcaggcg	Protospacer
. * ********. ************* .*. 

2248. spacer 1.9|2220755|32|CP034053|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
gagataaccgccttgttccagcggcgcgcctt	Protospacer
*  ** * ******************  * ..

2249. spacer 1.10|2220816|32|CP034053|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.719

ccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
ggcgatgtcgtcgtcctcggtgatgtcctcct	Protospacer
   * .***** *********.********  

2250. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2251. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2252. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2253. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2254. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2255. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2256. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2257. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2258. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2259. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2260. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2261. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2262. spacer 1.13|2220999|33|CP034053|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727

acctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca	Protospacer
 *..****** ******** ********  *..

2263. spacer 2.12|2230025|32|CP034053|CRISPRCasFinder,CRT matches to NC_022590 (Brevibacterium sp. Ap13 plasmid pAP13, complete sequence) position: , mismatch: 9, identity: 0.719

gacggacataccgcgctgcccggtctgcggca	CRISPR spacer
aagggacataccgcgcggcccgctctcgctta	Protospacer
.* ************* ***** ***    .*

2264. spacer 2.17|2230330|32|CP034053|CRISPRCasFinder,CRT matches to NC_048198 (Erwinia phage vB_EhrS_59, complete genome) position: , mismatch: 9, identity: 0.719

gtcgtcacatagtgctctatccactggttagc	CRISPR spacer
cagccctgatagtgctcgatccaccggttagc	Protospacer
    .*  ********* ******.*******

2265. spacer 1.4|2220815|33|CP034053|PILER-CR,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.697

tccagtcgtcgtagtcctcggtaatgtcctcga	CRISPR spacer
aggcgatgtcgtcgtcctcggtgatgtcctcct	Protospacer
    * .***** *********.********  

2266. spacer 1.9|2220755|32|CP034053|CRISPRCasFinder matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 10, identity: 0.688

gtcatcagcgccttgttccagcggcgaccacc	CRISPR spacer
aaattttgcgtctagttccagcggcgaccagt	Protospacer
.   *. ***.** **************** .

2267. spacer 1.16|2220998|34|CP034053|CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2268. spacer 1.16|2220998|34|CP034053|CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2269. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2270. spacer 1.16|2220998|34|CP034053|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2271. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2272. spacer 1.16|2220998|34|CP034053|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2273. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2274. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2275. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2276. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2277. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2278. spacer 1.16|2220998|34|CP034053|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2279. spacer 1.16|2220998|34|CP034053|CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706

tacctcccggcgtccgcgccagggcgatcacgtg	CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca	Protospacer
. *..****** ******** ********  *..

2280. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NZ_CP016458 (Blastomonas sp. RAC04 plasmid pBSY18_2, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
cagtctgggccgatctgggcgccgccgggatg	Protospacer
. *. *** ******* *********** .  

2281. spacer 2.11|2229964|32|CP034053|CRISPRCasFinder,CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 11, identity: 0.656

tcgcatggcccgatctcggcgccgccggtggc	CRISPR spacer
agctccagcccgatctcggcgctgccgttgcg	Protospacer
   . ..***************.**** **  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2727610 : 2738497 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_2 3145103 : 3191930 57 Enterobacteria_phage(52.78%) portal,tail,plate,capsid,terminase,tRNA,integrase,transposase,head attL 3150327:3150348|attR 3188192:3188213
DBSCAN-SWA_3 3471097 : 3480560 8 Brazilian_cedratvirus(16.67%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP034057
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 45756 54 Klebsiella_phage(86.27%) capsid,head,portal,terminase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP034055
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 79423 85 Salmonella_phage(88.89%) capsid,terminase,integrase,tail attL 13485:13502|attR 23703:23720
DBSCAN-SWA_2 83347 : 112810 29 Salmonella_phage(80.77%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage