Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027729 Pseudomonas sp. R3-18-08 chromosome, complete genome 1 crisprs csa3,DEDDh,DinG,cas3,PD-DExK 0 2 5 0

Results visualization

1. CP027729
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027729_2 5183911-5184021 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027729_1 1.2|2334937|37|CP027729|CRISPRCasFinder 2334937-2334973 37 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 505688-505724 5 0.865
CP027729_1 1.2|2334937|37|CP027729|CRISPRCasFinder 2334937-2334973 37 NZ_CP028919 Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence 197424-197460 5 0.865
CP027729_1 1.4|2335069|31|CP027729|CRISPRCasFinder 2335069-2335099 31 NZ_CP022681 Streptococcus respiraculi strain HTS25 plasmid unnamed1, complete sequence 22027-22057 8 0.742
CP027729_1 1.4|2335069|31|CP027729|CRISPRCasFinder 2335069-2335099 31 NZ_CP011616 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-118, complete sequence 116193-116223 8 0.742
CP027729_1 1.4|2335069|31|CP027729|CRISPRCasFinder 2335069-2335099 31 NZ_CP017931 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-111, complete sequence 56118-56148 8 0.742
CP027729_1 1.4|2335069|31|CP027729|CRISPRCasFinder 2335069-2335099 31 NZ_CP011594 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-111, complete sequence 104889-104919 8 0.742
CP027729_1 1.4|2335069|31|CP027729|CRISPRCasFinder 2335069-2335099 31 NZ_CP018360 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-111, complete sequence 77702-77732 8 0.742

1. spacer 1.2|2334937|37|CP027729|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.865

agaggcgcgctcgggatcattcctgaagttgccgccg	CRISPR spacer
ggccgcgcgctccggatcattcttgaagttgccgccg	Protospacer
.*  ******** *********.**************

2. spacer 1.2|2334937|37|CP027729|CRISPRCasFinder matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.865

agaggcgcgctcgggatcattcctgaagttgccgccg	CRISPR spacer
agccgcacgctcgggatcattcttgaagttgccgccc	Protospacer
**  **.***************.************* 

3. spacer 1.4|2335069|31|CP027729|CRISPRCasFinder matches to NZ_CP022681 (Streptococcus respiraculi strain HTS25 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ttgataaaactctttatcatgagaagcagac	CRISPR spacer
atgagaaaactcgttatcatgagattgtgtc	Protospacer
 *** ******* ***********    * *

4. spacer 1.4|2335069|31|CP027729|CRISPRCasFinder matches to NZ_CP011616 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-118, complete sequence) position: , mismatch: 8, identity: 0.742

ttgataaaactctttatcatgagaagcagac	CRISPR spacer
ttgataaaacacttcatcatgaggtccgtat	Protospacer
********** ***.********.  *. *.

5. spacer 1.4|2335069|31|CP027729|CRISPRCasFinder matches to NZ_CP017931 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-111, complete sequence) position: , mismatch: 8, identity: 0.742

ttgataaaactctttatcatgagaagcagac	CRISPR spacer
ttgataaaacacttcatcatgaggtccgtat	Protospacer
********** ***.********.  *. *.

6. spacer 1.4|2335069|31|CP027729|CRISPRCasFinder matches to NZ_CP011594 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-111, complete sequence) position: , mismatch: 8, identity: 0.742

ttgataaaactctttatcatgagaagcagac	CRISPR spacer
ttgataaaacacttcatcatgaggtccgtat	Protospacer
********** ***.********.  *. *.

7. spacer 1.4|2335069|31|CP027729|CRISPRCasFinder matches to NZ_CP018360 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-111, complete sequence) position: , mismatch: 8, identity: 0.742

ttgataaaactctttatcatgagaagcagac	CRISPR spacer
ttgataaaacacttcatcatgaggtccgtat	Protospacer
********** ***.********.  *. *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 386526 : 417432 40 Pseudomonas_phage(72.41%) capsid,head,tail,terminase NA
DBSCAN-SWA_2 1305691 : 1345991 50 uncultured_Caudovirales_phage(33.33%) plate,tRNA,tail NA
DBSCAN-SWA_3 1449818 : 1454782 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_4 3457834 : 3467835 12 uncultured_Caudovirales_phage(71.43%) tRNA NA
DBSCAN-SWA_5 5407029 : 5417862 9 Mannheimia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage