Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027713 Pseudomonas chlororaphis strain TAMOak81 chromosome, complete genome 1 crisprs DinG,csa3,cas3,RT,PD-DExK,DEDDh,WYL 0 1 4 0

Results visualization

1. CP027713
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027713_4 4459319-4459422 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027713_1 1.1|2417098|37|CP027713|CRISPRCasFinder 2417098-2417134 37 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 4518-4554 4 0.892

1. spacer 1.1|2417098|37|CP027713|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.892

acggcgccatcggcggcaccggtggcctgatcaagag	CRISPR spacer
ccggcgccatcggcggcaccggcggcctgaccaagac	Protospacer
 *********************.*******.***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1332158 : 1422112 94 Pseudomonas_phage(40.38%) protease,tail,plate,tRNA NA
DBSCAN-SWA_2 2261908 : 2318843 91 Pseudomonas_phage(65.15%) terminase,integrase,tail attL 2262670:2262719|attR 2317205:2317254
DBSCAN-SWA_3 4166014 : 4172247 8 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_4 4792778 : 4799928 8 Enterobacteria_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage