Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033892 Lactobacillus plantarum strain LMT1-48 plasmid p_4, complete sequence 0 crisprs NA 0 0 0 0
CP033888 Lactobacillus plantarum strain LMT1-48 chromosome, complete genome 4 crisprs NA 1 3 0 0
CP033890 Lactobacillus plantarum strain LMT1-48 plasmid p_2, complete sequence 0 crisprs NA 0 0 0 0
CP033891 Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence 1 crisprs NA 0 1 0 0
CP033889 Lactobacillus plantarum strain LMT1-48 plasmid p_1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033888
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033888_1 24300-24448 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033888_2 26730-26895 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033888_3 1715825-1715910 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033888_4 2496894-2497391 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033888_4 4.1|2496912|18|CP033888|CRT 2496912-2496929 18 CP033888.1 1936901-1936918 2 0.889

1. spacer 4.1|2496912|18|CP033888|CRT matches to position: 1936901-1936918, mismatch: 2, identity: 0.889 

gccgctaagaaacataag	CRISPR spacer
gccgctaaggaacatcag	Protospacer
*********.***** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033888_2 2.1|26776|39|CP033888|PILER-CR 26776-26814 39 NC_048084 Lactobacillus phage Iacchus, complete genome 27980-28018 1 0.974
CP033888_2 2.1|26776|39|CP033888|PILER-CR 26776-26814 39 MG557979 Lactobacillus phage Lpa804, complete genome 179-217 1 0.974
CP033888_2 2.1|26776|39|CP033888|PILER-CR 26776-26814 39 MG557979 Lactobacillus phage Lpa804, complete genome 359-397 2 0.949
CP033888_2 2.1|26776|39|CP033888|PILER-CR 26776-26814 39 MH809531 Lactobacillus phage Bromius, complete genome 31196-31234 2 0.949
CP033888_2 2.1|26776|39|CP033888|PILER-CR 26776-26814 39 AY682195 Lactobacillus plantarum bacteriophage LP65, complete genome 75311-75349 3 0.923
CP033888_2 2.1|26776|39|CP033888|PILER-CR 26776-26814 39 NC_006565 Lactobacillus phage LP65, complete genome 75311-75349 3 0.923
CP033888_1 1.1|24353|43|CP033888|CRISPRCasFinder 24353-24395 43 MG557979 Lactobacillus phage Lpa804, complete genome 139364-139406 6 0.86
CP033888_4 4.2|2496948|30|CP033888|CRT 2496948-2496977 30 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 31047-31076 7 0.767
CP033888_4 4.2|2496948|30|CP033888|CRT 2496948-2496977 30 NC_042345 Phage Salvo, complete genome 4721-4750 8 0.733

1. spacer 2.1|26776|39|CP033888|PILER-CR matches to NC_048084 (Lactobacillus phage Iacchus, complete genome) position: , mismatch: 1, identity: 0.974 

tcagattaaagatgaagctgtcaatagcgctaaaattgc	CRISPR spacer
tcagattaaagatgaagctgtcaatagtgctaaaattgc	Protospacer
***************************.***********

2. spacer 2.1|26776|39|CP033888|PILER-CR matches to MG557979 (Lactobacillus phage Lpa804, complete genome) position: , mismatch: 1, identity: 0.974 

tcagattaaagatgaagctgtcaatagcgctaaaattgc	CRISPR spacer
tcagattaaagatgaagctgtcaatagtgctaaaattgc	Protospacer
***************************.***********

3. spacer 2.1|26776|39|CP033888|PILER-CR matches to MG557979 (Lactobacillus phage Lpa804, complete genome) position: , mismatch: 2, identity: 0.949 

tcagattaaagatgaagctgtcaatagcgctaaaattgc	CRISPR spacer
tcagattaaagatgaagctgttaatagcgctaagattgc	Protospacer
*********************.***********.*****

4. spacer 2.1|26776|39|CP033888|PILER-CR matches to MH809531 (Lactobacillus phage Bromius, complete genome) position: , mismatch: 2, identity: 0.949 

tcagattaaagatgaagctgtcaatagcgctaaaattgc	CRISPR spacer
acagattaaagatgaagctgtcaatagtgctaaaattgc	Protospacer
 **************************.***********

5. spacer 2.1|26776|39|CP033888|PILER-CR matches to AY682195 (Lactobacillus plantarum bacteriophage LP65, complete genome) position: , mismatch: 3, identity: 0.923 

tcagattaaagatgaagctgtcaatagcgctaaaattgc	CRISPR spacer
acagattaaagatgaagctgttaatagcgctaagattgc	Protospacer
 ********************.***********.*****

6. spacer 2.1|26776|39|CP033888|PILER-CR matches to NC_006565 (Lactobacillus phage LP65, complete genome) position: , mismatch: 3, identity: 0.923 

tcagattaaagatgaagctgtcaatagcgctaaaattgc	CRISPR spacer
acagattaaagatgaagctgttaatagcgctaagattgc	Protospacer
 ********************.***********.*****

7. spacer 1.1|24353|43|CP033888|CRISPRCasFinder matches to MG557979 (Lactobacillus phage Lpa804, complete genome) position: , mismatch: 6, identity: 0.86 

aatagccgtacagtctaatgctactgccaaagctcagtctaca	CRISPR spacer
aatagccgtacagtctaacgctactgccaaagcccaaagtacg	Protospacer
******************.**************.**.  ***.

8. spacer 4.2|2496948|30|CP033888|CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 7, identity: 0.767 

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
cacaagaataaagccgccaagaagctccgg	Protospacer
******** ***** ********.* . .*

9. spacer 4.2|2496948|30|CP033888|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 8, identity: 0.733 

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
ccggggaagtaagcggacaagaaacatact	Protospacer
*  ..**** ****** ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033891
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033891_1 3294-3395 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NC_017468 Lactobacillus helveticus H10 plasmid pH10, complete sequence 15844-15873 0 1.0
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP033891 Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence 3330-3359 0 1.0
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NC_017017 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence 5387-5416 1 0.967
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014928 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence 6824-6853 1 0.967
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 12632-12661 1 0.967
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 5237-5266 1 0.967
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP031200 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence 39624-39653 1 0.967
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NC_006529 Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence 4742-4771 1 0.967
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014874 Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence 6854-6883 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP027191 Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence 29359-29388 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP027195 Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence 30409-30438 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NC_008498 Lactobacillus brevis ATCC 367 plasmid 1, complete sequence 8762-8791 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NC_015421 Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence 1005-1034 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014900 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence 28835-28864 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014913 Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence 22508-22537 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP019033 Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence 21083-21112 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP017358 Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence 4830-4859 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP017368 Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence 5770-5799 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP017265 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence 26504-26533 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 6891-6920 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 20910-20939 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014934 Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence 5933-5962 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP014937 Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence 5934-5963 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 MK994179 Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence 4885-4914 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP011537 Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence 7181-7210 2 0.933
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 10405-10434 3 0.9
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 86924-86953 3 0.9
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 NZ_AP014682 Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence 515-544 5 0.833
CP033891_1 1.1|3330|30|CP033891|CRISPRCasFinder 3330-3359 30 MN034684 Leviviridae sp. isolate H1_Rhizo_27_scaffold_801 RNA-dependent RNA polymerase (H1Rhizo27801_000001), hypothetical protein (H1Rhizo27801_000002), and hypothetical protein (H1Rhizo27801_000003) genes, complete cds 2054-2083 8 0.733

1. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NC_017468 (Lactobacillus helveticus H10 plasmid pH10, complete sequence) position: , mismatch: 0, identity: 1.0 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaag	Protospacer
******************************

2. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP033891 (Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence) position: , mismatch: 0, identity: 1.0 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaag	Protospacer
******************************

3. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NC_017017 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence) position: , mismatch: 1, identity: 0.967 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
*****************************

4. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014928 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence) position: , mismatch: 1, identity: 0.967 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
*****************************

5. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 1, identity: 0.967 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaat	Protospacer
*****************************

6. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 1, identity: 0.967 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
*****************************

7. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP031200 (Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence) position: , mismatch: 1, identity: 0.967 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaat	Protospacer
*****************************

8. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NC_006529 (Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence) position: , mismatch: 1, identity: 0.967 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacggactttcgcgaag	Protospacer
*****************.************

9. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014874 (Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************

10. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP027191 (Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************

11. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP027195 (Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************

12. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NC_008498 (Lactobacillus brevis ATCC 367 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gtggggtgtcgtcaacgaactttcgcgaac	Protospacer
*.***************************

13. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NC_015421 (Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcgggttgtcgtcaacgaactttcgcgaat	Protospacer
***** ***********************

14. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014900 (Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgttgtcaacgaactttcgcgaat	Protospacer
*********.*******************

15. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014913 (Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

16. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP019033 (Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggagtgtcgtcaacggactttcgcgaag	Protospacer
****.************.************

17. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP017358 (Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

18. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP017368 (Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

19. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP017265 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

20. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

21. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

22. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014934 (Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

23. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP014937 (Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

24. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to MK994179 (Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
**********.******.************

25. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP011537 (Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence) position: , mismatch: 2, identity: 0.933 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggagtgtcgtcaacggactttcgcgaag	Protospacer
****.************.************

26. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 3, identity: 0.9 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggagtgttgtcaacgaactttcgcgaat	Protospacer
****.****.*******************

27. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 3, identity: 0.9 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gcggagtgttgtcaacgaactttcgcgaat	Protospacer
****.****.*******************

28. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to NZ_AP014682 (Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-2, complete sequence) position: , mismatch: 5, identity: 0.833 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
gaggggtgtcgtcaacgaacttatgcggaa	Protospacer
* ******************** .***.*.

29. spacer 1.1|3330|30|CP033891|CRISPRCasFinder matches to MN034684 (Leviviridae sp. isolate H1_Rhizo_27_scaffold_801 RNA-dependent RNA polymerase (H1Rhizo27801_000001), hypothetical protein (H1Rhizo27801_000002), and hypothetical protein (H1Rhizo27801_000003) genes, complete cds) position: , mismatch: 8, identity: 0.733 

gcggggtgtcgtcaacgaactttcgcgaag	CRISPR spacer
cgctggtgtcgtcaacgaacattcgctact	Protospacer
    **************** ***** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage