Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033625 Klebsiella pneumoniae strain 4743 chromosome, complete genome 3 crisprs csa3,RT,cas3,DEDDh,DinG,WYL 2 1 8 0
CP033626 Klebsiella pneumoniae strain 4743 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0
CP033630 Klebsiella pneumoniae strain 4743 plasmid unnamed5 0 crisprs NA 0 0 0 0
CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 0 crisprs RT 0 0 1 0
CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 0 crisprs csa3,cas3,RT 0 0 2 0
CP033629 Klebsiella pneumoniae strain 4743 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
CP033624 Klebsiella pneumoniae strain 4743 plasmid unnamed6 0 crisprs c2c9_V-U4,DEDDh 0 0 1 0

Results visualization

1. CP033625
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033625_1 1188607-1188715 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033625_2 1769263-1769525 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033625_3 2206634-2206735 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033625_2 2.1|1769324|40|CP033625|PILER-CR 1769324-1769363 40 CP033625.1 1769627-1769666 1 0.975
CP033625_2 2.2|1769425|40|CP033625|PILER-CR 1769425-1769464 40 CP033625.1 1769627-1769666 1 0.975

1. spacer 2.1|1769324|40|CP033625|PILER-CR matches to position: 1769627-1769666, mismatch: 1, identity: 0.975

taccccgattagttcgccatcccgtaggcctgataagcga	CRISPR spacer
taccccgattagttcgccattccgtaggcctgataagcga	Protospacer
********************.*******************

2. spacer 2.2|1769425|40|CP033625|PILER-CR matches to position: 1769627-1769666, mismatch: 1, identity: 0.975

taccccgattagttcgccatcccgtaggcctgataagcga	CRISPR spacer
taccccgattagttcgccattccgtaggcctgataagcga	Protospacer
********************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033625_4 4.1|4062611|25|CP033625|CRISPRCasFinder 4062611-4062635 25 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8458-8482 1 0.96
CP033625_4 4.1|4062611|25|CP033625|CRISPRCasFinder 4062611-4062635 25 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8458-8482 1 0.96
CP033625_4 4.1|4062611|25|CP033625|CRISPRCasFinder 4062611-4062635 25 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11394-11418 1 0.96

1. spacer 4.1|4062611|25|CP033625|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.96

ccccgccggtacgcagcgtggttac	CRISPR spacer
cctcgccggtacgcagcgtggttac	Protospacer
**.**********************

2. spacer 4.1|4062611|25|CP033625|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.96

ccccgccggtacgcagcgtggttac	CRISPR spacer
cctcgccggtacgcagcgtggttac	Protospacer
**.**********************

3. spacer 4.1|4062611|25|CP033625|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.96

ccccgccggtacgcagcgtggttac	CRISPR spacer
cctcgccggtacgcagcgtggttac	Protospacer
**.**********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1141947 : 1208963 77 Salmonella_phage(80.43%) tail,integrase,lysis,plate,head,holin,tRNA,capsid,portal attL 1140790:1140827|attR 1197598:1197635
DBSCAN-SWA_2 1310929 : 1322307 18 Morganella_phage(25.0%) integrase attL 1310090:1310104|attR 1318577:1318591
DBSCAN-SWA_3 1333730 : 1399813 72 Salmonella_phage(40.43%) terminase,tail,integrase,holin,protease,capsid,transposase attL 1334725:1334742|attR 1402561:1402578
DBSCAN-SWA_4 1790029 : 1798408 7 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_5 1930054 : 2002737 86 Klebsiella_phage(17.46%) terminase,integrase,tail,holin,head,protease,capsid,portal attL 1918596:1918614|attR 2009555:2009573
DBSCAN-SWA_6 2829979 : 2840866 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3545342 : 3554816 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_8 4031331 : 4076783 66 Cronobacter_phage(26.92%) terminase,coat,tail,integrase,head,holin,tRNA attL 4028285:4028330|attR 4073855:4073900
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033627
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1727 : 67645 59 uncultured_Caudovirales_phage(27.78%) integrase,protease,transposase NA
DBSCAN-SWA_2 159172 : 169816 17 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP033628
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5122 : 54727 53 Escherichia_phage(36.36%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP033624
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 500 : 54773 59 Klebsiella_phage(85.19%) capsid,head,transposase,portal,terminase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP033626
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7709 : 22100 20 Salmonella_phage(20.0%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage