Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031651 Pantoea agglomerans strain TH81 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP031652 Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP031649 Pantoea agglomerans strain TH81 chromosome, complete genome 2 crisprs DEDDh,cas3,DinG 0 1 5 0
CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 2 crisprs csa3 0 3 0 0

Results visualization

1. CP031649
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031649_1 1623736-1623827 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031649_2 1725043-1725187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031649_3 3.1|3137132|36|CP031649|CRISPRCasFinder 3137132-3137167 36 NZ_CP028350 Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence 450705-450740 3 0.917
CP031649_3 3.1|3137132|36|CP031649|CRISPRCasFinder 3137132-3137167 36 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 539547-539582 3 0.917
CP031649_3 3.1|3137132|36|CP031649|CRISPRCasFinder 3137132-3137167 36 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 15104-15139 3 0.917
CP031649_3 3.1|3137132|36|CP031649|CRISPRCasFinder 3137132-3137167 36 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 267195-267230 3 0.917
CP031649_3 3.1|3137132|36|CP031649|CRISPRCasFinder 3137132-3137167 36 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 116013-116048 3 0.917
CP031649_3 3.1|3137132|36|CP031649|CRISPRCasFinder 3137132-3137167 36 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 160153-160188 4 0.889

1. spacer 3.1|3137132|36|CP031649|CRISPRCasFinder matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 3, identity: 0.917

cggctacgggcgcacctcagggatgaggtgcgtact	CRISPR spacer
cgggaacgggcgcacctcagggatgaggtgcgtaat	Protospacer
***  ***************************** *

2. spacer 3.1|3137132|36|CP031649|CRISPRCasFinder matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 3, identity: 0.917

cggctacgggcgcacctcagggatgaggtgcgtact	CRISPR spacer
cgggaacgggcgcacctcagggatgaggtgcgtaat	Protospacer
***  ***************************** *

3. spacer 3.1|3137132|36|CP031649|CRISPRCasFinder matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.917

cggctacgggcgcacctcagggatgaggtgcgtact	CRISPR spacer
cgggaacgggcgcacctcagggatgaggtgcgtaat	Protospacer
***  ***************************** *

4. spacer 3.1|3137132|36|CP031649|CRISPRCasFinder matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 3, identity: 0.917

cggctacgggcgcacctcagggatgaggtgcgtact	CRISPR spacer
cgggaacgggcgcacctcagggatgaggtgcgtaat	Protospacer
***  ***************************** *

5. spacer 3.1|3137132|36|CP031649|CRISPRCasFinder matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 3, identity: 0.917

cggctacgggcgcacctcagggatgaggtgcgtact	CRISPR spacer
cgggaacgggcgcacctcagggatgaggtgcgtaat	Protospacer
***  ***************************** *

6. spacer 3.1|3137132|36|CP031649|CRISPRCasFinder matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.889

cggctacgggcgcacctcagggatgaggtgcgtact	CRISPR spacer
ccggaacgggcgcacctcagggatgaggtgcgtaat	Protospacer
* *  ***************************** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 882614 : 890637 6 uncultured_Mediterranean_phage(33.33%) integrase attL 875629:875641|attR 897168:897180
DBSCAN-SWA_2 1485462 : 1495865 10 Synechococcus_phage(37.5%) NA NA
DBSCAN-SWA_3 2304498 : 2314721 11 Bacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_4 3202668 : 3210394 9 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 3272407 : 3281778 10 Streptococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP031650
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031650_1 1438-1616 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031650_2 1820-1932 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031650_1 1.2|1545|56|CP031650|PILER-CR 1545-1600 56 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 1539-1594 0 1.0
CP031650_2 2.1|1859|35|CP031650|CRISPRCasFinder 1859-1893 35 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 538562-538596 0 1.0
CP031650_2 2.1|1859|35|CP031650|CRISPRCasFinder 1859-1893 35 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 1859-1893 0 1.0
CP031650_1 1.2|1545|56|CP031650|PILER-CR 1545-1600 56 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 538856-538911 1 0.982
CP031650_2 2.1|1859|35|CP031650|CRISPRCasFinder 1859-1893 35 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 475907-475941 1 0.971
CP031650_2 2.1|1859|35|CP031650|CRISPRCasFinder 1859-1893 35 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 175379-175413 1 0.971
CP031650_2 2.1|1859|35|CP031650|CRISPRCasFinder 1859-1893 35 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 18351-18385 1 0.971
CP031650_1 1.1|1460|63|CP031650|PILER-CR 1460-1522 63 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 1454-1516 3 0.952
CP031650_2 2.1|1859|35|CP031650|CRISPRCasFinder 1859-1893 35 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 519762-519796 3 0.914

1. spacer 1.2|1545|56|CP031650|PILER-CR matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccagatgcccggtctgaggcgagtcataactgccatggcgggatgctaatcttg	CRISPR spacer
tgccagatgcccggtctgaggcgagtcataactgccatggcgggatgctaatcttg	Protospacer
********************************************************

2. spacer 2.1|1859|35|CP031650|CRISPRCasFinder matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 0, identity: 1.0

tctactgactcatattacgaccccgtcggcacgcg	CRISPR spacer
tctactgactcatattacgaccccgtcggcacgcg	Protospacer
***********************************

3. spacer 2.1|1859|35|CP031650|CRISPRCasFinder matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tctactgactcatattacgaccccgtcggcacgcg	CRISPR spacer
tctactgactcatattacgaccccgtcggcacgcg	Protospacer
***********************************

4. spacer 1.2|1545|56|CP031650|PILER-CR matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 1, identity: 0.982

tgccagatgcccggtctgaggcgagtcataactgccatggcgggatgctaatcttg	CRISPR spacer
tgccagatgcccggtctgaggcgagtcataactgccatggcgagatgctaatcttg	Protospacer
******************************************.*************

5. spacer 2.1|1859|35|CP031650|CRISPRCasFinder matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tctactgactcatattacgaccccgtcggcacgcg	CRISPR spacer
tctactgactcatattacgaccccgtcggcacgcc	Protospacer
********************************** 

6. spacer 2.1|1859|35|CP031650|CRISPRCasFinder matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 1, identity: 0.971

tctactgactcatattacgaccccgtcggcacgcg	CRISPR spacer
tctactgactcatattacgaccccgtcggcacgcc	Protospacer
********************************** 

7. spacer 2.1|1859|35|CP031650|CRISPRCasFinder matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 1, identity: 0.971

tctactgactcatattacgaccccgtcggcacgcg	CRISPR spacer
tctactgactcatattacgaccccgtcggcacgcc	Protospacer
********************************** 

8. spacer 1.1|1460|63|CP031650|PILER-CR matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.952

tgtctgctgatgggcactatccttgcctcaccattgaatctctttaacggctttccgaat	CRISPR spacer
tgtctgctgatgggcactatccttgcctcaccattgaatctctttaacggctttccgaat	Protospacer
************************************************************

9. spacer 2.1|1859|35|CP031650|CRISPRCasFinder matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 3, identity: 0.914

tctactgactcatattacgaccccgtcggcacgcg	CRISPR spacer
actactgactcatattacgaccctgtcggcacgcc	Protospacer
 **********************.********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage