Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024058 Lactobacillus plantarum strain KACC 92189 chromosome, complete genome 2 crisprs NA 0 9 0 0
CP024061 Lactobacillus plantarum strain KACC 92189 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP024062 Lactobacillus plantarum strain KACC 92189 plasmid unnamed4 0 crisprs NA 0 0 0 0
CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP024059 Lactobacillus plantarum strain KACC 92189 plasmid unnamed1 0 crisprs NA 0 0 0 0

Results visualization

1. CP024058
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024058_1 1421293-1422186 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024058_2 2310540-2310737 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024058_1 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT 1421527-1421556 30 MG788324 Lactobacillus phage PM411, complete genome 18394-18423 0 1.0
CP024058_1 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT 1421527-1421556 30 NZ_CP024415 Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence 29329-29358 0 1.0
CP024058_1 1.11|1421989|30|CP024058|CRISPRCasFinder,CRT 1421989-1422018 30 MG788324 Lactobacillus phage PM411, complete genome 31503-31532 0 1.0
CP024058_1 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT 1421527-1421556 30 NZ_CP018210 Lactobacillus plantarum strain BLS41 plasmid pLPBLS41_1, complete sequence 9497-9526 1 0.967
CP024058_1 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT 1421857-1421886 30 X90511 Lactobacillus bacteriophage phig1e DNA for Rorf162, Holin, Lysin, and Rorf175 genes 2482-2511 2 0.933
CP024058_1 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT 1421857-1421886 30 NC_004305 Lactobacillus phage phig1e, complete genome 7338-7367 2 0.933
CP024058_1 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT 1421857-1421886 30 X98106 Lactobacillus bacteriophage phig1e complete genomic DNA 7338-7367 2 0.933
CP024058_1 1.11|1421989|30|CP024058|CRISPRCasFinder,CRT 1421989-1422018 30 NZ_CP024415 Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence 18018-18047 2 0.933
CP024058_1 1.11|1421989|30|CP024058|CRISPRCasFinder,CRT 1421989-1422018 30 NZ_CP018210 Lactobacillus plantarum strain BLS41 plasmid pLPBLS41_1, complete sequence 36587-36616 2 0.933
CP024058_1 1.19|1421858|29|CP024058|PILER-CR 1421858-1421886 29 NC_004305 Lactobacillus phage phig1e, complete genome 7339-7367 2 0.931
CP024058_1 1.19|1421858|29|CP024058|PILER-CR 1421858-1421886 29 X98106 Lactobacillus bacteriophage phig1e complete genomic DNA 7339-7367 2 0.931
CP024058_1 1.19|1421858|29|CP024058|PILER-CR 1421858-1421886 29 X90511 Lactobacillus bacteriophage phig1e DNA for Rorf162, Holin, Lysin, and Rorf175 genes 2482-2510 2 0.931
CP024058_1 1.17|1421726|29|CP024058|PILER-CR 1421726-1421754 29 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 20170-20198 3 0.897
CP024058_1 1.7|1421725|30|CP024058|CRISPRCasFinder,CRT 1421725-1421754 30 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 20170-20199 4 0.867
CP024058_1 1.13|1422121|30|CP024058|CRISPRCasFinder,CRT 1422121-1422150 30 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 28509-28538 4 0.867
CP024058_1 1.13|1422121|30|CP024058|CRISPRCasFinder,CRT 1422121-1422150 30 JN051154 Pediococcus phage clP1, complete genome 16773-16802 4 0.867
CP024058_1 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT 1421857-1421886 30 NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 79143-79172 6 0.8
CP024058_1 1.17|1421726|29|CP024058|PILER-CR 1421726-1421754 29 KC292026 Halovirus HGTV-1, complete genome 52333-52361 6 0.793
CP024058_1 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT 1421527-1421556 30 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 232868-232897 7 0.767
CP024058_1 1.7|1421725|30|CP024058|CRISPRCasFinder,CRT 1421725-1421754 30 KC292026 Halovirus HGTV-1, complete genome 52332-52361 7 0.767
CP024058_1 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT 1421857-1421886 30 NZ_CP044333 Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence 131307-131336 7 0.767
CP024058_1 1.16|1421660|29|CP024058|PILER-CR 1421660-1421688 29 MN694430 Marine virus AFVG_250M44, complete genome 21950-21978 8 0.724
CP024058_1 1.16|1421660|29|CP024058|PILER-CR 1421660-1421688 29 MN692992 Marine virus AFVG_117M93, complete genome 21942-21970 8 0.724
CP024058_1 1.6|1421659|30|CP024058|CRISPRCasFinder,CRT 1421659-1421688 30 MN694430 Marine virus AFVG_250M44, complete genome 21949-21978 9 0.7
CP024058_1 1.6|1421659|30|CP024058|CRISPRCasFinder,CRT 1421659-1421688 30 MN692992 Marine virus AFVG_117M93, complete genome 21941-21970 9 0.7

1. spacer 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT matches to MG788324 (Lactobacillus phage PM411, complete genome) position: , mismatch: 0, identity: 1.0

taatgccaaccgcttgttagcttcaatctt	CRISPR spacer
taatgccaaccgcttgttagcttcaatctt	Protospacer
******************************

2. spacer 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP024415 (Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence) position: , mismatch: 0, identity: 1.0

taatgccaaccgcttgttagcttcaatctt	CRISPR spacer
taatgccaaccgcttgttagcttcaatctt	Protospacer
******************************

3. spacer 1.11|1421989|30|CP024058|CRISPRCasFinder,CRT matches to MG788324 (Lactobacillus phage PM411, complete genome) position: , mismatch: 0, identity: 1.0

caatgtcacggtcaaagaatacacgtttaa	CRISPR spacer
caatgtcacggtcaaagaatacacgtttaa	Protospacer
******************************

4. spacer 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP018210 (Lactobacillus plantarum strain BLS41 plasmid pLPBLS41_1, complete sequence) position: , mismatch: 1, identity: 0.967

taatgccaaccgcttgttagcttcaatctt	CRISPR spacer
taatgccaaccgcttgttagcctcaatctt	Protospacer
*********************.********

5. spacer 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT matches to X90511 (Lactobacillus bacteriophage phig1e DNA for Rorf162, Holin, Lysin, and Rorf175 genes) position: , mismatch: 2, identity: 0.933

cgtattgcttgccgggccggttgctagata	CRISPR spacer
cgtattgcttgatgggccggttgctagata	Protospacer
*********** .*****************

6. spacer 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT matches to NC_004305 (Lactobacillus phage phig1e, complete genome) position: , mismatch: 2, identity: 0.933

cgtattgcttgccgggccggttgctagata	CRISPR spacer
cgtattgcttgatgggccggttgctagata	Protospacer
*********** .*****************

7. spacer 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT matches to X98106 (Lactobacillus bacteriophage phig1e complete genomic DNA) position: , mismatch: 2, identity: 0.933

cgtattgcttgccgggccggttgctagata	CRISPR spacer
cgtattgcttgatgggccggttgctagata	Protospacer
*********** .*****************

8. spacer 1.11|1421989|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP024415 (Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence) position: , mismatch: 2, identity: 0.933

caatgtcacggtcaaagaatacacgtttaa	CRISPR spacer
caacgtcacagtcaaagaatacacgtttaa	Protospacer
***.*****.********************

9. spacer 1.11|1421989|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP018210 (Lactobacillus plantarum strain BLS41 plasmid pLPBLS41_1, complete sequence) position: , mismatch: 2, identity: 0.933

caatgtcacggtcaaagaatacacgtttaa	CRISPR spacer
caacgtcacagtcaaagaatacacgtttaa	Protospacer
***.*****.********************

10. spacer 1.19|1421858|29|CP024058|PILER-CR matches to NC_004305 (Lactobacillus phage phig1e, complete genome) position: , mismatch: 2, identity: 0.931

gtattgcttgccgggccggttgctagata	CRISPR spacer
gtattgcttgatgggccggttgctagata	Protospacer
********** .*****************

11. spacer 1.19|1421858|29|CP024058|PILER-CR matches to X98106 (Lactobacillus bacteriophage phig1e complete genomic DNA) position: , mismatch: 2, identity: 0.931

gtattgcttgccgggccggttgctagata	CRISPR spacer
gtattgcttgatgggccggttgctagata	Protospacer
********** .*****************

12. spacer 1.19|1421858|29|CP024058|PILER-CR matches to X90511 (Lactobacillus bacteriophage phig1e DNA for Rorf162, Holin, Lysin, and Rorf175 genes) position: , mismatch: 2, identity: 0.931

gtattgcttgccgggccggttgctagata	CRISPR spacer
gtattgcttgatgggccggttgctagata	Protospacer
********** .*****************

13. spacer 1.17|1421726|29|CP024058|PILER-CR matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.897

cgctgcgtcacacgcacgcatcttactta	CRISPR spacer
ccctgcgtcacacgcacacatcttattta	Protospacer
* ***************.*******.***

14. spacer 1.7|1421725|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.867

tcgctgcgtcacacgcacgcatcttactta	CRISPR spacer
gccctgcgtcacacgcacacatcttattta	Protospacer
 * ***************.*******.***

15. spacer 1.13|1422121|30|CP024058|CRISPRCasFinder,CRT matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 4, identity: 0.867

atattaggtcagcgttgcatagaactttaa	CRISPR spacer
tgattaggtcagcgttgcatagcaccttaa	Protospacer
  ******************** **.****

16. spacer 1.13|1422121|30|CP024058|CRISPRCasFinder,CRT matches to JN051154 (Pediococcus phage clP1, complete genome) position: , mismatch: 4, identity: 0.867

atattaggtcagcgttgcatagaactttaa	CRISPR spacer
tgattaggtcagcgttgcatagcaccttaa	Protospacer
  ******************** **.****

17. spacer 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 6, identity: 0.8

cgtattgcttgccgggccggttgctagata	CRISPR spacer
cgtgttgcttgccaggccggttgacagcga	Protospacer
***.*********.********* .**  *

18. spacer 1.17|1421726|29|CP024058|PILER-CR matches to KC292026 (Halovirus HGTV-1, complete genome) position: , mismatch: 6, identity: 0.793

cgctgcgtcacacgcacgcatcttactta	CRISPR spacer
tcgtgcgtgacaggcacgcatcttacttt	Protospacer
.  ***** *** *************** 

19. spacer 1.4|1421527|30|CP024058|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 7, identity: 0.767

taatgccaaccgcttgttagcttcaatctt	CRISPR spacer
taatgccagccgcttgttcgcttcttcact	Protospacer
********.********* *****  . .*

20. spacer 1.7|1421725|30|CP024058|CRISPRCasFinder,CRT matches to KC292026 (Halovirus HGTV-1, complete genome) position: , mismatch: 7, identity: 0.767

tcgctgcgtcacacgcacgcatcttactta	CRISPR spacer
ctcgtgcgtgacaggcacgcatcttacttt	Protospacer
..  ***** *** *************** 

21. spacer 1.9|1421857|30|CP024058|CRISPRCasFinder,CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cgtattgcttgccgggccggttgctagata	CRISPR spacer
cgtattgctcgccgggccgcttggttcgaa	Protospacer
*********.********* *** *  . *

22. spacer 1.16|1421660|29|CP024058|PILER-CR matches to MN694430 (Marine virus AFVG_250M44, complete genome) position: , mismatch: 8, identity: 0.724

actccgggcctctttagctttagactcag	CRISPR spacer
tgtccgggtctctttatctttagacatcc	Protospacer
  ******.******* ******** .  

23. spacer 1.16|1421660|29|CP024058|PILER-CR matches to MN692992 (Marine virus AFVG_117M93, complete genome) position: , mismatch: 8, identity: 0.724

actccgggcctctttagctttagactcag	CRISPR spacer
tgtccgggtctctttatctttagacatcc	Protospacer
  ******.******* ******** .  

24. spacer 1.6|1421659|30|CP024058|CRISPRCasFinder,CRT matches to MN694430 (Marine virus AFVG_250M44, complete genome) position: , mismatch: 9, identity: 0.7

cactccgggcctctttagctttagactcag	CRISPR spacer
ttgtccgggtctctttatctttagacatcc	Protospacer
.  ******.******* ******** .  

25. spacer 1.6|1421659|30|CP024058|CRISPRCasFinder,CRT matches to MN692992 (Marine virus AFVG_117M93, complete genome) position: , mismatch: 9, identity: 0.7

cactccgggcctctttagctttagactcag	CRISPR spacer
ttgtccgggtctctttatctttagacatcc	Protospacer
.  ******.******* ******** .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage