Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 0 crisprs NA 0 0 0 0
CP033137 Vibrio owensii strain 1700302 chromosome 1, complete sequence 0 crisprs DEDDh,cas3,WYL,csx1,DinG,cas2,csa3 0 0 5 0
CP033140 Vibrio owensii strain 1700302 plasmid pVOWZ2, complete sequence 0 crisprs NA 0 0 0 0
CP033138 Vibrio owensii strain 1700302 chromosome 2, complete sequence 1 crisprs csx1,csa3,cas3,cas5f,cas7f,cas6f 0 1 4 0

Results visualization

1. CP033138
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033138_3 1556076-1556158 Unclear NA
1 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033138_3 3.1|1556099|37|CP033138|CRISPRCasFinder 1556099-1556135 37 NZ_AP019800 Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence 27654-27690 7 0.811

1. spacer 3.1|1556099|37|CP033138|CRISPRCasFinder matches to NZ_AP019800 (Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence) position: , mismatch: 7, identity: 0.811

ctgataattatggcgttggtgctgctaaacttcctcc	CRISPR spacer
aaataaactatggcgttcgtgctgctaaacttcctcc	Protospacer
  .  **.********* *******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 930608 : 940880 17 Vibrio_phage(87.5%) NA NA
DBSCAN-SWA_2 948740 : 962938 18 Vibrio_phage(69.23%) portal,terminase,capsid NA
DBSCAN-SWA_3 1491903 : 1524296 27 Bacillus_virus(28.57%) transposase,holin NA
DBSCAN-SWA_4 2152149 : 2194342 49 Vibrio_phage(37.5%) tail,capsid,head,plate,integrase attL 2143089:2143106|attR 2178586:2178603
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033137
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 557593 : 575142 15 uncultured_Mediterranean_phage(18.18%) tRNA NA
DBSCAN-SWA_2 1677730 : 1687307 15 Vibrio_phage(42.86%) NA NA
DBSCAN-SWA_3 2725861 : 2735438 15 Vibrio_phage(42.86%) NA NA
DBSCAN-SWA_4 2950534 : 2957221 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_5 3034865 : 3041931 9 Megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage