| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| CP033081 | Glutamicibacter nicotianae strain OTC-16 chromosome, complete genome | 1 crisprs | 7 | 1 | 0 | 0 | |
| CP033083 | Glutamicibacter nicotianae strain OTC-16 plasmid unnamed2, complete sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| CP033082 | Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence | 1 crisprs | 0 | 2 | 0 | 0 |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| CP033081_1 | 2827786-2828595 | Orphan |
NA
|
10 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| CP033081_1 | 2828476-2828493 | 18 | CP033081.1 | 2827780-2827797 | 0 | 1.0 | |
| CP033081_1 | 2828560-2828577 | 18 | CP033081.1 | 2827780-2827797 | 0 | 1.0 | |
| CP033081_1 | 2828332-2828385 | 54 | CP033081.1 | 2828560-2828613 | 1 | 0.981 | |
| CP033081_1 | 2828404-2828457 | 54 | CP033081.1 | 2828560-2828613 | 1 | 0.981 | |
| CP033081_1 | 2828476-2828493 | 18 | CP033081.1 | 2828596-2828613 | 1 | 0.944 | |
| CP033081_1 | 2828560-2828577 | 18 | CP033081.1 | 2828596-2828613 | 1 | 0.944 | |
| CP033081_1 | 2827804-2827881 | 78 | CP033081.1 | 2828524-2828601 | 18 | 0.769 | |
| CP033081_1 | 2828236-2828313 | 78 | CP033081.1 | 2828536-2828613 | 18 | 0.769 | |
| CP033081_1 | 2827900-2828001 | 102 | CP033081.1 | 2827780-2827881 | 42 | 0.588 |
cgtcagcggtcgaatcag CRISPR spacer cgtcagcggtcgaatcag Protospacer ******************
cgtcagcggtcgaatcag CRISPR spacer cgtcagcggtcgaatcag Protospacer ******************
cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgaatcag CRISPR spacer cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgcatcag Protospacer ************************************************ *****
cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgaatcag CRISPR spacer cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgcatcag Protospacer ************************************************ *****
cgtcagcggtcgaatcag CRISPR spacer cgtcagcggtcgcatcag Protospacer ************ *****
cgtcagcggtcgaatcag CRISPR spacer cgtcagcggtcgcatcag Protospacer ************ *****
catcggcagtagcgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttg CRISPR spacer catcggcagtagcgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttg Protospacer ************************************************************
cgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttgcatcggcagtag CRISPR spacer cgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttgcatcggcagtag Protospacer ************************************************************
cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcagttgcatcggcagtag CRISPR spacer cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcagttgcatcggcagtag Protospacer ************************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| CP033081_1 | 2828512-2828541 | 30 | NZ_CP026517 | Deinococcus sp. NW-56 plasmid unnamed1, complete sequence | 324428-324457 | 7 | 0.767 | |
| CP033081_1 | 2828512-2828541 | 30 | NZ_CP019063 | Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence | 502010-502039 | 8 | 0.733 | |
| CP033081_1 | 2828512-2828541 | 30 | NZ_CP019063 | Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence | 502815-502844 | 8 | 0.733 | |
| CP033081_1 | 2828512-2828541 | 30 | NZ_CP019063 | Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence | 503623-503652 | 8 | 0.733 | |
| CP033081_1 | 2828512-2828541 | 30 | MG592425 | Vibrio phage 1.042.O._10N.286.45.B8, partial genome | 18831-18860 | 8 | 0.733 | |
| CP033081_1 | 2828512-2828541 | 30 | MG592448 | Vibrio phage 1.071.A._10N.286.46.A12, partial genome | 19230-19259 | 8 | 0.733 | |
| CP033081_1 | 2828512-2828541 | 30 | MG592400 | Vibrio phage 1.016.O._10N.286.46.A11, partial genome | 18951-18980 | 8 | 0.733 | |
| CP033081_1 | 2828512-2828541 | 30 | AP013821 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15A-MedDCM-OCT-S23-C116, *** SEQUENCING IN PROGRESS *** | 8322-8351 | 10 | 0.667 | |
| CP033081_1 | 2828512-2828541 | 30 | AP013507 | Uncultured Mediterranean phage uvMED DNA, complete genome, group G2, isolate: uvMED-CGR-C15A-MedDCM-OCT-S31-C20 | 14085-14114 | 10 | 0.667 |
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer ccacagcagttgcagcggcagcagcgcgat Protospacer * *********** ******.****. *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer
ataaagcatttgcatcggcagcagcgtgat Protospacer
**** ************.***** *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer
ataaagcatttgcatcggcagcagcgtgat Protospacer
**** ************.***** *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer
ataaagcatttgcatcggcagcagcgtgat Protospacer
**** ************.***** *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer tgtcagcagttgcaacgtcagtagatgaat Protospacer .************* ** ****** *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer tgtcagcagttgcaacgtcagtagatgaat Protospacer .************* ** ****** *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer tgtcagcagttgcaacgtcagtagatgaat Protospacer .************* ** ****** *
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer gagtagcagttggatcggcagtagctctta Protospacer . .******** ************ .. .
cgtcagcagttgcatcggcagtagcgtcag CRISPR spacer gagtagcagttggatcggcagtagctctta Protospacer . .******** ************ .. .
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| CP033082_1 | 92275-92311 | 37 | NZ_CP033082 | Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence | 92265-92301 | 0 | 1.0 | |
| CP033082_1 | 92182-92244 | 63 | NZ_CP033082 | Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence | 92177-92239 | 3 | 0.952 | |
| CP033082_1 | 92275-92311 | 37 | NZ_CP033082 | Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence | 92139-92175 | 7 | 0.811 |
tcagtgaaggaagttttccacgtgcaatcggtgacgc CRISPR spacer tcagtgaaggaagttttccacgtgcaatcggtgacgc Protospacer *************************************
cctattgcagcgggtgtggataattttctggaggagttaatccgtgtgttttcagggatg CRISPR spacer cctattgcagcgggtgtggataattttctggaggagttaatccgtgtgttttcagggatg Protospacer ************************************************************
tcagtgaaggaagttttccacgtgcaatcggtgacgc CRISPR spacer tggatagagcaagttatccacgtgcaatcggtgacgc Protospacer * ..*..** ***** *********************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|