Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033076 Buttiauxella sp. 3AFRM03 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,DinG,WYL 0 1 15 0
CP033075 Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence 0 crisprs RT 0 0 5 0
CP033074 Buttiauxella sp. 3AFRM03 plasmid pBTX_120, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033076
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033076_2 3801104-3801180 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033076_2 2.1|3801130|25|CP033076|CRISPRCasFinder 3801130-3801154 25 CP053334 Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed2, complete sequence 63321-63345 4 0.84

1. spacer 2.1|3801130|25|CP033076|CRISPRCasFinder matches to CP053334 (Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

taatgcaaatcggttttcgtagggc	CRISPR spacer
taatgcatatcggtttttgtaggtt	Protospacer
******* *********.***** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15826 : 62285 75 Edwardsiella_phage(30.51%) tail,plate,terminase,integrase,head attL 1937:1952|attR 37290:37305
DBSCAN-SWA_2 729056 : 828201 113 Enterobacteria_phage(24.07%) tail,transposase,tRNA,portal,plate,terminase,integrase,capsid,head attL 730653:730668|attR 817457:817472
DBSCAN-SWA_3 910749 : 975179 65 Cronobacter_phage(33.33%) tail,transposase,portal,holin,terminase,integrase,capsid,head attL 922207:922221|attR 971119:971133
DBSCAN-SWA_4 1103798 : 1113661 16 Vibrio_phage(44.44%) terminase,tail,transposase,plate NA
DBSCAN-SWA_5 1429578 : 1504156 57 Shigella_phage(17.65%) transposase,plate NA
DBSCAN-SWA_6 2296136 : 2375240 82 Salmonella_phage(19.64%) lysis,tail,transposase,tRNA,portal,plate,holin,terminase,integrase,capsid,head attL 2301731:2301779|attR 2335551:2335599
DBSCAN-SWA_7 3460937 : 3509924 50 uncultured_Caudovirales_phage(50.0%) terminase,protease,integrase,tRNA attL 3460891:3460912|attR 3471785:3471806
DBSCAN-SWA_8 3877477 : 3891948 14 Morganella_phage(22.22%) tRNA NA
DBSCAN-SWA_9 4168894 : 4177676 13 Enterobacteria_phage(80.0%) capsid NA
DBSCAN-SWA_10 4698422 : 4782802 80 Escherichia_phage(29.55%) lysis,tail,transposase,tRNA,portal,plate,terminase,holin,integrase,capsid,head attL 4749830:4749854|attR 4781143:4781167
DBSCAN-SWA_11 4832773 : 4839113 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_12 4931169 : 4972873 39 Mycoplasma_phage(15.38%) holin,transposase,integrase,tRNA attL 4950208:4950223|attR 4967209:4967224
DBSCAN-SWA_13 5054874 : 5109771 74 Vibrio_phage(18.18%) tail,tRNA,portal,plate,terminase,protease,integrase attL 5054718:5054734|attR 5096584:5096600
DBSCAN-SWA_14 5226237 : 5288602 59 Escherichia_phage(13.04%) protease,transposase NA
DBSCAN-SWA_15 5312943 : 5319444 11 Enterobacteria_phage(16.67%) integrase attL 5312546:5312557|attR 5314188:5314199
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033075
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8812 9 Macacine_betaherpesvirus(25.0%) integrase attL 3293:3306|attR 19238:19251
DBSCAN-SWA_2 20608 : 22339 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_3 36713 : 38903 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_4 43041 : 46881 4 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_5 52242 : 54078 4 Vibrio_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage