Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033051 Bacillus marisflavi strain Bac144 chromosome, complete genome 4 crisprs NA 0 2 0 0

Results visualization

1. CP033051
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033051_1 1000457-1000530 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033051_2 1894088-1894162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033051_3 3162475-3162548 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033051_4 3929745-3929819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033051_4 4.1|3929769|27|CP033051|CRISPRCasFinder 3929769-3929795 27 MT210152 Bacillus phage Gp, complete genome 10229-10255 6 0.778
CP033051_3 3.1|3162498|28|CP033051|CRISPRCasFinder 3162498-3162525 28 NZ_CP041104 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed5, complete sequence 25947-25974 7 0.75

1. spacer 4.1|3929769|27|CP033051|CRISPRCasFinder matches to MT210152 (Bacillus phage Gp, complete genome) position: , mismatch: 6, identity: 0.778 

tcaaataaagctttcattttaggggtg	CRISPR spacer
tcaaataaagttttcattttatgacat	Protospacer
**********.********** *.

2. spacer 3.1|3162498|28|CP033051|CRISPRCasFinder matches to NZ_CP041104 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.75 

agtgacaaaaaacggttcttgagggggg	CRISPR spacer
atcgacaaaaaacggttcttgagcaact	Protospacer
* .******************** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage